CRISPR_ID |
Spacer_Info |
Spacer_region |
Spacer_length |
Hit_phage_ID |
Hit_phage_def |
Protospacer_location |
Mismatch |
Identity |
AP018536_2 |
2.4|713715|28|AP018536|PILER-CR,CRT |
713715-713742 |
28 |
NZ_AP017297 |
Nostoc sp. NIES-3756 plasmid pNOS3756_2, complete sequence |
35176-35203 |
6 |
0.786 |
AP018536_2 |
2.3|713646|33|AP018536|PILER-CR,CRT |
713646-713678 |
33 |
NZ_CP013755 |
Lactobacillus plantarum strain DF plasmid unnamed2, complete sequence |
54886-54918 |
9 |
0.727 |
AP018536_2 |
2.3|713646|33|AP018536|PILER-CR,CRT |
713646-713678 |
33 |
NZ_CP013751 |
Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence |
653-685 |
9 |
0.727 |
AP018536_2 |
2.3|713646|33|AP018536|PILER-CR,CRT |
713646-713678 |
33 |
NZ_CP013751 |
Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence |
62781-62813 |
9 |
0.727 |
1. spacer 2.4|713715|28|AP018536|PILER-CR,CRT matches to NZ_AP017297 (Nostoc sp. NIES-3756 plasmid pNOS3756_2, complete sequence) position: , mismatch: 6, identity: 0.786
atgtgggtatagcctatgtggttaccgg CRISPR spacer
tagtgggtatagcctctgtggttttagg Protospacer
************* ******* . **
2. spacer 2.3|713646|33|AP018536|PILER-CR,CRT matches to NZ_CP013755 (Lactobacillus plantarum strain DF plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
ttaagtggtgcttagtgatttttttattgttaa CRISPR spacer
ttgcagtgttcttagtaatttttttattgtttg Protospacer
**. . ** ******.************** .
3. spacer 2.3|713646|33|AP018536|PILER-CR,CRT matches to NZ_CP013751 (Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
ttaagtggtgcttagtgatttttttattgttaa CRISPR spacer
ttgcagtgttcttagtaatttttttattgtttg Protospacer
**. . ** ******.************** .
4. spacer 2.3|713646|33|AP018536|PILER-CR,CRT matches to NZ_CP013751 (Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
ttaagtggtgcttagtgatttttttattgttaa CRISPR spacer
ttgcagtgttcttagtaatttttttattgtttg Protospacer
**. . ** ******.************** .