Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP023642 Flavobacterium anhuiense strain M168 chromosome, complete genome 13 crisprs NA 0 3 0 0

Results visualization

1. CP023642
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_1 40427-40545 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_2 382993-383097 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_3 1032536-1032615 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_4 1133507-1133662 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_5 1247384-1247494 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_6 1925596-1925695 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_7 3548207-3548430 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_8 3602183-3602266 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_9 3724133-3724246 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_10 4581445-4581522 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_11 4583773-4583876 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_12 4806490-4806578 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023642_13 5373247-5373377 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP023642_7 7.2|3548295|29|CP023642|CRISPRCasFinder 3548295-3548323 29 NZ_CP033935 Chryseobacterium balustinum strain KC_1863 plasmid unnamed, complete sequence 17201-17229 6 0.793
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 NC_018510 Bacillus thuringiensis HD-789 plasmid pBTHD789-3, complete sequence 203311-203342 7 0.781
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 NZ_CP013280 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-5-100K, complete sequence 63517-63548 7 0.781
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 NZ_CP039726 Bacillus thuringiensis strain BT-59 plasmid p5, complete sequence 72563-72594 7 0.781
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 NZ_CP009350 Bacillus thuringiensis HD1002 plasmid 4, complete sequence 92347-92378 7 0.781
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 479559-479590 7 0.781
CP023642_7 7.2|3548295|29|CP023642|CRISPRCasFinder 3548295-3548323 29 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 490517-490545 7 0.759
CP023642_7 7.2|3548295|29|CP023642|CRISPRCasFinder 3548295-3548323 29 KT895374 Bacillus phage vB_BpuM-BpSp, complete genome 103359-103387 7 0.759
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 NZ_CP017573 Bacillus thuringiensis strain SCG04-02 plasmid PSCG61, complete sequence 54767-54798 8 0.75
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 MN855778 Myoviridae sp. isolate 416, complete genome 10860-10891 8 0.75
CP023642_12 12.1|4806519|31|CP023642|CRISPRCasFinder 4806519-4806549 31 NZ_CP046704 Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence 51510-51540 8 0.742
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 59532-59563 9 0.719
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 MN693753 Marine virus AFVG_250M679, complete genome 6054-6085 9 0.719
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 NZ_CP032531 Bacillus megaterium NCT-2 plasmid pNCT2_3, complete sequence 1036-1067 10 0.688
CP023642_7 7.1|3548235|32|CP023642|CRISPRCasFinder 3548235-3548266 32 KT995479 Bacillus phage BM5, complete genome 25703-25734 10 0.688

1. spacer 7.2|3548295|29|CP023642|CRISPRCasFinder matches to NZ_CP033935 (Chryseobacterium balustinum strain KC_1863 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

aaaggtaataaaagctctttttttagact	CRISPR spacer
agaacttataaaagctctttttttaaaca	Protospacer
*.*. * ******************.**

2. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to NC_018510 (Bacillus thuringiensis HD-789 plasmid pBTHD789-3, complete sequence) position: , mismatch: 7, identity: 0.781 

cgggataacataaaatccttttttttataact	CRISPR spacer
taaaataacataaaatccttatttttatagat	Protospacer
....**************** ********. *

3. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to NZ_CP013280 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-5-100K, complete sequence) position: , mismatch: 7, identity: 0.781 

cgggataacataaaatccttttttttataact	CRISPR spacer
taaaataacataaaatccttatttttatagat	Protospacer
....**************** ********. *

4. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to NZ_CP039726 (Bacillus thuringiensis strain BT-59 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781 

cgggataacataaaatccttttttttataact	CRISPR spacer
taaaataacataaaatccttatttttatagat	Protospacer
....**************** ********. *

5. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to NZ_CP009350 (Bacillus thuringiensis HD1002 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.781 

cgggataacataaaatccttttttttataact	CRISPR spacer
taaaataacataaaatccttatttttatagat	Protospacer
....**************** ********. *

6. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 7, identity: 0.781 

cgggataacataaaatccttttttttataact--	CRISPR spacer
gtggatgacataaaatcgttttttt--taattgg	Protospacer
  ****.********** *******  ***.*

7. spacer 7.2|3548295|29|CP023642|CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 7, identity: 0.759 

aaaggtaataaaagctctttttttagact	CRISPR spacer
ttaaccaataaaagctcttgttttagaca	Protospacer
  *. .************* ********

8. spacer 7.2|3548295|29|CP023642|CRISPRCasFinder matches to KT895374 (Bacillus phage vB_BpuM-BpSp, complete genome) position: , mismatch: 7, identity: 0.759 

aaaggtaataaaagctctttttttagact	CRISPR spacer
tcgattaaaaaaagatctttttttagact	Protospacer
  .. *** ***** **************

9. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to NZ_CP017573 (Bacillus thuringiensis strain SCG04-02 plasmid PSCG61, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggataacataaaatccttttttttataact	CRISPR spacer
aaaaataacataaaaaccttatttttatagat	Protospacer
 ...*********** **** ********. *

10. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to MN855778 (Myoviridae sp. isolate 416, complete genome) position: , mismatch: 8, identity: 0.75 

cgggataacataaaatccttttttttataact	CRISPR spacer
agcgataaaataaaatccgtttttttcttgca	Protospacer
 * ***** ********* ******* * .*

11. spacer 12.1|4806519|31|CP023642|CRISPRCasFinder matches to NZ_CP046704 (Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence) position: , mismatch: 8, identity: 0.742 

caaaaaataaactctttagtctcaatttcat	CRISPR spacer
gctgataaaaactctttagtcgcattttcat	Protospacer
   .* * ************* ** ******

12. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggataacataaaatccttttttttataact	CRISPR spacer
gcggatgacataaaatccttatttttaatcga	Protospacer
  ****.************* ******

13. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to MN693753 (Marine virus AFVG_250M679, complete genome) position: , mismatch: 9, identity: 0.719 

cgggataacataaaatccttttttttataact	CRISPR spacer
tatgtctgcaaaaaatcctttttttaataact	Protospacer
.. * . .** ************** ******

14. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to NZ_CP032531 (Bacillus megaterium NCT-2 plasmid pNCT2_3, complete sequence) position: , mismatch: 10, identity: 0.688 

cgggataacataaaatccttttttttataact	CRISPR spacer
tttaaaaacataaaatcctggtttttatacaa	Protospacer
.  .* *************  ********

15. spacer 7.1|3548235|32|CP023642|CRISPRCasFinder matches to KT995479 (Bacillus phage BM5, complete genome) position: , mismatch: 10, identity: 0.688 

cgggataacataaaatccttttttttataact	CRISPR spacer
tctcttttaataaattcctttttattataact	Protospacer
.    *   ***** ******** ********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage