Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024083 Vibrio cholerae strain FORC_073 chromosome 2, complete sequence 0 crisprs csa3,RT,cas3 0 0 1 0
CP024082 Vibrio cholerae strain FORC_073 chromosome 1, complete sequence 1 crisprs RT,cas3,DEDDh,DinG,csx1,csa3,WYL 0 1 3 0

Results visualization

1. CP024083
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 433305 : 445038 21 Shigella_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP024082
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024082_1 2597626-2597869 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024082_1 1.1|2597675|37|CP024082|PILER-CR 2597675-2597711 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 4 0.892
CP024082_1 1.1|2597675|37|CP024082|PILER-CR 2597675-2597711 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 4 0.892

1. spacer 1.1|2597675|37|CP024082|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*********************.***********. *

2. spacer 1.1|2597675|37|CP024082|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
******.***************.*********** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 677350 : 683967 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 2298645 : 2305838 9 Anguillid_herpesvirus(16.67%) NA NA
DBSCAN-SWA_3 2944645 : 2950166 7 Shigella_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage