Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 0 crisprs cas14j 0 0 0 0
CP032380 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU1-USMARC-69807, complete sequence 0 crisprs DEDDh 0 0 1 0
CP032379 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 chromosome, complete genome 2 crisprs PD-DExK,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,cas3,DEDDh,DinG 0 1 11 0

Results visualization

1. CP032380
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 37158 : 65303 34 Escherichia_phage(30.0%) transposase,head,integrase,tail attL 43241:43255|attR 66005:66019
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP032379
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032379_1 974769-975039 TypeI-E I-E
4 spacers
cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032379_2 991199-991347 TypeI-E I-E
2 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032379_1 1.2|974859|32|CP032379|PILER-CR 974859-974890 32 MG592432 Vibrio phage 1.050.O._10N.286.48.A6, partial genome 21687-21718 8 0.75
CP032379_1 1.2|974859|32|CP032379|PILER-CR 974859-974890 32 MG592431 Vibrio phage 1.049.O._10N.286.54.B5, partial genome 21426-21457 8 0.75
CP032379_1 1.2|974859|32|CP032379|PILER-CR 974859-974890 32 NC_047790 Pseudoalteromonas phage C5a, complete genome 34441-34472 9 0.719

1. spacer 1.2|974859|32|CP032379|PILER-CR matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa	Protospacer
   *.* ************* ****** ** *

2. spacer 1.2|974859|32|CP032379|PILER-CR matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa	Protospacer
   *.* ************* ****** ** *

3. spacer 1.2|974859|32|CP032379|PILER-CR matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
tttggtgtctgtgccgttttcgtcaataagct	Protospacer
.*    ********.*** ********** * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1152487 : 1218260 64 Salmonella_phage(87.8%) lysis,portal,integrase,tail,head,plate,transposase,capsid,tRNA attL 1155524:1155539|attR 1168791:1168806
DBSCAN-SWA_2 1481366 : 1487405 6 Salmonella_virus(50.0%) NA NA
DBSCAN-SWA_3 1723602 : 1732773 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1799970 : 1810477 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_5 1923405 : 1969616 64 Salmonella_phage(84.91%) terminase,integrase,tail,head,plate,holin,transposase,capsid attL 1921377:1921391|attR 1941697:1941711
DBSCAN-SWA_6 2661812 : 2760346 108 Enterobacteria_phage(24.0%) lysis,protease,terminase,portal,integrase,tail,holin,tRNA attL 2691595:2691610|attR 2760347:2760511
DBSCAN-SWA_7 2862445 : 2872153 12 Burkholderia_phage(28.57%) NA NA
DBSCAN-SWA_8 2957073 : 3001036 44 Escherichia_phage(33.33%) tail,protease NA
DBSCAN-SWA_9 3007978 : 3033612 32 Salmonella_phage(72.41%) terminase,holin NA
DBSCAN-SWA_10 3104581 : 3111894 7 Ralstonia_phage(16.67%) protease,integrase attL 3099637:3099651|attR 3110630:3110644
DBSCAN-SWA_11 3449351 : 3494988 68 Salmonella_phage(71.64%) lysis,coat,protease,terminase,portal,integrase,tail,holin attL 3449018:3449058|attR 3495006:3495046
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage