Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018530 Olsenella sp. GAM18 DNA, complete genome 5 crisprs NA 2 5 0 0

Results visualization

1. AP018530
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018530_1 360851-361214 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018530_2 496470-496615 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018530_3 596943-597018 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018530_4 849106-849254 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018530_5 2100156-2100260 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 AP018530.1 360825-360850 0 1.0
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 AP018530.1 360825-360850 0 1.0

1. spacer 1.2|360939|26|AP018530|CRT matches to position: 360825-360850, mismatch: 0, identity: 1.0 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggcttcggcggccgcgatgaccgtc	Protospacer
**************************

2. spacer 1.4|361056|26|AP018530|CRT matches to position: 360825-360850, mismatch: 0, identity: 1.0 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggcttcggcggccgcgatgaccgtc	Protospacer
**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018530_1 1.6|361167|23|AP018530|CRT 361167-361189 23 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 76332-76354 2 0.913
AP018530_1 1.6|361167|23|AP018530|CRT 361167-361189 23 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 84402-84424 2 0.913
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 107897-107922 3 0.885
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 882179-882204 3 0.885
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP029341 Streptomyces sp. SM17 plasmid pSM17C, complete sequence 12304-12329 3 0.885
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 107897-107922 3 0.885
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 882179-882204 3 0.885
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP029341 Streptomyces sp. SM17 plasmid pSM17C, complete sequence 12304-12329 3 0.885
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 670488-670513 4 0.846
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP032327 Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence 140632-140657 4 0.846
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 419388-419413 4 0.846
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_LR699074 Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2 5021-5046 4 0.846
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_LR536451 Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2 34321-34346 4 0.846
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 670488-670513 4 0.846
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP032327 Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence 140632-140657 4 0.846
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 419388-419413 4 0.846
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_LR699074 Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2 5021-5046 4 0.846
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_LR536451 Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2 34321-34346 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 LR606148 Rhizobium sp. Q54 genome assembly, plasmid: 5 281637-281662 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 LR606151 Rhizobium sp. Q54 genome assembly, plasmid: 8 54915-54940 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 NC_004041 Rhizobium etli CFN 42 plasmid p42d, complete sequence 208049-208074 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 NZ_LR723673 Rhizobium flavum strain YW14 plasmid 4 65798-65823 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 NZ_CP013633 Rhizobium sp. N324 plasmid pRspN324c, complete sequence 281568-281593 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 165724-165749 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 113792-113817 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 CP047390 Agrobacterium sp. CGMCC 11546 plasmid pB 156125-156150 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 133688-133713 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 NZ_CP040642 Agrobacterium sp. T29 plasmid unnamed2, complete sequence 31888-31913 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 964987-965012 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 133688-133713 4 0.846
AP018530_3 3.1|596968|26|AP018530|CRISPRCasFinder 596968-596993 26 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 279195-279220 4 0.846
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 228526-228551 5 0.808
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 126145-126170 5 0.808
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 21074-21099 5 0.808
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP029602 Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence 12692-12717 5 0.808
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP029602 Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence 59163-59188 5 0.808
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NC_006912 Streptomyces sp. FQ1 plasmid pFP1, complete sequence 19331-19356 5 0.808
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 228526-228551 5 0.808
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 126145-126170 5 0.808
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 21074-21099 5 0.808
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP029602 Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence 12692-12717 5 0.808
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP029602 Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence 59163-59188 5 0.808
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NC_006912 Streptomyces sp. FQ1 plasmid pFP1, complete sequence 19331-19356 5 0.808
AP018530_1 1.2|360939|26|AP018530|CRT 360939-360964 26 NZ_CP026306 Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence 34135-34160 6 0.769
AP018530_1 1.4|361056|26|AP018530|CRT 361056-361081 26 NZ_CP026306 Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence 34135-34160 6 0.769
AP018530_1 1.1|360876|38|AP018530|CRT 360876-360913 38 KT253150 Rhodobacter phage RcSaxon, complete genome 35207-35244 9 0.763
AP018530_1 1.1|360876|38|AP018530|CRT 360876-360913 38 NC_028954 Rhodobacter phage RcRhea, complete genome 35191-35228 9 0.763
AP018530_1 1.1|360876|38|AP018530|CRT 360876-360913 38 NC_042049 Rhodobacter phage RcCronus, complete genome 35111-35148 9 0.763
AP018530_1 1.1|360876|38|AP018530|CRT 360876-360913 38 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 521037-521074 9 0.763
AP018530_1 1.1|360876|38|AP018530|CRT 360876-360913 38 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 496531-496568 11 0.711

1. spacer 1.6|361167|23|AP018530|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 2, identity: 0.913 

cggctttggcggccgtgacagcc	CRISPR spacer
cggctttgaccgccgtgacagcc	Protospacer
********.* ************

2. spacer 1.6|361167|23|AP018530|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 2, identity: 0.913 

cggctttggcggccgtgacagcc	CRISPR spacer
cggctttggcagcggtgacagcc	Protospacer
**********.** *********

3. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggcttcggcggacgcgatgaacgta	Protospacer
************ ******** ***

4. spacer 1.2|360939|26|AP018530|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 3, identity: 0.885 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tgacttccgcggccgcgatgaccgac	Protospacer
**.**** **************** *

5. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP029341 (Streptomyces sp. SM17 plasmid pSM17C, complete sequence) position: , mismatch: 3, identity: 0.885 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggcttcggcggccacgatgacaggc	Protospacer
**************.******* * *

6. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggcttcggcggacgcgatgaacgta	Protospacer
************ ******** ***

7. spacer 1.4|361056|26|AP018530|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 3, identity: 0.885 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tgacttccgcggccgcgatgaccgac	Protospacer
**.**** **************** *

8. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP029341 (Streptomyces sp. SM17 plasmid pSM17C, complete sequence) position: , mismatch: 3, identity: 0.885 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggcttcggcggccacgatgacaggc	Protospacer
**************.******* * *

9. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cgacatcggcggccgcgatgaccgtg	Protospacer
.*.* ********************

10. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
ccgcttcggcggccgctatgacggtc	Protospacer
. ************** ***** ***

11. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggcttcgccggcggcgatgaccgcg	Protospacer
******** **** **********.

12. spacer 1.2|360939|26|AP018530|CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
agccttcgccggccgcgatgaccggc	Protospacer
 * ***** *************** *

13. spacer 1.2|360939|26|AP018530|CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tctcttcggcggcctcgatcaccgtc	Protospacer
*  *********** **** ******

14. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cgacatcggcggccgcgatgaccgtg	Protospacer
.*.* ********************

15. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
ccgcttcggcggccgctatgacggtc	Protospacer
. ************** ***** ***

16. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggcttcgccggcggcgatgaccgcg	Protospacer
******** **** **********.

17. spacer 1.4|361056|26|AP018530|CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
agccttcgccggccgcgatgaccggc	Protospacer
 * ***** *************** *

18. spacer 1.4|361056|26|AP018530|CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 4, identity: 0.846 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tctcttcggcggcctcgatcaccgtc	Protospacer
*  *********** **** ******

19. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

20. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to LR606151 (Rhizobium sp. Q54 genome assembly, plasmid: 8) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagtagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

21. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to NC_004041 (Rhizobium etli CFN 42 plasmid p42d, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

22. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to NZ_LR723673 (Rhizobium flavum strain YW14 plasmid 4) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagtagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

23. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

24. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

25. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

26. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

27. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

28. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to NZ_CP040642 (Agrobacterium sp. T29 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

29. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

30. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

31. spacer 3.1|596968|26|AP018530|CRISPRCasFinder matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgagaagggcggatttgggcccaa	CRISPR spacer
gacgagcagggcgcatttgggcccac	Protospacer
*.**** ****** ***********

32. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cgagatcggcggccgcgatgaccgtg	Protospacer
.*.  ********************

33. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggctccggcggccgcgatcaccagg	Protospacer
*****.************* ***.

34. spacer 1.2|360939|26|AP018530|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cttcttcggcggcggcgatggccgtc	Protospacer
.  ********** ******.*****

35. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cggcgtcggcggccgcgatgacgccc	Protospacer
.*** *****************  .*

36. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cggcgtcggcggccgcgatgacgccc	Protospacer
.*** *****************  .*

37. spacer 1.2|360939|26|AP018530|CRT matches to NC_006912 (Streptomyces sp. FQ1 plasmid pFP1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cggcgtcggcggccgcgatgacgccc	Protospacer
.*** *****************  .*

38. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cgagatcggcggccgcgatgaccgtg	Protospacer
.*.  ********************

39. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
tggctccggcggccgcgatcaccagg	Protospacer
*****.************* ***.

40. spacer 1.4|361056|26|AP018530|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cttcttcggcggcggcgatggccgtc	Protospacer
.  ********** ******.*****

41. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cggcgtcggcggccgcgatgacgccc	Protospacer
.*** *****************  .*

42. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cggcgtcggcggccgcgatgacgccc	Protospacer
.*** *****************  .*

43. spacer 1.4|361056|26|AP018530|CRT matches to NC_006912 (Streptomyces sp. FQ1 plasmid pFP1, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cggcgtcggcggccgcgatgacgccc	Protospacer
.*** *****************  .*

44. spacer 1.2|360939|26|AP018530|CRT matches to NZ_CP026306 (Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence) position: , mismatch: 6, identity: 0.769 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cggcgtcggcggccgcgatgacaccg	Protospacer
.*** *****************  .

45. spacer 1.4|361056|26|AP018530|CRT matches to NZ_CP026306 (Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence) position: , mismatch: 6, identity: 0.769 

tggcttcggcggccgcgatgaccgtc	CRISPR spacer
cggcgtcggcggccgcgatgacaccg	Protospacer
.*** *****************  .

46. spacer 1.1|360876|38|AP018530|CRT matches to KT253150 (Rhodobacter phage RcSaxon, complete genome) position: , mismatch: 9, identity: 0.763 

tggcggcgaccgtggcggccgcggcggctttggtggcc	CRISPR spacer
tggcggcggccgtggcggcggcggcggccgtgacccgc	Protospacer
********.********** ********. **..   *

47. spacer 1.1|360876|38|AP018530|CRT matches to NC_028954 (Rhodobacter phage RcRhea, complete genome) position: , mismatch: 9, identity: 0.763 

tggcggcgaccgtggcggccgcggcggctttggtggcc	CRISPR spacer
tggcggcggccgtggcggcggcggcggccgtgacccgc	Protospacer
********.********** ********. **..   *

48. spacer 1.1|360876|38|AP018530|CRT matches to NC_042049 (Rhodobacter phage RcCronus, complete genome) position: , mismatch: 9, identity: 0.763 

tggcggcgaccgtggcggccgcggcggctttggtggcc	CRISPR spacer
tggcggcggccgtggcggcggcggcggccgtgacccgc	Protospacer
********.********** ********. **..   *

49. spacer 1.1|360876|38|AP018530|CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 9, identity: 0.763 

tggcggcgaccgtggcggccgcggcggctttggtggcc	CRISPR spacer
gctcggcggccgcggcggccgcggcggctttcctcgct	Protospacer
   *****.***.******************  * **.

50. spacer 1.1|360876|38|AP018530|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 11, identity: 0.711 

tggcggcgaccgtggcggccgcggcggctttggtggcc	CRISPR spacer
cggcggcggccgcggcggccgcggcggccgcaagggaa	Protospacer
.*******.***.***************. ... **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage