Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032543 Streptomyces griseus subsp. griseus strain ATCC 13273 chromosome, complete genome 6 crisprs NA 0 1 0 0

Results visualization

1. CP032543
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032543_1 2027596-2027700 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032543_2 2570389-2570493 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032543_3 3819687-3819820 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032543_4 4437152-4437246 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032543_5 5052024-5052122 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032543_6 5162187-5162290 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032543_3 3.1|3819710|25|CP032543|CRISPRCasFinder 3819710-3819734 25 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 49342-49366 3 0.88
CP032543_3 3.1|3819710|25|CP032543|CRISPRCasFinder 3819710-3819734 25 NZ_CP015006 Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence 459516-459540 3 0.88
CP032543_3 3.1|3819710|25|CP032543|CRISPRCasFinder 3819710-3819734 25 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 155192-155216 3 0.88
CP032543_3 3.1|3819710|25|CP032543|CRISPRCasFinder 3819710-3819734 25 NZ_CP013381 Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence 267034-267058 4 0.84
CP032543_3 3.1|3819710|25|CP032543|CRISPRCasFinder 3819710-3819734 25 NZ_CP009547 Burkholderia sp. 2002721687 plasmid pBTU, complete sequence 155945-155969 4 0.84
CP032543_3 3.1|3819710|25|CP032543|CRISPRCasFinder 3819710-3819734 25 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 193512-193536 5 0.8
CP032543_3 3.1|3819710|25|CP032543|CRISPRCasFinder 3819710-3819734 25 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 221685-221709 5 0.8
CP032543_3 3.1|3819710|25|CP032543|CRISPRCasFinder 3819710-3819734 25 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 708255-708279 5 0.8

1. spacer 3.1|3819710|25|CP032543|CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 3, identity: 0.88 

cggcaactggggcggcggctccggt	CRISPR spacer
cggcggctggggcggcggctccggc	Protospacer
****..******************.

2. spacer 3.1|3819710|25|CP032543|CRISPRCasFinder matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 3, identity: 0.88 

cggcaactggggcggcggctccggt	CRISPR spacer
aggcaactgtggcggcggcaccggt	Protospacer
 ******** ********* *****

3. spacer 3.1|3819710|25|CP032543|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88 

cggcaactggggcggcggctccggt	CRISPR spacer
cggcatctggggcggcgtctccgga	Protospacer
***** *********** ******

4. spacer 3.1|3819710|25|CP032543|CRISPRCasFinder matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcaactggggcggcggctccggt	CRISPR spacer
cggcaactgggccggcggcttcgcg	Protospacer
*********** ********.**

5. spacer 3.1|3819710|25|CP032543|CRISPRCasFinder matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcaactggggcggcggctccggt	CRISPR spacer
cggcaactgggccggcggcttcgcg	Protospacer
*********** ********.**

6. spacer 3.1|3819710|25|CP032543|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 5, identity: 0.8 

cggcaactggggcggcggctccggt	CRISPR spacer
gggcaactggggcggcagctccaac	Protospacer
 ***************.*****...

7. spacer 3.1|3819710|25|CP032543|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.8 

cggcaactggggcggcggctccggt	CRISPR spacer
cggcaactggggcggcggcgagcgc	Protospacer
*******************    *.

8. spacer 3.1|3819710|25|CP032543|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.8 

cggcaactggggcggcggctccggt	CRISPR spacer
cggcaactggggcggcggcgagcgc	Protospacer
*******************    *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage