Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032656 Lactobacillus pentosus strain ZFM222 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
CP032654 Lactobacillus pentosus strain ZFM222 chromosome, complete genome 5 crisprs RT,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,DinG,csa3,DEDDh,WYL,cas9,cas1,cas2,csn2 0 32 11 0
CP032658 Lactobacillus pentosus strain ZFM222 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0
CP032657 Lactobacillus pentosus strain ZFM222 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
CP032655 Lactobacillus pentosus strain ZFM222 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. CP032654
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032654_1 647507-648691 Orphan NA
19 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032654_2 895993-896266 TypeI-E NA
4 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032654_3 896402-897201 TypeI-E NA
12 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032654_4 3064017-3065570 TypeII NA
23 spacers
csn2,cas2,cas1,cas9,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032654_5 3325825-3325903 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032654_3 3.6|896775|32|CP032654|CRISPRCasFinder 896775-896806 32 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 25805-25836 5 0.844
CP032654_3 3.6|896775|32|CP032654|CRISPRCasFinder 896775-896806 32 NC_006936 Lactobacillus phage phiJL-1, complete genome 36448-36479 5 0.844
CP032654_3 3.6|896775|32|CP032654|CRISPRCasFinder 896775-896806 32 AY236756 Lactobacillus plantarum bacteriophage phiJL-1, complete genome 36448-36479 5 0.844
CP032654_3 3.7|896836|32|CP032654|CRISPRCasFinder 896836-896867 32 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 25805-25836 5 0.844
CP032654_3 3.7|896836|32|CP032654|CRISPRCasFinder 896836-896867 32 NC_006936 Lactobacillus phage phiJL-1, complete genome 36448-36479 5 0.844
CP032654_3 3.7|896836|32|CP032654|CRISPRCasFinder 896836-896867 32 AY236756 Lactobacillus plantarum bacteriophage phiJL-1, complete genome 36448-36479 5 0.844
CP032654_3 3.15|896653|33|CP032654|CRT,PILER-CR 896653-896685 33 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 342218-342250 5 0.848
CP032654_4 4.10|3064647|30|CP032654|CRISPRCasFinder,CRT 3064647-3064676 30 MG592603 Vibrio phage 1.238.A._10N.261.52.F10, partial genome 64608-64637 5 0.833
CP032654_4 4.10|3064647|30|CP032654|CRISPRCasFinder,CRT 3064647-3064676 30 MG592610 Vibrio phage 1.245.O._10N.261.54.C7, partial genome 65780-65809 5 0.833
CP032654_4 4.10|3064647|30|CP032654|CRISPRCasFinder,CRT 3064647-3064676 30 MG592604 Vibrio phage 1.238.B._10N.261.52.F10, partial genome 64600-64629 5 0.833
CP032654_4 4.11|3064713|30|CP032654|CRISPRCasFinder,CRT 3064713-3064742 30 KX961631 Bacillus phage QCM11, complete genome 5017-5046 5 0.833
CP032654_1 1.2|647596|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 647596-647628 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 722945-722977 6 0.818
CP032654_1 1.19|648635|29|CP032654|CRISPRCasFinder,CRT,PILER-CR 648635-648663 29 MH319749 Marine virus AG-345-F15 Ga0172271_11 genomic sequence 13800-13828 6 0.793
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 196556-196587 6 0.812
CP032654_3 3.6|896775|32|CP032654|CRISPRCasFinder 896775-896806 32 NC_019489 Lactobacillus phage Sha1, complete genome 3815-3846 6 0.812
CP032654_3 3.7|896836|32|CP032654|CRISPRCasFinder 896836-896867 32 NC_019489 Lactobacillus phage Sha1, complete genome 3815-3846 6 0.812
CP032654_3 3.17|896775|33|CP032654|CRT,PILER-CR 896775-896807 33 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 25804-25836 6 0.818
CP032654_3 3.17|896775|33|CP032654|CRT,PILER-CR 896775-896807 33 NC_006936 Lactobacillus phage phiJL-1, complete genome 36447-36479 6 0.818
CP032654_3 3.17|896775|33|CP032654|CRT,PILER-CR 896775-896807 33 AY236756 Lactobacillus plantarum bacteriophage phiJL-1, complete genome 36447-36479 6 0.818
CP032654_3 3.18|896836|33|CP032654|CRT,PILER-CR 896836-896868 33 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 25804-25836 6 0.818
CP032654_3 3.18|896836|33|CP032654|CRT,PILER-CR 896836-896868 33 NC_006936 Lactobacillus phage phiJL-1, complete genome 36447-36479 6 0.818
CP032654_3 3.18|896836|33|CP032654|CRT,PILER-CR 896836-896868 33 AY236756 Lactobacillus plantarum bacteriophage phiJL-1, complete genome 36447-36479 6 0.818
CP032654_4 4.20|3065307|30|CP032654|CRISPRCasFinder,CRT,PILER-CR 3065307-3065336 30 NC_029065 Pseudomonas phage VCM genome assembly VCM, chromosome : 1 75027-75056 6 0.8
CP032654_4 4.21|3065373|30|CP032654|CRISPRCasFinder,CRT,PILER-CR 3065373-3065402 30 NC_019746 Gloeocapsa sp. PCC 7428 plasmid pGLO7428.01, complete sequence 103789-103818 6 0.8
CP032654_4 4.22|3065439|30|CP032654|CRISPRCasFinder,CRT,PILER-CR 3065439-3065468 30 NZ_CP043762 Paenibacillus sp. 37 plasmid pART37, complete sequence 4943-4972 6 0.8
CP032654_1 1.11|648146|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648146-648178 33 NZ_CP040462 Enterococcus sp. M190262 plasmid pM190262, complete sequence 102958-102990 7 0.788
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 72283-72314 7 0.781
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 70436-70467 7 0.781
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 128653-128684 7 0.781
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 144970-145001 7 0.781
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 111157-111188 7 0.781
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 KY092483 Streptomyces phage Bioscum, complete genome 9970-10001 7 0.781
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 MK305888 Streptomyces phage Austintatious, complete genome 9934-9965 7 0.781
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NC_047792 Streptomyces phage Ididsumtinwong, complete genome 9970-10001 7 0.781
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 KY092481 Streptomyces phage PapayaSalad, complete genome 9940-9971 7 0.781
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 JX182371 Streptomyces phage SV1, complete genome 10176-10207 7 0.781
CP032654_3 3.12|897141|32|CP032654|CRISPRCasFinder 897141-897172 32 NZ_LR215040 Mycoplasma columborale strain NCTC10179 plasmid 2 11055-11086 7 0.781
CP032654_3 3.12|897141|32|CP032654|CRISPRCasFinder 897141-897172 32 CP033541 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-1, complete sequence 100457-100488 7 0.781
CP032654_3 3.12|897141|32|CP032654|CRISPRCasFinder 897141-897172 32 MK496719 Capybara microvirus Cap1_SP_131, complete genome 1705-1736 7 0.781
CP032654_3 3.12|897141|32|CP032654|CRISPRCasFinder 897141-897172 32 MG770379 Klebsiella virus vB_KpnM_KpS110, complete genome 4557-4588 7 0.781
CP032654_3 3.12|897141|32|CP032654|CRISPRCasFinder 897141-897172 32 MN478483 Klebsiella virus UPM 2146, complete genome 13284-13315 7 0.781
CP032654_3 3.15|896653|33|CP032654|CRT,PILER-CR 896653-896685 33 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 196555-196587 7 0.788
CP032654_3 3.17|896775|33|CP032654|CRT,PILER-CR 896775-896807 33 NC_019489 Lactobacillus phage Sha1, complete genome 3814-3846 7 0.788
CP032654_3 3.18|896836|33|CP032654|CRT,PILER-CR 896836-896868 33 NC_019489 Lactobacillus phage Sha1, complete genome 3814-3846 7 0.788
CP032654_3 3.23|897141|33|CP032654|CRT,PILER-CR 897141-897173 33 NZ_LR215040 Mycoplasma columborale strain NCTC10179 plasmid 2 11055-11087 7 0.788
CP032654_4 4.12|3064779|30|CP032654|CRISPRCasFinder,CRT 3064779-3064808 30 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 302330-302359 7 0.767
CP032654_4 4.18|3065175|30|CP032654|CRISPRCasFinder,CRT,PILER-CR 3065175-3065204 30 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 474637-474666 7 0.767
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 71668-71699 8 0.75
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NZ_CP035507 Haematobacter massiliensis strain OT1 plasmid pOT1-7, complete sequence 80563-80594 8 0.75
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 MT708549 Burkholderia phage Maja, complete genome 8229-8260 8 0.75
CP032654_3 3.8|896897|32|CP032654|CRISPRCasFinder 896897-896928 32 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 311369-311400 8 0.75
CP032654_3 3.9|896958|32|CP032654|CRISPRCasFinder 896958-896989 32 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 311369-311400 8 0.75
CP032654_3 3.10|897019|32|CP032654|CRISPRCasFinder 897019-897050 32 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 311369-311400 8 0.75
CP032654_3 3.14|896591|34|CP032654|CRT,PILER-CR 896591-896624 34 MN856007 Siphoviridae sp. isolate 414, complete genome 1006-1039 8 0.765
CP032654_3 3.23|897141|33|CP032654|CRT,PILER-CR 897141-897173 33 MK496719 Capybara microvirus Cap1_SP_131, complete genome 1705-1737 8 0.758
CP032654_4 4.10|3064647|30|CP032654|CRISPRCasFinder,CRT 3064647-3064676 30 LT598654 Phage NCTB genome assembly, complete genome: monopartite 116136-116165 8 0.733
CP032654_4 4.12|3064779|30|CP032654|CRISPRCasFinder,CRT 3064779-3064808 30 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 124932-124961 8 0.733
CP032654_4 4.14|3064911|30|CP032654|CRISPRCasFinder,CRT 3064911-3064940 30 NZ_CP031226 Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence 237679-237708 8 0.733
CP032654_5 5.1|3325850|29|CP032654|CRISPRCasFinder 3325850-3325878 29 NZ_CP013691 Myroides odoratimimus strain PR63039 plasmid p63039, complete sequence 70648-70676 8 0.724
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 309740-309772 9 0.727
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 322504-322536 9 0.727
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 322504-322536 9 0.727
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 591841-591873 9 0.727
CP032654_1 1.10|648085|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648085-648117 33 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 109196-109228 9 0.727
CP032654_2 2.1|896022|32|CP032654|CRISPRCasFinder 896022-896053 32 NC_021727 Acinetobacter baumannii BJAB07104 plasmid p1BJAB07104, complete sequence 26947-26978 9 0.719
CP032654_2 2.1|896022|32|CP032654|CRISPRCasFinder 896022-896053 32 NZ_CP018422 Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence 54883-54914 9 0.719
CP032654_2 2.1|896022|32|CP032654|CRISPRCasFinder 896022-896053 32 NZ_CP018144 Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence 22610-22641 9 0.719
CP032654_2 2.1|896022|32|CP032654|CRISPRCasFinder 896022-896053 32 NC_017848 Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence 18975-19006 9 0.719
CP032654_2 2.1|896022|32|CP032654|CRISPRCasFinder 896022-896053 32 NZ_KM922672 Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence 26947-26978 9 0.719
CP032654_2 2.1|896022|32|CP032654|CRISPRCasFinder 896022-896053 32 NC_021731 Acinetobacter baumannii BJAB0868 plasmid p2BJAB0868, complete sequence 26947-26978 9 0.719
CP032654_2 2.1|896022|32|CP032654|CRISPRCasFinder 896022-896053 32 NZ_MK386682 Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence 37764-37795 9 0.719
CP032654_2 2.3|896144|32|CP032654|CRISPRCasFinder 896144-896175 32 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 233273-233304 9 0.719
CP032654_2 2.3|896144|32|CP032654|CRISPRCasFinder 896144-896175 32 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 197173-197204 9 0.719
CP032654_2 2.3|896144|32|CP032654|CRISPRCasFinder 896144-896175 32 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 105385-105416 9 0.719
CP032654_2 2.3|896144|32|CP032654|CRISPRCasFinder 896144-896175 32 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 323707-323738 9 0.719
CP032654_2 2.3|896144|32|CP032654|CRISPRCasFinder 896144-896175 32 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 91108-91139 9 0.719
CP032654_2 2.3|896144|32|CP032654|CRISPRCasFinder 896144-896175 32 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 323709-323740 9 0.719
CP032654_2 2.3|896144|32|CP032654|CRISPRCasFinder 896144-896175 32 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 167470-167501 9 0.719
CP032654_2 2.3|896144|32|CP032654|CRISPRCasFinder 896144-896175 32 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 323319-323350 9 0.719
CP032654_3 3.1|896431|32|CP032654|CRISPRCasFinder 896431-896462 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 348461-348492 9 0.719
CP032654_3 3.12|897141|32|CP032654|CRISPRCasFinder 897141-897172 32 NC_031046 Staphylococcus phage BP39, complete genome 1707-1738 9 0.719
CP032654_4 4.2|3064119|30|CP032654|CRISPRCasFinder,CRT 3064119-3064148 30 NC_009926 Acaryochloris marina MBIC11017 plasmid pREB1, complete sequence 294452-294481 9 0.7
CP032654_4 4.12|3064779|30|CP032654|CRISPRCasFinder,CRT 3064779-3064808 30 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 531636-531665 9 0.7
CP032654_4 4.12|3064779|30|CP032654|CRISPRCasFinder,CRT 3064779-3064808 30 MN862068 Brevundimonas phage vB_BsubS-Delta, complete genome 21159-21188 9 0.7
CP032654_4 4.18|3065175|30|CP032654|CRISPRCasFinder,CRT,PILER-CR 3065175-3065204 30 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 86232-86261 9 0.7
CP032654_4 4.18|3065175|30|CP032654|CRISPRCasFinder,CRT,PILER-CR 3065175-3065204 30 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 253751-253780 9 0.7
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 355053-355085 10 0.697
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 309681-309713 10 0.697
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 329136-329168 10 0.697
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 315926-315958 10 0.697
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 324101-324133 10 0.697
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 329136-329168 10 0.697
CP032654_1 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR 648024-648056 33 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 309681-309713 10 0.697
CP032654_3 3.5|896714|32|CP032654|CRISPRCasFinder 896714-896745 32 CAJCJZ010000002 Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence 7487-7518 10 0.688
CP032654_3 3.5|896714|32|CP032654|CRISPRCasFinder 896714-896745 32 MT119360 Enterococcus phage nattely, complete genome 77710-77741 10 0.688
CP032654_3 3.12|897141|32|CP032654|CRISPRCasFinder 897141-897172 32 NC_048677 Lactobacillus phage LpeD, complete genome 131509-131540 10 0.688
CP032654_3 3.12|897141|32|CP032654|CRISPRCasFinder 897141-897172 32 MT774376 CrAssphage cr55_1, complete genome 42192-42223 10 0.688
CP032654_3 3.12|897141|32|CP032654|CRISPRCasFinder 897141-897172 32 MT774380 CrAssphage cr1_1, complete genome 45960-45991 10 0.688
CP032654_3 3.16|896714|33|CP032654|CRT,PILER-CR 896714-896746 33 MT119360 Enterococcus phage nattely, complete genome 77710-77742 11 0.667
CP032654_3 3.16|896714|33|CP032654|CRT,PILER-CR 896714-896746 33 CAJCJZ010000002 Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence 7486-7518 11 0.667
CP032654_3 3.4|896653|32|CP032654|CRISPRCasFinder 896653-896684 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 342219-342250 18 0.438

1. spacer 3.6|896775|32|CP032654|CRISPRCasFinder matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844 

cttaccaattagcccacagcgattaccgtatc	CRISPR spacer
cttaccaattagcccacagcgattaccagtct	Protospacer
***************************.  ..

2. spacer 3.6|896775|32|CP032654|CRISPRCasFinder matches to NC_006936 (Lactobacillus phage phiJL-1, complete genome) position: , mismatch: 5, identity: 0.844 

cttaccaattagcccacagcgattaccgtatc	CRISPR spacer
cttaccaattagcccacagcgataaccgatct	Protospacer
*********************** ****  ..

3. spacer 3.6|896775|32|CP032654|CRISPRCasFinder matches to AY236756 (Lactobacillus plantarum bacteriophage phiJL-1, complete genome) position: , mismatch: 5, identity: 0.844 

cttaccaattagcccacagcgattaccgtatc	CRISPR spacer
cttaccaattagcccacagcgataaccgatct	Protospacer
*********************** ****  ..

4. spacer 3.7|896836|32|CP032654|CRISPRCasFinder matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844 

cttaccaattagcccacagcgattaccgtatc	CRISPR spacer
cttaccaattagcccacagcgattaccagtct	Protospacer
***************************.  ..

5. spacer 3.7|896836|32|CP032654|CRISPRCasFinder matches to NC_006936 (Lactobacillus phage phiJL-1, complete genome) position: , mismatch: 5, identity: 0.844 

cttaccaattagcccacagcgattaccgtatc	CRISPR spacer
cttaccaattagcccacagcgataaccgatct	Protospacer
*********************** ****  ..

6. spacer 3.7|896836|32|CP032654|CRISPRCasFinder matches to AY236756 (Lactobacillus plantarum bacteriophage phiJL-1, complete genome) position: , mismatch: 5, identity: 0.844 

cttaccaattagcccacagcgattaccgtatc	CRISPR spacer
cttaccaattagcccacagcgataaccgatct	Protospacer
*********************** ****  ..

7. spacer 3.15|896653|33|CP032654|CRT,PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.848 

gccccgat--gtcatcgagggcggcgcccccagcg	CRISPR spacer
--accgattggtcatcgaggggggcgccgccagcg	Protospacer
   *****  *********** ****** ******

8. spacer 4.10|3064647|30|CP032654|CRISPRCasFinder,CRT matches to MG592603 (Vibrio phage 1.238.A._10N.261.52.F10, partial genome) position: , mismatch: 5, identity: 0.833 

aataagccttttaatgccttgctcagggca	CRISPR spacer
agtaagccttttagtgtcttgctcaggacg	Protospacer
*.***********.**.**********.*.

9. spacer 4.10|3064647|30|CP032654|CRISPRCasFinder,CRT matches to MG592610 (Vibrio phage 1.245.O._10N.261.54.C7, partial genome) position: , mismatch: 5, identity: 0.833 

aataagccttttaatgccttgctcagggca	CRISPR spacer
agtaagccttttagtgtcttgctcaggacg	Protospacer
*.***********.**.**********.*.

10. spacer 4.10|3064647|30|CP032654|CRISPRCasFinder,CRT matches to MG592604 (Vibrio phage 1.238.B._10N.261.52.F10, partial genome) position: , mismatch: 5, identity: 0.833 

aataagccttttaatgccttgctcagggca	CRISPR spacer
agtaagccttttagtgtcttgctcaggacg	Protospacer
*.***********.**.**********.*.

11. spacer 4.11|3064713|30|CP032654|CRISPRCasFinder,CRT matches to KX961631 (Bacillus phage QCM11, complete genome) position: , mismatch: 5, identity: 0.833 

cagcaatgtgaatcgaatcagtgtcacaat	CRISPR spacer
cagttaaatgaatcgagtcagtgtcacaat	Protospacer
***. * .********.*************

12. spacer 1.2|647596|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.818 

ctttagcagtctgggccgctcgcccctgggcgg--	CRISPR spacer
gttcagcagtctgcgccgctcgccc--gggccggt	Protospacer
 **.********* ***********  **** *

13. spacer 1.19|648635|29|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to MH319749 (Marine virus AG-345-F15 Ga0172271_11 genomic sequence) position: , mismatch: 6, identity: 0.793 

caatcattatgctagtgatactagcagca	CRISPR spacer
agataattatgctagtgatactaggacaa	Protospacer
 .** ******************* *  *

14. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 6, identity: 0.812 

gccccgatgtcatcgagggcggcgcccccagc	CRISPR spacer
gcgccgatgtcatcgagggccgcgcggccgcc	Protospacer
** ***************** ****  **. *

15. spacer 3.6|896775|32|CP032654|CRISPRCasFinder matches to NC_019489 (Lactobacillus phage Sha1, complete genome) position: , mismatch: 6, identity: 0.812 

cttaccaattagcccacagcgattaccgtatc	CRISPR spacer
cttgccaattagcccacagcgattaccagtct	Protospacer
***.***********************.  ..

16. spacer 3.7|896836|32|CP032654|CRISPRCasFinder matches to NC_019489 (Lactobacillus phage Sha1, complete genome) position: , mismatch: 6, identity: 0.812 

cttaccaattagcccacagcgattaccgtatc	CRISPR spacer
cttgccaattagcccacagcgattaccagtct	Protospacer
***.***********************.  ..

17. spacer 3.17|896775|33|CP032654|CRT,PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818 

cttaccaattagcccacagcgattaccgtatca	CRISPR spacer
cttaccaattagcccacagcgattaccagtctg	Protospacer
***************************.  ...

18. spacer 3.17|896775|33|CP032654|CRT,PILER-CR matches to NC_006936 (Lactobacillus phage phiJL-1, complete genome) position: , mismatch: 6, identity: 0.818 

cttaccaattagcccacagcgattaccgtatca	CRISPR spacer
cttaccaattagcccacagcgataaccgatctg	Protospacer
*********************** ****  ...

19. spacer 3.17|896775|33|CP032654|CRT,PILER-CR matches to AY236756 (Lactobacillus plantarum bacteriophage phiJL-1, complete genome) position: , mismatch: 6, identity: 0.818 

cttaccaattagcccacagcgattaccgtatca	CRISPR spacer
cttaccaattagcccacagcgataaccgatctg	Protospacer
*********************** ****  ...

20. spacer 3.18|896836|33|CP032654|CRT,PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818 

cttaccaattagcccacagcgattaccgtatca	CRISPR spacer
cttaccaattagcccacagcgattaccagtctg	Protospacer
***************************.  ...

21. spacer 3.18|896836|33|CP032654|CRT,PILER-CR matches to NC_006936 (Lactobacillus phage phiJL-1, complete genome) position: , mismatch: 6, identity: 0.818 

cttaccaattagcccacagcgattaccgtatca	CRISPR spacer
cttaccaattagcccacagcgataaccgatctg	Protospacer
*********************** ****  ...

22. spacer 3.18|896836|33|CP032654|CRT,PILER-CR matches to AY236756 (Lactobacillus plantarum bacteriophage phiJL-1, complete genome) position: , mismatch: 6, identity: 0.818 

cttaccaattagcccacagcgattaccgtatca	CRISPR spacer
cttaccaattagcccacagcgataaccgatctg	Protospacer
*********************** ****  ...

23. spacer 4.20|3065307|30|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NC_029065 (Pseudomonas phage VCM genome assembly VCM, chromosome : 1) position: , mismatch: 6, identity: 0.8 

atggctaaactgaacaaaacacagacgtat-	CRISPR spacer
atggctaaactgaccaaagcaca-acgcgag	Protospacer
************* ****.**** ***..

24. spacer 4.21|3065373|30|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NC_019746 (Gloeocapsa sp. PCC 7428 plasmid pGLO7428.01, complete sequence) position: , mismatch: 6, identity: 0.8 

-gttataccgtctaaatacccgcaacactca	CRISPR spacer
tgtta-accgtataaatacccgcaacaaagc	Protospacer
 **** ***** ***************

25. spacer 4.22|3065439|30|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043762 (Paenibacillus sp. 37 plasmid pART37, complete sequence) position: , mismatch: 6, identity: 0.8 

caacttgaagaaactagttaagaacatccg	CRISPR spacer
tatcttgaagaaactaactaagaacagtcg	Protospacer
.* *************..******** .**

26. spacer 1.11|648146|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040462 (Enterococcus sp. M190262 plasmid pM190262, complete sequence) position: , mismatch: 7, identity: 0.788 

taagtttaggggcgcaggttcgaggcctgcaag	CRISPR spacer
taaccgtccggtcgcaggttcgagtcctgcaag	Protospacer
*** . *  ** ************ ********

27. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc	CRISPR spacer
aggccgacgtcatcgagggcggcgccggcaac	Protospacer
.  ****.******************  **.*

28. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc	CRISPR spacer
aggccgacgtcatcgagggcggcgccggcaac	Protospacer
.  ****.******************  **.*

29. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc	CRISPR spacer
aggccgacgtcatcgagggcggcgccggcaac	Protospacer
.  ****.******************  **.*

30. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc	CRISPR spacer
aggccgacgtcatcgagggcggcgccggcaac	Protospacer
.  ****.******************  **.*

31. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc	CRISPR spacer
aggccgacgtcatcgagggcggcgccggcaac	Protospacer
.  ****.******************  **.*

32. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to KY092483 (Streptomyces phage Bioscum, complete genome) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc--	CRISPR spacer
tcgccgagggcatcgagggcggcg--ccgagcag	Protospacer
 * **** * **************  ** ***

33. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to MK305888 (Streptomyces phage Austintatious, complete genome) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc--	CRISPR spacer
tcgccgagggcatcgagggcggcg--ccgagcag	Protospacer
 * **** * **************  ** ***

34. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NC_047792 (Streptomyces phage Ididsumtinwong, complete genome) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc--	CRISPR spacer
tcgccgagggcatcgagggcggcg--ccgagcag	Protospacer
 * **** * **************  ** ***

35. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to KY092481 (Streptomyces phage PapayaSalad, complete genome) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc--	CRISPR spacer
tcgccgagggcatcgagggcggcg--ccgagcag	Protospacer
 * **** * **************  ** ***

36. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to JX182371 (Streptomyces phage SV1, complete genome) position: , mismatch: 7, identity: 0.781 

gccccgatgtcatcgagggcggcgcccccagc--	CRISPR spacer
tcgccgagggcatcgagggcggcg--ccgagcag	Protospacer
 * **** * **************  ** ***

37. spacer 3.12|897141|32|CP032654|CRISPRCasFinder matches to NZ_LR215040 (Mycoplasma columborale strain NCTC10179 plasmid 2) position: , mismatch: 7, identity: 0.781 

tacaattaattcagttgatttaattgatggat	CRISPR spacer
aagaattgattcacttgatttaattgatgcta	Protospacer
 * ****.***** ***************

38. spacer 3.12|897141|32|CP032654|CRISPRCasFinder matches to CP033541 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-1, complete sequence) position: , mismatch: 7, identity: 0.781 

tacaattaattcagttgatttaattgatggat	CRISPR spacer
ttcaattaattcagttgctttaattacttagt	Protospacer
* *************** *******. * ..*

39. spacer 3.12|897141|32|CP032654|CRISPRCasFinder matches to MK496719 (Capybara microvirus Cap1_SP_131, complete genome) position: , mismatch: 7, identity: 0.781 

tacaattaattcagttgatttaattgatggat	CRISPR spacer
cacaattaattcatttgaattaattcgtttat	Protospacer
.************ **** ****** .*  **

40. spacer 3.12|897141|32|CP032654|CRISPRCasFinder matches to MG770379 (Klebsiella virus vB_KpnM_KpS110, complete genome) position: , mismatch: 7, identity: 0.781 

tacaattaattcagttgattt-aattgatggat	CRISPR spacer
tacaaatcattcagttgatttaaactaattaa-	Protospacer
***** * ************* **.*.** .*

41. spacer 3.12|897141|32|CP032654|CRISPRCasFinder matches to MN478483 (Klebsiella virus UPM 2146, complete genome) position: , mismatch: 7, identity: 0.781 

tacaattaattcagttgattt-aattgatggat	CRISPR spacer
tacaaatcattcagttgatttaaactaattaa-	Protospacer
***** * ************* **.*.** .*

42. spacer 3.15|896653|33|CP032654|CRT,PILER-CR matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 7, identity: 0.788 

gccccgatgtcatcgagggcggcgcccccagcg	CRISPR spacer
gcgccgatgtcatcgagggccgcgcggccgcct	Protospacer
** ***************** ****  **. *

43. spacer 3.17|896775|33|CP032654|CRT,PILER-CR matches to NC_019489 (Lactobacillus phage Sha1, complete genome) position: , mismatch: 7, identity: 0.788 

cttaccaattagcccacagcgattaccgtatca	CRISPR spacer
cttgccaattagcccacagcgattaccagtctg	Protospacer
***.***********************.  ...

44. spacer 3.18|896836|33|CP032654|CRT,PILER-CR matches to NC_019489 (Lactobacillus phage Sha1, complete genome) position: , mismatch: 7, identity: 0.788 

cttaccaattagcccacagcgattaccgtatca	CRISPR spacer
cttgccaattagcccacagcgattaccagtctg	Protospacer
***.***********************.  ...

45. spacer 3.23|897141|33|CP032654|CRT,PILER-CR matches to NZ_LR215040 (Mycoplasma columborale strain NCTC10179 plasmid 2) position: , mismatch: 7, identity: 0.788 

tacaattaattcagttgatttaattgatggata	CRISPR spacer
aagaattgattcacttgatttaattgatgctaa	Protospacer
 * ****.***** ***************   *

46. spacer 4.12|3064779|30|CP032654|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.767 

gggatgtcggtcagggtggtgaagaaacca	CRISPR spacer
aggatgtcggtcaggatgttgaagaagatc	Protospacer
.**************.** *******. .

47. spacer 4.18|3065175|30|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 7, identity: 0.767 

attctggcgccggtggttggccggtgatcc	CRISPR spacer
attctggcgcgggtggttggcaaggactgc	Protospacer
********** ********** .* . * *

48. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 8, identity: 0.75 

gccccgatgtcatcgagggcggcgcccccagc	CRISPR spacer
aggccgacgtcatccagggcggcgccggcaac	Protospacer
.  ****.****** ***********  **.*

49. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NZ_CP035507 (Haematobacter massiliensis strain OT1 plasmid pOT1-7, complete sequence) position: , mismatch: 8, identity: 0.75 

gccccgatgtcatcgagggcggcgcccccagc----	CRISPR spacer
gccgcgatgtcgtcgagggcgg----cctggctgcg	Protospacer
*** *******.**********    **..**

50. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to MT708549 (Burkholderia phage Maja, complete genome) position: , mismatch: 8, identity: 0.75 

gccccgatgtcatcgagggcggcgcccccagc	CRISPR spacer
gccccgaagtcatcgtgggcggctcgaacttc	Protospacer
******* ******* ******* *   *  *

51. spacer 3.8|896897|32|CP032654|CRISPRCasFinder matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgtgacggagtttgacttcgatggataacga-	CRISPR spacer
gtgtgatggagtttgccttcgatgg-tgatgtc	Protospacer
 .****.******** ********* *.*.*

52. spacer 3.9|896958|32|CP032654|CRISPRCasFinder matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgtgacggagtttgacttcgatggataacga-	CRISPR spacer
gtgtgatggagtttgccttcgatgg-tgatgtc	Protospacer
 .****.******** ********* *.*.*

53. spacer 3.10|897019|32|CP032654|CRISPRCasFinder matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgtgacggagtttgacttcgatggataacga-	CRISPR spacer
gtgtgatggagtttgccttcgatgg-tgatgtc	Protospacer
 .****.******** ********* *.*.*

54. spacer 3.14|896591|34|CP032654|CRT,PILER-CR matches to MN856007 (Siphoviridae sp. isolate 414, complete genome) position: , mismatch: 8, identity: 0.765 

---ctatcaaactcatctcatagcctctcaatcatca	CRISPR spacer
tttccttcga---catctcataacctctcaatcgtca	Protospacer
   *. **.*   *********.**********.***

55. spacer 3.23|897141|33|CP032654|CRT,PILER-CR matches to MK496719 (Capybara microvirus Cap1_SP_131, complete genome) position: , mismatch: 8, identity: 0.758 

tacaattaattcagttgatttaattgatggata	CRISPR spacer
cacaattaattcatttgaattaattcgtttatg	Protospacer
.************ **** ****** .*  **.

56. spacer 4.10|3064647|30|CP032654|CRISPRCasFinder,CRT matches to LT598654 (Phage NCTB genome assembly, complete genome: monopartite) position: , mismatch: 8, identity: 0.733 

aataagccttttaatgccttgctcagggca	CRISPR spacer
gttaagcctttaaatgcctggctcatccta	Protospacer
. ********* ******* *****   .*

57. spacer 4.12|3064779|30|CP032654|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.733 

gggatgtcggtcagggtggtgaagaaacca	CRISPR spacer
agagcctcggtcaggatggtgaggaaaccg	Protospacer
.*... *********.******.******.

58. spacer 4.14|3064911|30|CP032654|CRISPRCasFinder,CRT matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 8, identity: 0.733 

agcataccctggttgattgctcagtgtgtc	CRISPR spacer
cttaacgcctggttgattgctcagtctgtg	Protospacer
  .*   ****************** ***

59. spacer 5.1|3325850|29|CP032654|CRISPRCasFinder matches to NZ_CP013691 (Myroides odoratimimus strain PR63039 plasmid p63039, complete sequence) position: , mismatch: 8, identity: 0.724 

tgggtagccagtgaagctaatacaatcag	CRISPR spacer
gttttagccattgaagctaatacaatact	Protospacer
    ****** ***************

60. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.727 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaactg	Protospacer
.*** ***** ***************.  . *.

61. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.727 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaactg	Protospacer
.*** ***** ***************.  . *.

62. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.727 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaactg	Protospacer
.*** ***** ***************.  . *.

63. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.727 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaactg	Protospacer
.*** ***** ***************.  . *.

64. spacer 1.10|648085|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.727 

aatgcttctgccaatcgttcggcactcgccacg	CRISPR spacer
cccgcctctgccaatcgttcggcgctccgtccg	Protospacer
  .**.*****************.***  . **

65. spacer 2.1|896022|32|CP032654|CRISPRCasFinder matches to NC_021727 (Acinetobacter baumannii BJAB07104 plasmid p1BJAB07104, complete sequence) position: , mismatch: 9, identity: 0.719 

actagcgtagaaatttcggttagtcacattgg	CRISPR spacer
cttagcttagaaatttcggttaatcgctctaa	Protospacer
 .**** ***************.**.* .*..

66. spacer 2.1|896022|32|CP032654|CRISPRCasFinder matches to NZ_CP018422 (Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence) position: , mismatch: 9, identity: 0.719 

actagcgtagaaatttcggttagtcacattgg	CRISPR spacer
cttagcttagaaatttcggttaatcgctctaa	Protospacer
 .**** ***************.**.* .*..

67. spacer 2.1|896022|32|CP032654|CRISPRCasFinder matches to NZ_CP018144 (Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

actagcgtagaaatttcggttagtcacattgg	CRISPR spacer
cttagcttagaaatttcggttaatcgctctaa	Protospacer
 .**** ***************.**.* .*..

68. spacer 2.1|896022|32|CP032654|CRISPRCasFinder matches to NC_017848 (Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence) position: , mismatch: 9, identity: 0.719 

actagcgtagaaatttcggttagtcacattgg	CRISPR spacer
cttagcttagaaatttcggttaatcgctctaa	Protospacer
 .**** ***************.**.* .*..

69. spacer 2.1|896022|32|CP032654|CRISPRCasFinder matches to NZ_KM922672 (Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence) position: , mismatch: 9, identity: 0.719 

actagcgtagaaatttcggttagtcacattgg	CRISPR spacer
cttagcttagaaatttcggttaatcgctctaa	Protospacer
 .**** ***************.**.* .*..

70. spacer 2.1|896022|32|CP032654|CRISPRCasFinder matches to NC_021731 (Acinetobacter baumannii BJAB0868 plasmid p2BJAB0868, complete sequence) position: , mismatch: 9, identity: 0.719 

actagcgtagaaatttcggttagtcacattgg	CRISPR spacer
cttagcttagaaatttcggttaatcgctctaa	Protospacer
 .**** ***************.**.* .*..

71. spacer 2.1|896022|32|CP032654|CRISPRCasFinder matches to NZ_MK386682 (Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence) position: , mismatch: 9, identity: 0.719 

actagcgtagaaatttcggttagtcacattgg	CRISPR spacer
cttagcttagaaatttcggttaatcgctctaa	Protospacer
 .**** ***************.**.* .*..

72. spacer 2.3|896144|32|CP032654|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 9, identity: 0.719 

tgacagcactaaacgaaaagtcagaagtgaca	CRISPR spacer
caaaagcactaaacgaaaaattagaagaaatc	Protospacer
..* ***************.*.***** .*.

73. spacer 2.3|896144|32|CP032654|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgacagcactaaacgaaaagtcagaagtgaca	CRISPR spacer
caaaagcactaaacgaaaaattagaagaaatc	Protospacer
..* ***************.*.***** .*.

74. spacer 2.3|896144|32|CP032654|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

tgacagcactaaacgaaaagtcagaagtgaca	CRISPR spacer
caaaagcactaaacgaaaaattagaagaaatc	Protospacer
..* ***************.*.***** .*.

75. spacer 2.3|896144|32|CP032654|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 9, identity: 0.719 

tgacagcactaaacgaaaagtcagaagtgaca	CRISPR spacer
caaaagcactaaacgaaaaattagaagaaatc	Protospacer
..* ***************.*.***** .*.

76. spacer 2.3|896144|32|CP032654|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgacagcactaaacgaaaagtcagaagtgaca	CRISPR spacer
caaaagcactaaacgaaaaattagaagaaatc	Protospacer
..* ***************.*.***** .*.

77. spacer 2.3|896144|32|CP032654|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgacagcactaaacgaaaagtcagaagtgaca	CRISPR spacer
caaaagcactaaacgaaaaattagaagaaatc	Protospacer
..* ***************.*.***** .*.

78. spacer 2.3|896144|32|CP032654|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgacagcactaaacgaaaagtcagaagtgaca	CRISPR spacer
caaaagcactaaacgaaaaattagaagaaatc	Protospacer
..* ***************.*.***** .*.

79. spacer 2.3|896144|32|CP032654|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgacagcactaaacgaaaagtcagaagtgaca	CRISPR spacer
caaaagcactaaacgaaaaattagaagaaatc	Protospacer
..* ***************.*.***** .*.

80. spacer 3.1|896431|32|CP032654|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719 

agtacgttgtccactttcaatgtattcggcat	CRISPR spacer
ccgcccctgtccactgtcaatgttttcggcaa	Protospacer
    * .******** ******* *******

81. spacer 3.12|897141|32|CP032654|CRISPRCasFinder matches to NC_031046 (Staphylococcus phage BP39, complete genome) position: , mismatch: 9, identity: 0.719 

tacaattaattcagttgatttaattgatggat	CRISPR spacer
aacatttaattcagttgatttaatcaactata	Protospacer
 *** *******************..*. .

82. spacer 4.2|3064119|30|CP032654|CRISPRCasFinder,CRT matches to NC_009926 (Acaryochloris marina MBIC11017 plasmid pREB1, complete sequence) position: , mismatch: 9, identity: 0.7 

tattttctatgcgctgaaattcttttaggt	CRISPR spacer
atcaggttatgcaatgaaattcttttaggt	Protospacer
  .   .*****. ****************

83. spacer 4.12|3064779|30|CP032654|CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 9, identity: 0.7 

gggatgtcggtcagggtggtgaagaaacca	CRISPR spacer
tcgatgtcggtcagggtgctgaaggcctgg	Protospacer
  **************** *****.  . .

84. spacer 4.12|3064779|30|CP032654|CRISPRCasFinder,CRT matches to MN862068 (Brevundimonas phage vB_BsubS-Delta, complete genome) position: , mismatch: 9, identity: 0.7 

gggatgtcggtcagggtggtgaagaaacca	CRISPR spacer
ccgatgtcggtcagggcggtggagatggag	Protospacer
  **************.****.*** .  .

85. spacer 4.18|3065175|30|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 9, identity: 0.7 

attctggcgccggtggttggccggtgatcc	CRISPR spacer
gtactggcgccggtgattggccggcaccgt	Protospacer
.* ************.********.. . .

86. spacer 4.18|3065175|30|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 9, identity: 0.7 

attctggcgccggtggttggccggtgatcc	CRISPR spacer
gagctggcgcaggtggttggccgctggagt	Protospacer
.  ******* ************ **.  .

87. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 10, identity: 0.697 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaaccg	Protospacer
.*** ***** ***************.  . ..

88. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 10, identity: 0.697 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaaccg	Protospacer
.*** ***** ***************.  . ..

89. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 10, identity: 0.697 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaaccg	Protospacer
.*** ***** ***************.  . ..

90. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.697 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaaccg	Protospacer
.*** ***** ***************.  . ..

91. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 10, identity: 0.697 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaaccg	Protospacer
.*** ***** ***************.  . ..

92. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 10, identity: 0.697 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaaccg	Protospacer
.*** ***** ***************.  . ..

93. spacer 1.9|648024|33|CP032654|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 10, identity: 0.697 

accgggccaaaacgatgagcggcgccactgata	CRISPR spacer
gccgcgccaacacgatgagcggcgccgaaaccg	Protospacer
.*** ***** ***************.  . ..

94. spacer 3.5|896714|32|CP032654|CRISPRCasFinder matches to CAJCJZ010000002 (Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.688 

ccctcatctgttccgtcttcgttttcgccatc	CRISPR spacer
ggacggaatgcttcgtcttcgttttcgccatc	Protospacer
   . .  **.*.*******************

95. spacer 3.5|896714|32|CP032654|CRISPRCasFinder matches to MT119360 (Enterococcus phage nattely, complete genome) position: , mismatch: 10, identity: 0.688 

ccctcatctgttccgtcttcgttttcgccatc	CRISPR spacer
ggacggaatgcttcgtcttcgttttcgccatc	Protospacer
   . .  **.*.*******************

96. spacer 3.12|897141|32|CP032654|CRISPRCasFinder matches to NC_048677 (Lactobacillus phage LpeD, complete genome) position: , mismatch: 10, identity: 0.688 

tacaattaattcagttgatttaattgatggat	CRISPR spacer
aaggattaagtcaattgatttaattgacctta	Protospacer
 * .***** ***.*************.

97. spacer 3.12|897141|32|CP032654|CRISPRCasFinder matches to MT774376 (CrAssphage cr55_1, complete genome) position: , mismatch: 10, identity: 0.688 

tacaattaattcagttgatttaattgatggat	CRISPR spacer
ttcaataatttcagttgatttaattttcttca	Protospacer
* **** * ****************  .

98. spacer 3.12|897141|32|CP032654|CRISPRCasFinder matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 10, identity: 0.688 

tacaattaattcagttgatttaattgatggat	CRISPR spacer
ttcaataatttcagttgatttaattttcttca	Protospacer
* **** * ****************  .

99. spacer 3.16|896714|33|CP032654|CRT,PILER-CR matches to MT119360 (Enterococcus phage nattely, complete genome) position: , mismatch: 11, identity: 0.667 

ccctcatctgttccgtcttcgttttcgccatcg	CRISPR spacer
ggacggaatgcttcgtcttcgttttcgccatct	Protospacer
   . .  **.*.*******************

100. spacer 3.16|896714|33|CP032654|CRT,PILER-CR matches to CAJCJZ010000002 (Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.667 

ccctcatctgttccgtcttcgttttcgccatcg	CRISPR spacer
ggacggaatgcttcgtcttcgttttcgccatct	Protospacer
   . .  **.*.*******************

101. spacer 3.4|896653|32|CP032654|CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 18, identity: 0.438 

gccccgatgtcatcgagggcggcgcccccagc--------------	CRISPR spacer
--------------gctggcggcgcccccctcgatgaccaatcggt	Protospacer
              *  ************  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6525 : 14457 6 Lactobacillus_phage(100.0%) holin NA
DBSCAN-SWA_2 70458 : 79206 11 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_3 550842 : 558588 9 Escherichia_phage(50.0%) integrase attL 543894:543909|attR 562944:562959
DBSCAN-SWA_4 579522 : 646345 48 Streptococcus_phage(15.38%) integrase,transposase,protease attL 604733:604792|attR 637977:639410
DBSCAN-SWA_5 782432 : 791683 8 Lactobacillus_phage(85.71%) NA NA
DBSCAN-SWA_6 937920 : 971890 36 Macacine_betaherpesvirus(40.0%) protease,transposase,tRNA NA
DBSCAN-SWA_7 1999287 : 2007801 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 2502130 : 2511989 7 Streptococcus_phage(14.29%) NA NA
DBSCAN-SWA_9 2901029 : 2965084 53 Streptococcus_phage(17.65%) portal,capsid,tRNA,head,tail,integrase,terminase attL 2910747:2910763|attR 2959807:2959823
DBSCAN-SWA_10 3320791 : 3367995 44 Bacillus_virus(33.33%) protease,transposase,bacteriocin NA
DBSCAN-SWA_11 3540898 : 3564280 35 Lactobacillus_phage(89.66%) transposase,portal,capsid,protease,head,tail,integrase,terminase attL 3537594:3537607|attR 3543648:3543661

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP032655
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6583 : 68485 52 Staphylococcus_phage(13.64%) transposase,integrase attL 11181:11240|attR 54092:56142

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage