Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032481 Staphylococcus aureus strain O326 chromosome, complete genome 5 crisprs cas3,DEDDh,DinG,csa3,WYL 2 0 9 0

Results visualization

1. CP032481
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032481_1 1801172-1801255 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032481_2 1915073-1915200 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032481_3 2004948-2005137 Orphan NA
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032481_4 2186649-2186737 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032481_5 2310287-2310366 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP032481_5 5.1|2310312|30|CP032481|CRISPRCasFinder 2310312-2310341 30 CP032481.1 2310198-2310227 1 0.967
CP032481_3 3.1|2004967|39|CP032481|CRT 2004967-2005005 39 CP032481.1 1155515-1155553 2 0.949
CP032481_3 3.1|2004967|39|CP032481|CRT 2004967-2005005 39 CP032481.1 2310242-2310280 2 0.949

1. spacer 5.1|2310312|30|CP032481|CRISPRCasFinder matches to position: 2310198-2310227, mismatch: 1, identity: 0.967

acttttgtcagcttctgtgttggggccccg	CRISPR spacer
acttttgtcaacttctgtgttggggccccg	Protospacer
**********.*******************

2. spacer 3.1|2004967|39|CP032481|CRT matches to position: 1155515-1155553, mismatch: 2, identity: 0.949

ctgtagaatttccttttgaaattctctatgttgggggcc	CRISPR spacer
ctgtagaatttctttttgaaattctctatgttggggccc	Protospacer
************.*********************** **

3. spacer 3.1|2004967|39|CP032481|CRT matches to position: 2310242-2310280, mismatch: 2, identity: 0.949

ctgtagaatttccttttgaaattctctatgttgggggcc	CRISPR spacer
ctgtagaatttctttttgaaattctctatgttggggccc	Protospacer
************.*********************** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 328384 : 371113 53 Staphylococcus_phage(68.63%) tail,integrase,portal,holin,protease attL 328273:328291|attR 373283:373301
DBSCAN-SWA_2 416162 : 432163 25 Staphylococcus_phage(95.0%) coat NA
DBSCAN-SWA_3 780478 : 788298 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_4 803971 : 814815 8 uncultured_Caudovirales_phage(71.43%) NA NA
DBSCAN-SWA_5 1595314 : 1603626 7 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_6 1673279 : 1682322 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_7 1806055 : 1852518 41 Staphylococcus_phage(94.29%) tRNA,protease NA
DBSCAN-SWA_8 1857860 : 1878826 19 Staphylococcus_phage(93.33%) protease NA
DBSCAN-SWA_9 1909163 : 1984486 84 Staphylococcus_phage(61.54%) tail,integrase,protease,head,terminase,tRNA attL 1951508:1951522|attR 1986043:1986057
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage