Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032653 Lactobacillus sakei strain LZ217 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 2 0
CP032652 Lactobacillus sakei strain LZ217 chromosome, complete genome 1 crisprs cas3,DEDDh,DinG,csa3 1 0 6 0

Results visualization

1. CP032653
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8308 : 17764 6 Pandoravirus(16.67%) transposase NA
DBSCAN-SWA_2 31576 : 37584 6 Bacillus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP032652
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032652_1 150817-150900 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP032652_1 1.1|150840|38|CP032652|CRISPRCasFinder 150840-150877 38 CP032652.1 150714-150751 0 1.0

1. spacer 1.1|150840|38|CP032652|CRISPRCasFinder matches to position: 150714-150751, mismatch: 0, identity: 1.0

aattagagtgcttttagtgcttgtttagattttgagca	CRISPR spacer
aattagagtgcttttagtgcttgtttagattttgagca	Protospacer
**************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 481888 : 489997 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 576797 : 588850 12 Enterococcus_phage(30.0%) transposase NA
DBSCAN-SWA_3 741597 : 748993 7 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_4 904677 : 984525 96 Lactobacillus_phage(28.57%) tRNA,holin,terminase,integrase,portal,tail,capsid attL 945808:945824|attR 987529:987545
DBSCAN-SWA_5 1123545 : 1131839 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1197138 : 1246887 56 Streptococcus_phage(27.27%) protease,bacteriocin,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage