Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032707 Brevundimonas naejangsanensis strain BRV3 chromosome, complete genome 4 crisprs DEDDh,csa3,DinG,WYL 1 0 1 0

Results visualization

1. CP032707
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032707_1 907488-907569 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032707_2 1060754-1060854 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032707_3 1600819-1600901 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032707_4 2132720-2132820 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP032707_1 1.1|907512|34|CP032707|CRISPRCasFinder 907512-907545 34 CP032707.1 1234022-1234055 2 0.941

1. spacer 1.1|907512|34|CP032707|CRISPRCasFinder matches to position: 1234022-1234055, mismatch: 2, identity: 0.941

cgctcaagcagccgaaggcgttagcgcgcccaaa	CRISPR spacer
cgctcaagcagtcgaaggcgttagcgcacccaaa	Protospacer
***********.***************.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1790377 : 1798176 12 Geobacillus_phage(33.33%) portal,tail,protease,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage