Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032815 Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome 2 crisprs PD-DExK,WYL,csa3,cas3,DEDDh,DinG,RT 1 14 10 0

Results visualization

1. CP032815
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032815_1 925741-927051 Orphan I-E
21 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032815_2 936814-937513 Orphan I-E
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP032815_1 1.4|925954|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 925954-925985 32 CP032815.1 1491307-1491338 1 0.969

1. spacer 1.4|925954|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to position: 1491307-1491338, mismatch: 1, identity: 0.969

gcagattggtatctggtacgacgactgccgcc	CRISPR spacer
gcagattggtatccggtacgacgactgccgcc	Protospacer
*************.******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032815_2 2.10|937391|33|CP032815|PILER-CR 937391-937423 33 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 35344-35376 0 1.0
CP032815_2 2.21|937392|32|CP032815|CRISPRCasFinder,CRT 937392-937423 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 35345-35376 0 1.0
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 NC_019769 Enterobacteria phage HK542, complete genome 29180-29215 0 1.0
CP032815_2 2.10|937391|33|CP032815|PILER-CR 937391-937423 33 NZ_CP029990 Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence 95163-95195 1 0.97
CP032815_2 2.10|937391|33|CP032815|PILER-CR 937391-937423 33 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 9402-9434 1 0.97
CP032815_2 2.10|937391|33|CP032815|PILER-CR 937391-937423 33 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 39737-39769 1 0.97
CP032815_2 2.10|937391|33|CP032815|PILER-CR 937391-937423 33 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 113375-113407 1 0.97
CP032815_2 2.21|937392|32|CP032815|CRISPRCasFinder,CRT 937392-937423 32 NZ_CP029990 Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence 95164-95195 1 0.969
CP032815_2 2.21|937392|32|CP032815|CRISPRCasFinder,CRT 937392-937423 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 9403-9434 1 0.969
CP032815_2 2.21|937392|32|CP032815|CRISPRCasFinder,CRT 937392-937423 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 39737-39768 1 0.969
CP032815_2 2.21|937392|32|CP032815|CRISPRCasFinder,CRT 937392-937423 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 113376-113407 1 0.969
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 NC_016160 Escherichia phage HK75, complete genome 28597-28632 1 0.972
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 NC_019705 Enterobacteria phage mEpX2, complete genome 29051-29086 1 0.972
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 KY979108 Escherichia phage ECP1, complete genome 432-467 1 0.972
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 NC_019719 Enterobacteria phage HK633, complete genome 31745-31780 1 0.972
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 JF974339 Enterobacteria phage IME10, complete genome 9728-9763 1 0.972
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 NC_005344 Enterobacteria phage Sf6, complete genome 28415-28450 1 0.972
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 NC_019715 Enterobacterial phage mEp234, complete genome 30413-30448 2 0.944
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 NC_019711 Enterobacteria phage HK629, complete genome 37174-37209 2 0.944
CP032815_3 3.1|2717962|36|CP032815|CRISPRCasFinder 2717962-2717997 36 NC_019768 Enterobacteria phage HK106, complete genome 32709-32744 2 0.944
CP032815_1 1.11|926381|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926381-926412 32 NZ_CP009113 Rhodococcus opacus strain 1CP plasmid pR1CP2, complete sequence 57554-57585 6 0.812
CP032815_2 2.21|937392|32|CP032815|CRISPRCasFinder,CRT 937392-937423 32 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 270963-270994 7 0.781
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 189898-189929 8 0.75
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 189898-189929 8 0.75
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1789627-1789658 8 0.75
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1806317-1806348 8 0.75
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 51148-51179 8 0.75
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 212687-212718 8 0.75
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NC_017805 Deinococcus gobiensis I-0 plasmid P1, complete sequence 382523-382554 8 0.75
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 212685-212716 8 0.75
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1769551-1769582 8 0.75
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 MN536027 Pseudomonas phage vB_Pae-SS2019XII, complete genome 14176-14207 8 0.75
CP032815_1 1.19|926869|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926869-926900 32 MH622910 Caudovirales sp. isolate ctdb_3, complete genome 4473-4504 8 0.75
CP032815_1 1.5|926015|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926015-926046 32 NZ_CP014361 Methylomonas sp. DH-1 plasmid, complete sequence 141473-141504 9 0.719
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 276209-276240 9 0.719
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 20088-20119 9 0.719
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_CP049813 Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence 69714-69745 9 0.719
CP032815_1 1.11|926381|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926381-926412 32 MN096355 Mycobacterium phage Purky, complete genome 25716-25747 9 0.719
CP032815_1 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926442-926473 32 MN694197 Marine virus AFVG_250M303, complete genome 6755-6786 9 0.719
CP032815_2 2.7|937208|33|CP032815|PILER-CR 937208-937240 33 NZ_CP021643 Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence 63579-63611 9 0.727
CP032815_2 2.13|936904|32|CP032815|CRISPRCasFinder,CRT 936904-936935 32 AP018321 Nostoc sp. HK-01 plasmid plasmid3 DNA, complete genome 46531-46562 9 0.719
CP032815_2 2.18|937209|32|CP032815|CRISPRCasFinder,CRT 937209-937240 32 NZ_CP021643 Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence 63580-63611 9 0.719
CP032815_2 2.18|937209|32|CP032815|CRISPRCasFinder,CRT 937209-937240 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2378875-2378906 9 0.719
CP032815_1 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926137-926168 32 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 171558-171589 10 0.688
CP032815_1 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926442-926473 32 KX119175 Helicobacter phage Pt22899G, complete genome 5088-5119 10 0.688
CP032815_1 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926442-926473 32 KX119175 Helicobacter phage Pt22899G, complete genome 16950-16981 10 0.688
CP032815_1 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926442-926473 32 JF734911 Helicobacter phage phiHP33, complete genome 19807-19838 10 0.688
CP032815_1 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926442-926473 32 KX119200 Helicobacter phage FrMEG235U, complete genome 14594-14625 10 0.688
CP032815_1 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926442-926473 32 KX119200 Helicobacter phage FrMEG235U, complete genome 19690-19721 10 0.688
CP032815_1 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926442-926473 32 KX119201 Helicobacter phage FrANT170U, complete genome 14594-14625 10 0.688
CP032815_1 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926442-926473 32 KX119201 Helicobacter phage FrANT170U, complete genome 19690-19721 10 0.688
CP032815_1 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926442-926473 32 KX119179 Helicobacter phage Pt5303G mobile element protein and transposase genes, complete cds 1261-1292 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP031899 Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence 76272-76303 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_KM085450 Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence 141990-142021 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP009107 Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence 141989-142020 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP028382 Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence 155197-155228 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP027343 Escherichia coli strain 2014C-4587 plasmid unnamed, complete sequence 103401-103432 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP027311 Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence 50904-50935 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP027441 Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence 97903-97934 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP027585 Escherichia coli strain 00-3076 plasmid unnamed, complete sequence 13352-13383 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP027370 Escherichia coli strain 2014C-3307 plasmid unnamed2 109572-109603 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP027453 Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence 79387-79418 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP027451 Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence 10648-10679 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP027372 Escherichia coli strain 2015C-3905 plasmid unnamed 102888-102919 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP028121 Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence 49990-50021 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NC_007365 Escherichia coli EH41 plasmid pO113, complete sequence 160071-160102 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP023542 Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence 141994-142025 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP010192 Escherichia coli strain M8 plasmid A, complete genome 74522-74553 10 0.688
CP032815_1 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926564-926595 32 NZ_CP023164 Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence 35202-35233 10 0.688
CP032815_1 1.19|926869|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926869-926900 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1409535-1409566 10 0.688
CP032815_2 2.7|937208|33|CP032815|PILER-CR 937208-937240 33 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2378874-2378906 10 0.697
CP032815_2 2.13|936904|32|CP032815|CRISPRCasFinder,CRT 936904-936935 32 MG592456 Vibrio phage 1.081.O._10N.286.52.C2, partial genome 229928-229959 10 0.688
CP032815_2 2.19|937270|32|CP032815|CRISPRCasFinder,CRT 937270-937301 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 318607-318638 10 0.688
CP032815_1 1.15|926625|32|CP032815|PILER-CR,CRISPRCasFinder,CRT 926625-926656 32 NZ_CP015094 Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence 53594-53625 11 0.656

1. spacer 2.10|937391|33|CP032815|PILER-CR matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatatccgcccatcggcc	Protospacer
*********************************

2. spacer 2.21|937392|32|CP032815|CRISPRCasFinder,CRT matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatatccgcccatcggcc	Protospacer
********************************

3. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to NC_019769 (Enterobacteria phage HK542, complete genome) position: , mismatch: 0, identity: 1.0

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagagccgcaccattactggtgtttgcgt	Protospacer
************************************

4. spacer 2.10|937391|33|CP032815|PILER-CR matches to NZ_CP029990 (Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence) position: , mismatch: 1, identity: 0.97

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatattcgcccatcggcc	Protospacer
********************.************

5. spacer 2.10|937391|33|CP032815|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatattcgcccatcggcc	Protospacer
********************.************

6. spacer 2.10|937391|33|CP032815|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatattcgcccatcggcc	Protospacer
********************.************

7. spacer 2.10|937391|33|CP032815|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

gtcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
gtcgcacaacgcctggatattcgcccatcggcc	Protospacer
********************.************

8. spacer 2.21|937392|32|CP032815|CRISPRCasFinder,CRT matches to NZ_CP029990 (Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

9. spacer 2.21|937392|32|CP032815|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

10. spacer 2.21|937392|32|CP032815|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

11. spacer 2.21|937392|32|CP032815|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc	Protospacer
*******************.************

12. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to NC_016160 (Escherichia phage HK75, complete genome) position: , mismatch: 1, identity: 0.972

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagagccgcgccattactggtgtttgcgt	Protospacer
****************.*******************

13. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to NC_019705 (Enterobacteria phage mEpX2, complete genome) position: , mismatch: 1, identity: 0.972

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagagccgcgccattactggtgtttgcgt	Protospacer
****************.*******************

14. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to KY979108 (Escherichia phage ECP1, complete genome) position: , mismatch: 1, identity: 0.972

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagagccgcgccattactggtgtttgcgt	Protospacer
****************.*******************

15. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to NC_019719 (Enterobacteria phage HK633, complete genome) position: , mismatch: 1, identity: 0.972

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagagccgcgccattactggtgtttgcgt	Protospacer
****************.*******************

16. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to JF974339 (Enterobacteria phage IME10, complete genome) position: , mismatch: 1, identity: 0.972

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagagccgcgccattactggtgtttgcgt	Protospacer
****************.*******************

17. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to NC_005344 (Enterobacteria phage Sf6, complete genome) position: , mismatch: 1, identity: 0.972

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagagccgcgccattactggtgtttgcgt	Protospacer
****************.*******************

18. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to NC_019715 (Enterobacterial phage mEp234, complete genome) position: , mismatch: 2, identity: 0.944

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagatccgcgccattactggtgtttgcgt	Protospacer
*********** ****.*******************

19. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to NC_019711 (Enterobacteria phage HK629, complete genome) position: , mismatch: 2, identity: 0.944

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagagacgcgccattactggtgtttgcgt	Protospacer
************ ***.*******************

20. spacer 3.1|2717962|36|CP032815|CRISPRCasFinder matches to NC_019768 (Enterobacteria phage HK106, complete genome) position: , mismatch: 2, identity: 0.944

ctccgctgagagccgcaccattactggtgtttgcgt	CRISPR spacer
ctccgctgagatccgcgccattactggtgtttgcgt	Protospacer
*********** ****.*******************

21. spacer 1.11|926381|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009113 (Rhodococcus opacus strain 1CP plasmid pR1CP2, complete sequence) position: , mismatch: 6, identity: 0.812

gcgctgaccatgattgcagtcagg--gtcggcat	CRISPR spacer
tcgctgaccatgattgcagccgggtcgtcggg--	Protospacer
 ******************.*.**  *****   

22. spacer 2.21|937392|32|CP032815|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcacaacgcctggatatccgcccatcggcc	CRISPR spacer
tcgagaaacgcctggatctccgcccaccgccg	Protospacer
*** . *********** ********.** * 

23. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc--	CRISPR spacer
cgcgggcgctcgacgcgctgcac--gtggccctg	Protospacer
***.****** ************  ...*.**  

24. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc--	CRISPR spacer
cgcgggcgctcgacgcgctgcac--gtggccctg	Protospacer
***.****** ************  ...*.**  

25. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

26. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

27. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc--	CRISPR spacer
cgcgggcgctcgacgcgctgcac--gtggccctg	Protospacer
***.****** ************  ...*.**  

28. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

29. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc----	CRISPR spacer
cgcaggcgctggccgagctgc----acgatccagag	Protospacer
************ ** *****    **..***    

30. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

31. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcagtcgctcgacgcgctgcaccgcgtggcg	Protospacer
***** **** ************ *   * * 

32. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to MN536027 (Pseudomonas phage vB_Pae-SS2019XII, complete genome) position: , mismatch: 8, identity: 0.75

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
tccaggcgctggaggcgctgcgcagcaagagc	Protospacer
. *********** *******.***  **  *

33. spacer 1.19|926869|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to MH622910 (Caudovirales sp. isolate ctdb_3, complete genome) position: , mismatch: 8, identity: 0.75

---aaacaccaacattacggcacgcaagaggttat	CRISPR spacer
ttcaagcgtcag---tacggcacgcaagaagttat	Protospacer
   **.*..**.   **************.*****

34. spacer 1.5|926015|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014361 (Methylomonas sp. DH-1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

actgttaaaatgcttcaggacggtgaagtaaa	CRISPR spacer
caagcgaaaatgcttcaggatggtgaaatatg	Protospacer
   *. **************.******.** .

35. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcgggcgctggacgcgccgcacaagaccttt	Protospacer
***.**************.*****..   *..

36. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 9, identity: 0.719

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
cgcaggcgctggagacgctgcacgatcgaaca	Protospacer
************* .********.. *.. * 

37. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
tgcaggccctgaacgcgctgcacatctatcac	Protospacer
.****** ***.************  .* . *

38. spacer 1.11|926381|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 9, identity: 0.719

gcgctgaccatgattgcagtcagggtcggcat	CRISPR spacer
ctggctgccatgatcgcagtcatggtcggcct	Protospacer
 .* . .*******.******* ******* *

39. spacer 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to MN694197 (Marine virus AFVG_250M303, complete genome) position: , mismatch: 9, identity: 0.719

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
aatagggaatgaaacgtattagtaaaaacaaa	Protospacer
.. ... .******** ***************

40. spacer 2.7|937208|33|CP032815|PILER-CR matches to NZ_CP021643 (Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence) position: , mismatch: 9, identity: 0.727

gaaaccagaattgctgaagtaaattgcaaaaga	CRISPR spacer
gaaacaagatttgctgaagtaaatttagcattt	Protospacer
***** *** ***************  . *   

41. spacer 2.13|936904|32|CP032815|CRISPRCasFinder,CRT matches to AP018321 (Nostoc sp. HK-01 plasmid plasmid3 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gcgttctacagtaaggtttacagcctgagcaa	CRISPR spacer
tgcctattcagtaagggttacagccttagcat	Protospacer
   .* * ******** ********* **** 

42. spacer 2.18|937209|32|CP032815|CRISPRCasFinder,CRT matches to NZ_CP021643 (Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence) position: , mismatch: 9, identity: 0.719

aaaccagaattgctgaagtaaattgcaaaaga	CRISPR spacer
aaacaagatttgctgaagtaaatttagcattt	Protospacer
**** *** ***************  . *   

43. spacer 2.18|937209|32|CP032815|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

aaaccagaattgctgaagtaaattgcaaaaga	CRISPR spacer
acgggcgaattgctgaaggaaatcgcaaaaat	Protospacer
* .   ************ ****.******. 

44. spacer 1.7|926137|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

cgcaggcgctggacgcgctgcacagacagtcc	CRISPR spacer
gtcaggcgctgcacgccctgcacagccgcgag	Protospacer
  ********* **** ******** *.    

45. spacer 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to KX119175 (Helicobacter phage Pt22899G, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

46. spacer 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to KX119175 (Helicobacter phage Pt22899G, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

47. spacer 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to JF734911 (Helicobacter phage phiHP33, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

48. spacer 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to KX119200 (Helicobacter phage FrMEG235U, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

49. spacer 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to KX119200 (Helicobacter phage FrMEG235U, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

50. spacer 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to KX119201 (Helicobacter phage FrANT170U, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

51. spacer 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to KX119201 (Helicobacter phage FrANT170U, complete genome) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

52. spacer 1.12|926442|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to KX119179 (Helicobacter phage Pt5303G mobile element protein and transposase genes, complete cds) position: , mismatch: 10, identity: 0.688

ggggaatgatgaaacgaattagtaaaaacaaa	CRISPR spacer
tgcctttgattaaacgacttagtaaaaacctt	Protospacer
 *    **** ****** ***********   

53. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031899 (Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

54. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

55. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009107 (Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

56. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028382 (Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

57. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027343 (Escherichia coli strain 2014C-4587 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

58. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027311 (Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

59. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027441 (Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

60. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027585 (Escherichia coli strain 00-3076 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

61. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027370 (Escherichia coli strain 2014C-3307 plasmid unnamed2) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

62. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027453 (Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

63. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027451 (Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

64. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027372 (Escherichia coli strain 2015C-3905 plasmid unnamed) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

65. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028121 (Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

66. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NC_007365 (Escherichia coli EH41 plasmid pO113, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

67. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023542 (Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

68. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010192 (Escherichia coli strain M8 plasmid A, complete genome) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

69. spacer 1.14|926564|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023164 (Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence) position: , mismatch: 10, identity: 0.688

gaccgatccgggaacaaccggaacaacgcggg	CRISPR spacer
acaataaaagggaacaacctgaacaacgccgg	Protospacer
.    *   ********** ********* **

70. spacer 1.19|926869|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aaacaccaacattacggcacgcaagaggttat	CRISPR spacer
gctcaccgacattacggcgcgcaagaaggcgg	Protospacer
.  ****.**********.*******.* .. 

71. spacer 2.7|937208|33|CP032815|PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697

gaaaccagaattgctgaagtaaattgcaaaaga	CRISPR spacer
aacgggcgaattgctgaaggaaatcgcaaaaat	Protospacer
.* .   ************ ****.******. 

72. spacer 2.13|936904|32|CP032815|CRISPRCasFinder,CRT matches to MG592456 (Vibrio phage 1.081.O._10N.286.52.C2, partial genome) position: , mismatch: 10, identity: 0.688

gcgttctacagtaaggtttacagcctgagcaa	CRISPR spacer
gaacggctgagtaacgttaacagcctgagcaa	Protospacer
* ..  .  ***** *** *************

73. spacer 2.19|937270|32|CP032815|CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 10, identity: 0.688

atatcgaacgggttacggctgtcggtgtaact	CRISPR spacer
tgaccgaccgggtaacggctgtcggtggcgac	Protospacer
  *.*** ***** *************  . .

74. spacer 1.15|926625|32|CP032815|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 11, identity: 0.656

ccagtaacgctggcgtgataattttggtcgcc	CRISPR spacer
aagaagccgccggcgtgataattctggtcgat	Protospacer
  .. . ***.************.****** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1106145 : 1246291 164 Salmonella_phage(52.71%) transposase,tail,tRNA,terminase,capsid,head,holin,portal,lysis,plate,integrase attL 1211982:1212017|attR 1242879:1242914
DBSCAN-SWA_2 1504558 : 1541987 59 Salmonella_phage(77.19%) tail,protease,terminase,portal,lysis,coat NA
DBSCAN-SWA_3 1788695 : 1797866 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1970649 : 1977881 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_5 2081857 : 2122459 61 Salmonella_phage(17.39%) head,integrase,tail,lysis attL 2084065:2084094|attR 2125691:2125720
DBSCAN-SWA_6 2680711 : 2729045 68 Salmonella_phage(43.33%) tail,tRNA,protease,capsid,head,terminase,portal,lysis NA
DBSCAN-SWA_7 2960948 : 3007441 69 Salmonella_phage(45.28%) tail,protease,terminase,head,lysis,integrase attL 2957886:2957899|attR 3008363:3008376
DBSCAN-SWA_8 3240979 : 3282937 69 Salmonella_phage(70.49%) tail,terminase,holin,portal,lysis,coat,integrase attL 3240530:3240551|attR 3283003:3283024
DBSCAN-SWA_9 4542751 : 4590398 51 Burkholderia_phage(36.36%) tRNA,plate,tail NA
DBSCAN-SWA_10 4659983 : 4755777 100 Escherichia_phage(38.3%) tail,tRNA,terminase,capsid,head,holin,portal,lysis,plate,integrase attL 4720093:4720139|attR 4750831:4750877
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage