Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032841 Enterobacter hormaechei strain C15117 chromosome, complete genome 3 crisprs NA 0 1 0 0
CP032842 Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence 0 crisprs NA 0 0 0 0
CP032843 Enterobacter hormaechei strain C15117 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
CP032845 Enterobacter hormaechei strain C15117 plasmid unnamed3 0 crisprs NA 0 0 0 0
CP032844 Enterobacter hormaechei strain C15117 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP032846 Enterobacter hormaechei strain C15117 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0
CP032847 Enterobacter hormaechei strain C15117 plasmid unnamed5 0 crisprs NA 0 0 0 0

Results visualization

1. CP032841
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032841_1 447426-447509 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032841_2 2503344-2503426 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032841_3 3067399-3067495 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032841_2 2.1|2503372|27|CP032841|CRISPRCasFinder 2503372-2503398 27 NZ_LR134256 Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence 1565-1591 3 0.889
CP032841_2 2.1|2503372|27|CP032841|CRISPRCasFinder 2503372-2503398 27 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 351352-351378 4 0.852
CP032841_2 2.1|2503372|27|CP032841|CRISPRCasFinder 2503372-2503398 27 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 54243-54269 4 0.852
CP032841_2 2.1|2503372|27|CP032841|CRISPRCasFinder 2503372-2503398 27 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 103532-103558 4 0.852
CP032841_2 2.1|2503372|27|CP032841|CRISPRCasFinder 2503372-2503398 27 MN013086 Klebsiella phage vB_Kpn_Chronis, complete genome 33543-33569 4 0.852

1. spacer 2.1|2503372|27|CP032841|CRISPRCasFinder matches to NZ_LR134256 (Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.889

ctccacctccgcaggcattgatataac	CRISPR spacer
ctccacctccgcaggcattggtactac	Protospacer
********************.**. **

2. spacer 2.1|2503372|27|CP032841|CRISPRCasFinder matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 4, identity: 0.852

ctccacctccgcaggcattgatataac	CRISPR spacer
ccgcaccgccgcaggcatcgatataac	Protospacer
*. **** **********.********

3. spacer 2.1|2503372|27|CP032841|CRISPRCasFinder matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 4, identity: 0.852

ctccacctccgcaggcattgatataac	CRISPR spacer
ccgcaccgccgcaggcatcgatataac	Protospacer
*. **** **********.********

4. spacer 2.1|2503372|27|CP032841|CRISPRCasFinder matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 4, identity: 0.852

ctccacctccgcaggcattgatataac	CRISPR spacer
ccgcaccgccgcaggcatcgatataac	Protospacer
*. **** **********.********

5. spacer 2.1|2503372|27|CP032841|CRISPRCasFinder matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 4, identity: 0.852

ctccacctccgcaggcattgatataac	CRISPR spacer
atccacctccgcaggcattggtacgac	Protospacer
 *******************.**..**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage