Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024675 Citrobacter werkmanii strain UMH18 chromosome, complete genome 1 crisprs WYL,DinG,cas3,csa3,DEDDh 0 1 7 0

Results visualization

1. CP024675
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024675_1 1538645-1538768 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024675_1 1.1|1538688|38|CP024675|CRISPRCasFinder 1538688-1538725 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 3 0.921

1. spacer 1.1|1538688|38|CP024675|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 3, identity: 0.921

cggacgcaatatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******. ****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 923796 : 974876 60 Cronobacter_phage(71.79%) head,integrase,holin,portal,terminase,tail,capsid,transposase attL 924751:924766|attR 974640:974655
DBSCAN-SWA_2 1283280 : 1333952 58 Enterobacteria_phage(33.33%) portal,integrase,tail,tRNA attL 1277485:1277503|attR 1298694:1298712
DBSCAN-SWA_3 1443228 : 1453269 10 Tupanvirus(14.29%) tRNA NA
DBSCAN-SWA_4 2388990 : 2398105 8 Bacillus_phage(28.57%) protease NA
DBSCAN-SWA_5 2438816 : 2447246 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_6 3686497 : 3694148 10 Pseudoalteromonas_phage(16.67%) NA NA
DBSCAN-SWA_7 4181183 : 4191159 10 Enterobacteria_phage(100.0%) integrase,capsid attL 4181004:4181029|attR 4193500:4193525
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage