Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024683 Citrobacter freundii strain UMH13 chromosome, complete genome 1 crisprs WYL,DinG,cas3,csa3,DEDDh,PD-DExK 0 1 9 0

Results visualization

1. CP024683
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024683_1 1395969-1396092 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024683_1 1.1|1396012|38|CP024683|CRISPRCasFinder 1396012-1396049 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 3 0.921

1. spacer 1.1|1396012|38|CP024683|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 3, identity: 0.921

cggacgcaagatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******..****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1205548 : 1214209 9 uncultured_Caudovirales_phage(37.5%) transposase NA
DBSCAN-SWA_2 1309057 : 1326995 20 Salmonella_phage(15.38%) transposase,tRNA NA
DBSCAN-SWA_3 1654248 : 1678103 28 Escherichia_phage(88.0%) terminase,plate,tail NA
DBSCAN-SWA_4 1693749 : 1703962 12 Escherichia_phage(57.14%) integrase attL 1697579:1697592|attR 1712247:1712260
DBSCAN-SWA_5 1963005 : 2048639 97 Klebsiella_phage(28.85%) terminase,holin,protease,tail,head,tRNA,integrase,portal,capsid attL 1996483:1996510|attR 2048770:2048797
DBSCAN-SWA_6 2238946 : 2246981 8 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_7 2288824 : 2298403 8 Bacillus_phage(28.57%) protease NA
DBSCAN-SWA_8 2336639 : 2345058 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_9 4783282 : 4791856 11 Enterobacteria_phage(88.89%) capsid,integrase attL 4777517:4777530|attR 4799527:4799540
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage