Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024672 Citrobacter freundii strain HM38 chromosome, complete genome 1 crisprs WYL,DinG,cas3,csa3,DEDDh,PD-DExK 0 1 6 0

Results visualization

1. CP024672
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024672_1 1530682-1530805 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024672_1 1.1|1530725|38|CP024672|CRISPRCasFinder 1530725-1530762 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 3 0.921

1. spacer 1.1|1530725|38|CP024672|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 3, identity: 0.921

cggacgcaagatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******..****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1276995 : 1338127 72 Enterobacteria_phage(18.75%) integrase,tRNA,plate,tail,terminase,holin,portal attL 1270118:1270132|attR 1319123:1319137
DBSCAN-SWA_2 2072328 : 2145412 88 Salmonella_phage(23.91%) integrase,tRNA,capsid,holin,protease,tail,terminase,head,portal attL 2105805:2105832|attR 2145543:2145570
DBSCAN-SWA_3 2231421 : 2263998 53 Enterobacterial_phage(30.23%) integrase,capsid,holin,protease,tail,terminase,head attL 2223210:2223269|attR 2264057:2264180
DBSCAN-SWA_4 2433915 : 2443493 8 Bacillus_phage(28.57%) protease NA
DBSCAN-SWA_5 2481739 : 2490158 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_6 2940195 : 3033906 88 Salmonella_phage(70.83%) integrase,tRNA,plate,capsid,tail,head,portal attL 2999996:3000041|attR 3035050:3035095
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage