Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024677 Citrobacter freundii strain UMH16 chromosome, complete genome 2 crisprs WYL,DinG,cas3,csa3,DEDDh,PD-DExK 0 2 11 0
CP024678 Citrobacter freundii strain UMH16 plasmid pUMH16, complete sequence 0 crisprs DEDDh,csa3 0 0 1 0

Results visualization

1. CP024677
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024677_1 1567479-1567602 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024677_3 4921213-4921293 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024677_1 1.1|1567522|38|CP024677|CRISPRCasFinder 1567522-1567559 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 3 0.921
CP024677_2 2.3|3624756|31|CP024677|CRT 3624756-3624786 31 LR135896 uncultured phage genomic DNA containing rbcL region region 68325-68355 5 0.839

1. spacer 1.1|1567522|38|CP024677|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 3, identity: 0.921

cggacgcaagatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******..****************************

2. spacer 2.3|3624756|31|CP024677|CRT matches to LR135896 (uncultured phage genomic DNA containing rbcL region region) position: , mismatch: 5, identity: 0.839

agtga-ttccgggatgtttttggtgctttttt	CRISPR spacer
-ttgacttccgggttgttttttgtgcttttct	Protospacer
  *** ******* ******* ********.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 937033 : 980086 51 Cronobacter_phage(66.67%) portal,capsid,integrase,head,transposase,tail,terminase attL 956608:956626|attR 981544:981562
DBSCAN-SWA_2 1273788 : 1369208 121 Vibrio_phage(16.28%) portal,capsid,integrase,holin,head,transposase,tail,terminase,tRNA attL 1278265:1278324|attR 1367543:1368792
DBSCAN-SWA_3 1458903 : 1483082 22 Cronobacter_phage(29.41%) tail,tRNA NA
DBSCAN-SWA_4 1961021 : 2037671 91 Escherichia_phage(37.93%) holin,integrase,protease,transposase,coat,tail,terminase attL 1991906:1991922|attR 2038583:2038599
DBSCAN-SWA_5 2187127 : 2240130 61 Enterobacteria_phage(31.82%) portal,integrase,holin,protease,tail attL 2198492:2198517|attR 2240263:2240288
DBSCAN-SWA_6 2264568 : 2314575 69 Enterobacteria_phage(32.0%) portal,capsid,holin,integrase,head,protease,tail,terminase,tRNA attL 2305101:2305116|attR 2320681:2320696
DBSCAN-SWA_7 2489557 : 2497063 7 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_8 2538913 : 2548491 8 Bacillus_phage(28.57%) protease NA
DBSCAN-SWA_9 2586639 : 2595058 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_10 3570198 : 3577322 9 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_11 4886736 : 4937260 46 Shigella_phage(18.18%) transposase,integrase attL 4876822:4876843|attR 4937416:4937437
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP024678
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8951 : 24603 15 Enterobacteria_phage(18.18%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage