Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033019 Janthinobacterium agaricidamnosum strain BHSEK chromosome, complete genome 4 crisprs RT,DEDDh,DinG,cas3,csa3,WYL 0 1 5 0

Results visualization

1. CP033019
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033019_1 1630710-1630810 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033019_2 3784916-3785059 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033019_3 5381114-5381266 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033019_4 6250928-6251004 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033019_4 4.1|6250951|31|CP033019|CRISPRCasFinder 6250951-6250981 31 NZ_AP018687 Vibrio rumoiensis strain FERM P-14531 plasmid 1, complete sequence 156638-156668 7 0.774
CP033019_4 4.1|6250951|31|CP033019|CRISPRCasFinder 6250951-6250981 31 AP014939 Citrobacter freundii plasmid pKHM-1 DNA, complete sequence, strain: KHM 243 31178-31208 7 0.774
CP033019_4 4.1|6250951|31|CP033019|CRISPRCasFinder 6250951-6250981 31 NZ_LN681228 Xenorhabdus nematophila AN6/1 plasmid II, complete sequence 2810-2840 7 0.774

1. spacer 4.1|6250951|31|CP033019|CRISPRCasFinder matches to NZ_AP018687 (Vibrio rumoiensis strain FERM P-14531 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.774

agcaagcggccaatatctgtaggtgggatta	CRISPR spacer
agcaagcggccaatctctggaggggtgggga	Protospacer
************** **** *** * *.  *

2. spacer 4.1|6250951|31|CP033019|CRISPRCasFinder matches to AP014939 (Citrobacter freundii plasmid pKHM-1 DNA, complete sequence, strain: KHM 243) position: , mismatch: 7, identity: 0.774

agcaagcggccaatatctgtaggtgggatta	CRISPR spacer
agcaagcggccaatctctggaggggtgggga	Protospacer
************** **** *** * *.  *

3. spacer 4.1|6250951|31|CP033019|CRISPRCasFinder matches to NZ_LN681228 (Xenorhabdus nematophila AN6/1 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.774

agcaagcggccaatatctgtaggtgggatta	CRISPR spacer
agcaagcggccaatctctggaggggtgggga	Protospacer
************** **** *** * *.  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1033086 : 1062753 37 Burkholderia_phage(33.33%) head,portal,tail,terminase,integrase,plate,capsid attL 1029725:1029755|attR 1065200:1065230
DBSCAN-SWA_2 1404552 : 1437701 44 Burkholderia_phage(34.48%) head,portal,tail,terminase,integrase,plate,capsid attL 1406740:1406757|attR 1437921:1437938
DBSCAN-SWA_3 3259972 : 3267311 7 Pseudomonas_phage(83.33%) coat,terminase NA
DBSCAN-SWA_4 3288592 : 3302213 17 Pseudomonas_phage(36.36%) integrase attL 3299402:3299417|attR 3306519:3306534
DBSCAN-SWA_5 5382518 : 5436512 58 Burkholderia_phage(26.47%) head,portal,tail,terminase,integrase,plate,capsid,tRNA attL 5383292:5383338|attR 5416716:5416762
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage