Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 1 crisprs NA 0 2 0 0
CP033044 Bacillus foraminis strain Bac44 chromosome, complete genome 5 crisprs NA 0 0 0 0

Results visualization

1. CP033045
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033045_1 507157-507303 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033045_1 1.1|507186|31|CP033045|CRISPRCasFinder 507186-507216 31 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 507186-507216 0 1.0
CP033045_1 1.2|507246|29|CP033045|CRISPRCasFinder 507246-507274 29 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 507246-507274 0 1.0
CP033045_1 1.1|507186|31|CP033045|CRISPRCasFinder 507186-507216 31 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 507305-507335 3 0.903
CP033045_1 1.2|507246|29|CP033045|CRISPRCasFinder 507246-507274 29 MN693300 Marine virus AFVG_25M71, complete genome 53662-53690 6 0.793
CP033045_1 1.2|507246|29|CP033045|CRISPRCasFinder 507246-507274 29 MN693380 Marine virus AFVG_25M72, complete genome 54393-54421 6 0.793
CP033045_1 1.2|507246|29|CP033045|CRISPRCasFinder 507246-507274 29 NZ_CP015251 Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence 12467-12495 7 0.759
CP033045_1 1.2|507246|29|CP033045|CRISPRCasFinder 507246-507274 29 MH616656 Microviridae sp. isolate ctgj845, complete genome 3002-3030 7 0.759
CP033045_1 1.1|507186|31|CP033045|CRISPRCasFinder 507186-507216 31 NC_015418 Clostridium botulinum BKT015925 plasmid p3BKT015925, complete sequence 1361-1391 8 0.742
CP033045_1 1.2|507246|29|CP033045|CRISPRCasFinder 507246-507274 29 KM224879 Vibrio phage ICP2_2013_A_Haiti, complete genome 22774-22802 8 0.724

1. spacer 1.1|507186|31|CP033045|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

tgacgataacaaaaatggtgcttctataaca	CRISPR spacer
tgacgataacaaaaatggtgcttctataaca	Protospacer
*******************************

2. spacer 1.2|507246|29|CP033045|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

tgcctattgtttatttgtgtgactaaaac	CRISPR spacer
tgcctattgtttatttgtgtgactaaaac	Protospacer
*****************************

3. spacer 1.1|507186|31|CP033045|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903 

tgacgataacaaaaatggtgcttctataaca	CRISPR spacer
caacaataacaaaaatggtgcttctataaca	Protospacer
..**.**************************

4. spacer 1.2|507246|29|CP033045|CRISPRCasFinder matches to MN693300 (Marine virus AFVG_25M71, complete genome) position: , mismatch: 6, identity: 0.793 

tgcctattgtttatttgtgtgactaaaac	CRISPR spacer
ttgttgttgtttatttgtataactaaaac	Protospacer
*  .*.************.*.********

5. spacer 1.2|507246|29|CP033045|CRISPRCasFinder matches to MN693380 (Marine virus AFVG_25M72, complete genome) position: , mismatch: 6, identity: 0.793 

tgcctattgtttatttgtgtgactaaaac	CRISPR spacer
ttgttgttgtttatttgtataactaaaac	Protospacer
*  .*.************.*.********

6. spacer 1.2|507246|29|CP033045|CRISPRCasFinder matches to NZ_CP015251 (Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence) position: , mismatch: 7, identity: 0.759 

tgcctattgtttatttgtgtgactaaaac	CRISPR spacer
tgcctattgtttatttgtttggttctatt	Protospacer
****************** **..*  * .

7. spacer 1.2|507246|29|CP033045|CRISPRCasFinder matches to MH616656 (Microviridae sp. isolate ctgj845, complete genome) position: , mismatch: 7, identity: 0.759 

tgcctattgtttatttgtgtgactaaaac	CRISPR spacer
caaatcttgttaatttgtgtgtctaaaac	Protospacer
..  * ***** ********* *******

8. spacer 1.1|507186|31|CP033045|CRISPRCasFinder matches to NC_015418 (Clostridium botulinum BKT015925 plasmid p3BKT015925, complete sequence) position: , mismatch: 8, identity: 0.742 

tgacgataacaaaaatggtgcttctataaca	CRISPR spacer
attaaataagaaaaatggtgcttctaaaaaa	Protospacer
    .**** **************** ** *

9. spacer 1.2|507246|29|CP033045|CRISPRCasFinder matches to KM224879 (Vibrio phage ICP2_2013_A_Haiti, complete genome) position: , mismatch: 8, identity: 0.724 

tgcctattgtttatttgtgtgactaaaac	CRISPR spacer
gtacacctgtttatttgcgtgactaaaag	Protospacer
   *  .**********.**********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033044
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033044_1 445000-445073 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033044_2 863675-863784 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033044_3 1900616-1900733 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033044_4 2581726-2581974 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033044_5 4876206-4876282 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage