Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
---|---|---|---|---|---|---|---|
CP033043 | Bacillus litoralis strain Bac94 chromosome, complete genome | 6 crisprs | 1 | 2 | 0 | 0 |
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
CP033043_1 | 354905-354991 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
CP033043_2 | 413898-414243 | Orphan |
NA
|
6 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
CP033043_3 | 3063567-3063752 | Orphan |
NA
|
3 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
CP033043_4 | 4236913-4236986 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
CP033043_5 | 4792637-4792711 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
CP033043_6 | 4971785-4972334 | Orphan |
NA
|
10 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|
CP033043_3 | 3063590-3063617 | 28 | CP033043.1 | 1370212-1370239 | 2 | 0.929 | |
CP033043_3 | 3063590-3063617 | 28 | CP033043.1 | 2385419-2385446 | 2 | 0.929 | |
CP033043_3 | 3063590-3063617 | 28 | CP033043.1 | 2893450-2893477 | 2 | 0.929 | |
CP033043_3 | 3063590-3063617 | 28 | CP033043.1 | 2997792-2997819 | 2 | 0.929 | |
CP033043_3 | 3063590-3063617 | 28 | CP033043.1 | 3144905-3144932 | 2 | 0.929 | |
CP033043_3 | 3063590-3063617 | 28 | CP033043.1 | 3973758-3973785 | 2 | 0.929 | |
CP033043_3 | 3063590-3063617 | 28 | CP033043.1 | 4606068-4606095 | 2 | 0.929 | |
CP033043_3 | 3063590-3063617 | 28 | CP033043.1 | 4979975-4980002 | 2 | 0.929 |
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgaggaaatagcataaaaaattgattaa Protospacer *************.******* ******
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgaggaggtagcacaaaaaatagattaa Protospacer ******..********************
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgaggaaatagtacgaaaaatagattaa Protospacer ***********.**.*************
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgaggaaatagcacgaaaaattgattaa Protospacer **************.****** ******
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgaagaaatggcacaaaaaatagattaa Protospacer ***.*****.******************
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgaggaaatagaacgaaaaatagattaa Protospacer *********** **.*************
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgaggaattagcacgaaaaatagattaa Protospacer ******* ******.*************
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgaggaaatagcacaaaaaaaagatgaa Protospacer ******************** **** **
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
CP033043_6 | 4972179-4972200 | 22 | NZ_CP023000 | Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence | 1155876-1155897 | 1 | 0.955 | |
CP033043_3 | 3063590-3063617 | 28 | NZ_CP040940 | Cetia pacifica strain TB6 plasmid unnamed1, complete sequence | 87370-87397 | 4 | 0.857 | |
CP033043_3 | 3063590-3063617 | 28 | NZ_CP033813 | Staphylococcus haemolyticus strain FDAARGOS_517 plasmid unnamed2 | 13820-13847 | 5 | 0.821 | |
CP033043_3 | 3063590-3063617 | 28 | NZ_CP023496 | Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence | 43102-43129 | 5 | 0.821 | |
CP033043_3 | 3063590-3063617 | 28 | NC_014502 | Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence | 70971-70998 | 6 | 0.786 | |
CP033043_3 | 3063590-3063617 | 28 | HM029250 | Lactococcus phage 949, complete genome | 17196-17223 | 6 | 0.786 | |
CP033043_3 | 3063590-3063617 | 28 | CP020755 | Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence | 76749-76776 | 6 | 0.786 |
tcaagaaggaaaccgttccaaa CRISPR spacer tcaagaaggaaaccgatccaaa Protospacer *************** ******
tgaggaaatagcacaaaaaatagattaa CRISPR spacer ttatgaaatagcgcaaaaaatagatgaa Protospacer * * ********.************ **
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgagaaaatagaacaaaaaatagagtct Protospacer ****.****** ************ *
tgaggaaatagcacaaaaaatagattaa CRISPR spacer tgagaaaatagaacaaaaaatagagtct Protospacer ****.****** ************ *
tgaggaaatagcacaaaaaatagattaa CRISPR spacer ccaggaaatagcacaaaaattaaatttg Protospacer . ***************** **.*** .
tgaggaaatagcacaaaaaatagattaa CRISPR spacer aaaacaaatagcaaaaaaaatatattaa Protospacer .*. ******** ******** *****
tgaggaaatagcacaaaaaatagattaa CRISPR spacer agaggaaaaaacacaaaaaatagaagat Protospacer ******* *.************* *
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|