1. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 5, identity: 0.833
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
gctggcgatgtgcgagtgtccggcgatgcg Protospacer
.*******.***.***************
2. spacer 2.6|4694956|30|CP033069|CRISPRCasFinder,CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
agtcctgctcggtgctgttggcgtacacgc CRISPR spacer
agccggtctcggtgttgatggcgtacacgc Protospacer
**.* *******.** ************
3. spacer 2.7|4695022|30|CP033069|CRISPRCasFinder,CRT matches to NZ_CP022549 (Sphingorhabdus sp. YGSMI21 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
gtgcattcgatgccgcagacatcggccttg CRISPR spacer
cgggaatcgctgccgcagacatcgaccttg Protospacer
* * *** **************.*****
4. spacer 2.18|4695747|30|CP033069|CRISPRCasFinder,CRT matches to MK967377 (Gordonia phage MagicMan, complete genome) position: , mismatch: 6, identity: 0.8
cgtggcgcaggtacagagcaactgcggcca CRISPR spacer
ggtggcacaggtacagaggaactgggtgca Protospacer
*****.*********** ***** * **
5. spacer 2.22|4696011|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019319 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence) position: , mismatch: 6, identity: 0.8
agagcgggcgtaaaaaagcccgcaaggagc CRISPR spacer
agcgtaagcggaaaaaagcccgcaaggagg Protospacer
** *...*** ******************
6. spacer 2.24|4696143|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NC_006571 (Streptomyces albulus plasmid pNO33 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
tcgcaccaagcgcgtgaacctgtcgttgaa CRISPR spacer
gcgagcgaagcgcgtgaacctctcgttcaa Protospacer
** .* ************** ***** **
7. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
tccggcgatacgcgggcgtccggcgcggtg Protospacer
* *******.******.******** *.*
8. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NC_008538 (Arthrobacter sp. FB24 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.8
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
tacgtcgatgcgccggtgtccggcacggcc Protospacer
**** ******** **********. **
9. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NC_015147 (Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE302, complete sequence) position: , mismatch: 6, identity: 0.8
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
tacgtcgatgcgccggtgtccggcacggcc Protospacer
**** ******** **********. **
10. spacer 2.28|4696407|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030844 (Acidisarcina polymorpha strain SBC82 plasmid pACPOL3, complete sequence) position: , mismatch: 6, identity: 0.8
tttgaccagcgctgattacatctcgctcca CRISPR spacer
acacaccagcgccgattacatctcgctcta Protospacer
. ********.***************.*
11. spacer 2.35|4696869|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to MH825699 (Streptomyces phage Darolandstone, complete genome) position: , mismatch: 6, identity: 0.8
cgacagcaagcgccgcagctacggggtgaa CRISPR spacer
cggcagcaagcgcagcagctacgagataca Protospacer
**.********** *********.*.*. *
12. spacer 2.35|4696869|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to KY092484 (Streptomyces phage Raleigh, complete genome) position: , mismatch: 6, identity: 0.8
cgacagcaagcgccgcagctacggggtgaa CRISPR spacer
cggcagcaagcgcagcagctacgagataca Protospacer
**.********** *********.*.*. *
13. spacer 2.2|4694693|30|CP033069|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
gggtgcagtcaatgatgcccgcctgctctg CRISPR spacer
cgtttcagtcgatgacgcccgcctgctcct Protospacer
* * *****.****.************.
14. spacer 2.2|4694693|30|CP033069|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.767
gggtgcagtcaatgatgcccgcctgctctg CRISPR spacer
cgtttcagtcgatgacgcccgcctgctcct Protospacer
* * *****.****.************.
15. spacer 2.5|4694890|30|CP033069|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cttttttcgtcagcgcctctcggtcgtaca CRISPR spacer
tcattttcgtcagcgcctcacggtcaatca Protospacer
.. **************** *****. **
16. spacer 2.7|4695022|30|CP033069|CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 7, identity: 0.767
gtgcattcgatgccgcagacatcggccttg CRISPR spacer
atctggtcggtgtcgcagacatcggccttg Protospacer
.* .. ***.**.*****************
17. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
18. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
19. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
20. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
21. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
22. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
23. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
24. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
25. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
26. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
27. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
28. spacer 2.11|4695286|30|CP033069|CRISPRCasFinder,CRT matches to KJ094025 (Listeria phage LP-032 contig 2, partial genome) position: , mismatch: 7, identity: 0.767
gacgcaagtgaagagtgcgttaactcctga CRISPR spacer
agtccaagagaagagtgcgttaactgctgt Protospacer
... **** **************** ***
29. spacer 2.22|4696011|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to MN855748 (Bacteriophage sp. isolate 78, complete genome) position: , mismatch: 7, identity: 0.767
agagcgggcgtaaaaaagcccgcaaggagc CRISPR spacer
attgcggacgtaaaaaagcccgccagatgg Protospacer
* ****.*************** **. *
30. spacer 2.24|4696143|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
tcgcaccaagcgcgtgaacctgtcgttgaa----- CRISPR spacer
ccgcaccaagcgcgtgaa-----cgtggaaggcgc Protospacer
.***************** *** ***
31. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
gacggggacgcgcgggtgtccggcgcgggc Protospacer
**** **.**************** *
32. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP017660 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_6) position: , mismatch: 7, identity: 0.767
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
cttgccaatgcgggggtgttcggcgatgcg Protospacer
. .* *.***** ******.**********
33. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018667 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_4, complete sequence) position: , mismatch: 7, identity: 0.767
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
cttgccaatgcgggggtgttcggcgatgcg Protospacer
. .* *.***** ******.**********
34. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 7, identity: 0.767
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
cttgccaatgcgggggtgttcggcgatgcg Protospacer
. .* *.***** ******.**********
35. spacer 2.26|4696275|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ940994 (Pseudomonas sp. LM8 plasmid pLM8P2, complete sequence) position: , mismatch: 7, identity: 0.767
ggaggaagaacgccagcggcaagagcagtg CRISPR spacer
aggcgaagaaagccagcggcacgagcaacg Protospacer
.*. ****** ********** *****..*
36. spacer 2.26|4696275|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 7, identity: 0.767
ggaggaagaacgccagcggcaagagcagtg CRISPR spacer
ccggcaagaacgccaacggcaagaccagcg Protospacer
.* **********.******** ***.*
37. spacer 2.28|4696407|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
tttgaccagcgctgattacatctcgctcca CRISPR spacer
ctatgacagcgccgattacatctcgctgca Protospacer
.* . ******.************** **
38. spacer 2.28|4696407|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
tttgaccagcgctgattacatctcgctcca CRISPR spacer
ctatgacagcgccgattacatctcgctgca Protospacer
.* . ******.************** **
39. spacer 2.28|4696407|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
tttgaccagcgctgattacatctcgctcca CRISPR spacer
ctatgacagcgccgattacatctcgctgca Protospacer
.* . ******.************** **
40. spacer 2.28|4696407|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
tttgaccagcgctgattacatctcgctcca CRISPR spacer
ctatgacagcgccgattacatctcgctgca Protospacer
.* . ******.************** **
41. spacer 2.35|4696869|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to JN880423 (Salisaeta icosahedral phage 1, complete genome) position: , mismatch: 7, identity: 0.767
cgacagcaagcgccgcagctacggggtgaa---- CRISPR spacer
cggcagcaagcgccgcagcta----gcgcagccg Protospacer
**.****************** *.* *
42. spacer 2.2|4694693|30|CP033069|CRISPRCasFinder,CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 8, identity: 0.733
gggtgcagtcaatgatgcccgcctgctctg CRISPR spacer
tggtgaagtcgatgatgcccgcctttgtcg Protospacer
**** ****.************* . ..*
43. spacer 2.4|4694825|29|CP033069|CRISPRCasFinder,CRT matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 8, identity: 0.724
ctcggggtgaccacttcgccatgctcttg CRISPR spacer
atcgtggtgacctcttcgccatgcgggaa Protospacer
*** ******* *********** .
44. spacer 2.14|4695484|30|CP033069|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
caaaacgcgccccgtggaaggaatcgacca CRISPR spacer
ccgccgccgccccgtcgaaggcatcgacca Protospacer
* . ******** ***** ********
45. spacer 2.14|4695484|30|CP033069|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
caaaacgcgccccgtggaaggaatcgacca CRISPR spacer
ccgccgccgccccgtcgaaggcatcgacca Protospacer
* . ******** ***** ********
46. spacer 2.14|4695484|30|CP033069|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.733
caaaacgcgccccgtggaaggaatcgacca CRISPR spacer
ccgccgccgccccgtcgaaggcatcgacca Protospacer
* . ******** ***** ********
47. spacer 2.22|4696011|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to MT024872 (Streptomyces phage Muntaha, complete genome) position: , mismatch: 8, identity: 0.733
agagcgggcgtaaaaaagcccgcaaggagc CRISPR spacer
tcggcgggcttgaaaaagcccgcaagcttc Protospacer
.****** *.************** *
48. spacer 2.22|4696011|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to MT024865 (Streptomyces phage Wakanda, complete genome) position: , mismatch: 8, identity: 0.733
agagcgggcgtaaaaaagcccgcaaggagc CRISPR spacer
tcggcgggcttgaaaaagcccgcaagcttc Protospacer
.****** *.************** *
49. spacer 2.24|4696143|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.733
tcgcaccaagcgcgtgaacctgtcgttgaa CRISPR spacer
aaggcgcaagcgcgtgaacgtgtcgtcgag Protospacer
* ************* ******.**.
50. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045376 (Sulfitobacter sp. THAF37 plasmid pTHAF37_d, complete sequence) position: , mismatch: 8, identity: 0.733
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
gggcgcgaggcgctggtgtccggcgatgtc Protospacer
. **** **** **************.
51. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.733
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
ggcggcgatgcgccggtctccggcgcagga Protospacer
.*********** *** ******* * .
52. spacer 2.25|4696209|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017579 (Sphingomonas melonis TY plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tacggcgatgcgcgggtgtccggcgatgcg CRISPR spacer
atcggctatgcgcgggtgtcccgcggcgac Protospacer
**** ************** ***..*
53. spacer 2.26|4696275|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025812 (Sulfitobacter sp. SK025 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733
ggaggaagaacgccagcggcaagagcagtg CRISPR spacer
gcttgaagaacgccagcggcaggaggacga Protospacer
* *****************.*** * .
54. spacer 2.26|4696275|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045373 (Sulfitobacter sp. THAF37 plasmid pTHAF37_a, complete sequence) position: , mismatch: 8, identity: 0.733
ggaggaagaacgccagcggcaagagcagtg CRISPR spacer
gcttgaagaacgccagcggcaggaggaaga Protospacer
* *****************.*** *. .
55. spacer 2.33|4696737|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 8, identity: 0.733
gtccaggctggcgataggatcacgccttat CRISPR spacer
ctccagcctggcgacaggatcacgctgctc Protospacer
***** *******.**********. . .
56. spacer 2.34|4696803|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 8, identity: 0.733
ccactcgggaggcttgccagttcctcgcag CRISPR spacer
atcgtcgggcggcttgccagttcctcatcg Protospacer
. ***** ****************.. *
57. spacer 2.34|4696803|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
ccactcgggaggcttgccagttcctcgcag CRISPR spacer
ccgctcgggatgcttgccagttctcgactt Protospacer
**.******* ************.. .*
58. spacer 2.6|4694956|30|CP033069|CRISPRCasFinder,CRT matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7
agtcctgctcggtgctgttggcgtacacgc CRISPR spacer
gcgcctgctcgctgctgttggcgtggagca Protospacer
. ******** ************. *
59. spacer 2.10|4695220|30|CP033069|CRISPRCasFinder,CRT matches to NC_021250 (Pseudomonas migulae strain D2RT plasmid pD2RT, complete sequence) position: , mismatch: 9, identity: 0.7
tgaaatacgacaacccagctggacgtttgc CRISPR spacer
gctttttcgacaacccagcaggacgtttca Protospacer
* ************ ********
60. spacer 2.20|4695879|30|CP033069|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7
ccactcgggaggcttgccagttccacgtag CRISPR spacer
ccgctcgggatgcttgccagttctcgactt Protospacer
**.******* ************. ..
61. spacer 2.22|4696011|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035089 (Pseudomonas sp. 11K1 plasmid p11K1, complete sequence) position: , mismatch: 9, identity: 0.7
agagcgggcgtaaaaaagcccgcaaggagc CRISPR spacer
ccggcaggcgcaaaaaagcccgcaagagcg Protospacer
.**.****.***************..
62. spacer 2.23|4696077|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 9, identity: 0.7
gcttaccgcgttcggtgtgccgctgggtct CRISPR spacer
ctttgccgctttcggtgtgccgctgttcaa Protospacer
.**.**** *************** .
63. spacer 2.26|4696275|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaggaagaacgccagcggcaagagcagtg CRISPR spacer
tcggccagaacggcagcggcaagagcaccc Protospacer
.* ****** ************** .
64. spacer 2.26|4696275|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NC_020060 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899a, complete sequence) position: , mismatch: 9, identity: 0.7
ggaggaagaacgccagcggcaagagcagtg CRISPR spacer
tcggcgagaacggcagcggcaagagcacga Protospacer
.* .****** ************** .
65. spacer 2.26|4696275|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017103 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872a, complete sequence) position: , mismatch: 9, identity: 0.7
ggaggaagaacgccagcggcaagagcagtg CRISPR spacer
ttggcgagaacggcagcggcaagagcacga Protospacer
.* .****** ************** .
66. spacer 2.26|4696275|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to CP006878 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602a, complete sequence) position: , mismatch: 9, identity: 0.7
ggaggaagaacgccagcggcaagagcagtg CRISPR spacer
tcggcgagaacggcagcggcaagagcacga Protospacer
.* .****** ************** .
67. spacer 2.26|4696275|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.7
ggaggaagaacgccagcggcaagagcagtg CRISPR spacer
tcggcgagaacggcagcggcaagagcacga Protospacer
.* .****** ************** .
68. spacer 2.22|4696011|30|CP033069|CRISPRCasFinder,CRT,PILER-CR matches to NC_021211 (Pseudomonas sp. GLE121 plasmid pGLE121P2, complete sequence) position: , mismatch: 10, identity: 0.667
agagcgggcgtaaaaaagcccgcaaggagc CRISPR spacer
ccagcgggcgcaaaaaagcccgccgaagcg Protospacer
********.************ ....
