Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022561 Pseudomonas putida strain B4 chromosome, complete genome 2 crisprs WYL,RT,DEDDh,csa3,cas3,DinG 1 0 6 0

Results visualization

1. CP022561
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022561_1 702843-702937 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022561_3 5862721-5862822 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP022561_2 2.1|4728763|29|CP022561|CRISPRCasFinder 4728763-4728791 29 CP022561.1 2212789-2212817 0 1.0

1. spacer 2.1|4728763|29|CP022561|CRISPRCasFinder matches to position: 2212789-2212817, mismatch: 0, identity: 1.0

actctgagccgattcggaccacttcagcc	CRISPR spacer
actctgagccgattcggaccacttcagcc	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1083291 : 1091070 10 Thermobifida_phage(16.67%) NA NA
DBSCAN-SWA_2 1374548 : 1476968 117 Pseudomonas_phage(43.9%) portal,terminase,capsid,head,transposase,tail,integrase,tRNA attL 1403071:1403130|attR 1439653:1439717
DBSCAN-SWA_3 2115457 : 2124130 10 uncultured_Caudovirales_phage(75.0%) tRNA NA
DBSCAN-SWA_4 2193002 : 2248035 74 Pseudomonas_phage(44.9%) portal,terminase,capsid,head,tail,transposase,holin,bacteriocin,integrase,protease attL 2200137:2200196|attR 2252152:2252243
DBSCAN-SWA_5 2558264 : 2568142 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_6 4687956 : 4762204 97 Pseudomonas_phage(42.62%) portal,terminase,capsid,tail,transposase,holin,head,tRNA,integrase attL 4687182:4687210|attR 4767037:4767065
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage