CRISPRimmunity

Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Self targeting spacer number	Target MGE spacer number
CP033081	Glutamicibacter nicotianae strain OTC-16 chromosome, complete genome	1 crisprs	NA	7	1
CP033083	Glutamicibacter nicotianae strain OTC-16 plasmid unnamed2, complete sequence	0 crisprs	NA	0	0
CP033082	Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence	1 crisprs	NA	0	2

Results visualization

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP033081_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP033081_1

2827786-2828595

Orphan

Consensus_repeat	Method
CAGTTGCATCGGCAGTAG	CRT

10 spacers

The CRISPR arrays of CP033081_1

>merge|CP033081|1|2827786-2828595|CRT
CGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAG

>CP033081|1|1|2827786-2828595|CRT
CGGTCGAATCAGCAGTTG	CATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAG
CAGTTGCATCGGCAGTAG	CGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAG
CAGTTGCATCGGCAGTAG	CGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAG
CAGTTGCATCGGCAGTAG	CGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAGCAGTTGCATCGGCAGTAGCGTCAG
CAGTTGCATCGGCAGTAG	CGTCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAG
CAGTTGCATCGGCAGTAG	CGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAG
CAGTTGCATCGGCAGTAG	CGTCAGCGGTCGAATCAGCAGTTGCATCGGCAGTAGCGTCAGCGGTCGAATCAG
CAGTTGCATCGGCAGTAG	CGTCAGCGGTCGAATCAG
CAGTTGCATCGGCAGTAG	CGTCAGCAGTTGCATCGGCAGTAGCGTCAG
CAGTTGCATCGGCAGTAG	CGTCAGCGGTCGAATCAG
CAGTTGCATCGGCAGTAG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity
CP033081_1	1.8\|2828476\|18\|CP033081\|CRT	2828476-2828493	18	CP033081.1	2827780-2827797	0	1.0
CP033081_1	1.10\|2828560\|18\|CP033081\|CRT	2828560-2828577	18	CP033081.1	2827780-2827797	0	1.0
CP033081_1	1.6\|2828332\|54\|CP033081\|CRT	2828332-2828385	54	CP033081.1	2828560-2828613	1	0.981
CP033081_1	1.7\|2828404\|54\|CP033081\|CRT	2828404-2828457	54	CP033081.1	2828560-2828613	1	0.981
CP033081_1	1.8\|2828476\|18\|CP033081\|CRT	2828476-2828493	18	CP033081.1	2828596-2828613	1	0.944
CP033081_1	1.10\|2828560\|18\|CP033081\|CRT	2828560-2828577	18	CP033081.1	2828596-2828613	1	0.944
CP033081_1	1.1\|2827804\|78\|CP033081\|CRT	2827804-2827881	78	CP033081.1	2828524-2828601	18	0.769
CP033081_1	1.5\|2828236\|78\|CP033081\|CRT	2828236-2828313	78	CP033081.1	2828536-2828613	18	0.769
CP033081_1	1.2\|2827900\|102\|CP033081\|CRT	2827900-2828001	102	CP033081.1	2827780-2827881	42	0.588

1. spacer 1.8|2828476|18|CP033081|CRT matches to position: 2827780-2827797, mismatch: 0, identity: 1.0

cgtcagcggtcgaatcag	CRISPR spacer
cgtcagcggtcgaatcag	Protospacer
******************

2. spacer 1.10|2828560|18|CP033081|CRT matches to position: 2827780-2827797, mismatch: 0, identity: 1.0

cgtcagcggtcgaatcag	CRISPR spacer
cgtcagcggtcgaatcag	Protospacer
******************

3. spacer 1.6|2828332|54|CP033081|CRT matches to position: 2828560-2828613, mismatch: 1, identity: 0.981

cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcggtcgaatcag	CRISPR spacer
cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcggtcgcatcag	Protospacer
************************************************ *****

4. spacer 1.7|2828404|54|CP033081|CRT matches to position: 2828560-2828613, mismatch: 1, identity: 0.981

cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcggtcgaatcag	CRISPR spacer
cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcggtcgcatcag	Protospacer
************************************************ *****

5. spacer 1.8|2828476|18|CP033081|CRT matches to position: 2828596-2828613, mismatch: 1, identity: 0.944

cgtcagcggtcgaatcag	CRISPR spacer
cgtcagcggtcgcatcag	Protospacer
************ *****

6. spacer 1.10|2828560|18|CP033081|CRT matches to position: 2828596-2828613, mismatch: 1, identity: 0.944

cgtcagcggtcgaatcag	CRISPR spacer
cgtcagcggtcgcatcag	Protospacer
************ *****

7. spacer 1.1|2827804|78|CP033081|CRT matches to position: 2828524-2828601, mismatch: 18, identity: 0.769

catcggcagtagcgtcagcagttgcatcggcagtagcgtcagcggtcgaatcagcagttg	CRISPR spacer
catcggcagtagcgtcagcagttgcatcggcagtagcgtcagcggtcgaatcagcagttg	Protospacer
************************************************************

8. spacer 1.5|2828236|78|CP033081|CRT matches to position: 2828536-2828613, mismatch: 18, identity: 0.769

cgtcagcagttgcatcggcagtagcgtcagcggtcgaatcagcagttgcatcggcagtag	CRISPR spacer
cgtcagcagttgcatcggcagtagcgtcagcggtcgaatcagcagttgcatcggcagtag	Protospacer
************************************************************

9. spacer 1.2|2827900|102|CP033081|CRT matches to position: 2827780-2827881, mismatch: 42, identity: 0.588

cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcagttgcatcggcagtag	CRISPR spacer
cgtcagcggtcgaatcagcagttgcatcggcagtagcgtcagcagttgcatcggcagtag	Protospacer
************************************************************

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
CP033081_1	1.9\|2828512\|30\|CP033081\|CRT	2828512-2828541	30	NZ_CP026517	Deinococcus sp. NW-56 plasmid unnamed1, complete sequence	324428-324457	7	0.767
CP033081_1	1.9\|2828512\|30\|CP033081\|CRT	2828512-2828541	30	NZ_CP019063	Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence	502010-502039	8	0.733
CP033081_1	1.9\|2828512\|30\|CP033081\|CRT	2828512-2828541	30	NZ_CP019063	Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence	502815-502844	8	0.733
CP033081_1	1.9\|2828512\|30\|CP033081\|CRT	2828512-2828541	30	NZ_CP019063	Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence	503623-503652	8	0.733
CP033081_1	1.9\|2828512\|30\|CP033081\|CRT	2828512-2828541	30	MG592425	Vibrio phage 1.042.O._10N.286.45.B8, partial genome	18831-18860	8	0.733
CP033081_1	1.9\|2828512\|30\|CP033081\|CRT	2828512-2828541	30	MG592448	Vibrio phage 1.071.A._10N.286.46.A12, partial genome	19230-19259	8	0.733
CP033081_1	1.9\|2828512\|30\|CP033081\|CRT	2828512-2828541	30	MG592400	Vibrio phage 1.016.O._10N.286.46.A11, partial genome	18951-18980	8	0.733
CP033081_1	1.9\|2828512\|30\|CP033081\|CRT	2828512-2828541	30	AP013821	Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15A-MedDCM-OCT-S23-C116, * SEQUENCING IN PROGRESS *	8322-8351	10	0.667
CP033081_1	1.9\|2828512\|30\|CP033081\|CRT	2828512-2828541	30	AP013507	Uncultured Mediterranean phage uvMED DNA, complete genome, group G2, isolate: uvMED-CGR-C15A-MedDCM-OCT-S31-C20	14085-14114	10	0.667

1. spacer 1.9|2828512|30|CP033081|CRT matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgtcagcagttgcatcggcagtagcgtcag	CRISPR spacer
ccacagcagttgcagcggcagcagcgcgat	Protospacer
*  *********** ******.****. *

2. spacer 1.9|2828512|30|CP033081|CRT matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgtcagcagttgcatcggcagtagcgtcag	CRISPR spacer
ataaagcatttgcatcggcagcagcgtgat	Protospacer
    **** ************.***** *

3. spacer 1.9|2828512|30|CP033081|CRT matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgtcagcagttgcatcggcagtagcgtcag	CRISPR spacer
ataaagcatttgcatcggcagcagcgtgat	Protospacer
    **** ************.***** *

4. spacer 1.9|2828512|30|CP033081|CRT matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgtcagcagttgcatcggcagtagcgtcag	CRISPR spacer
ataaagcatttgcatcggcagcagcgtgat	Protospacer
    **** ************.***** *

5. spacer 1.9|2828512|30|CP033081|CRT matches to MG592425 (Vibrio phage 1.042.O._10N.286.45.B8, partial genome) position: , mismatch: 8, identity: 0.733

cgtcagcagttgcatcggcagtagcgtcag	CRISPR spacer
tgtcagcagttgcaacgtcagtagatgaat	Protospacer
.************* ** ******    *

6. spacer 1.9|2828512|30|CP033081|CRT matches to MG592448 (Vibrio phage 1.071.A._10N.286.46.A12, partial genome) position: , mismatch: 8, identity: 0.733

cgtcagcagttgcatcggcagtagcgtcag	CRISPR spacer
tgtcagcagttgcaacgtcagtagatgaat	Protospacer
.************* ** ******    *

7. spacer 1.9|2828512|30|CP033081|CRT matches to MG592400 (Vibrio phage 1.016.O._10N.286.46.A11, partial genome) position: , mismatch: 8, identity: 0.733

cgtcagcagttgcatcggcagtagcgtcag	CRISPR spacer
tgtcagcagttgcaacgtcagtagatgaat	Protospacer
.************* ** ******    *

8. spacer 1.9|2828512|30|CP033081|CRT matches to AP013821 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15A-MedDCM-OCT-S23-C116, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.667

cgtcagcagttgcatcggcagtagcgtcag	CRISPR spacer
gagtagcagttggatcggcagtagctctta	Protospacer
 . .******** ************ .. .

9. spacer 1.9|2828512|30|CP033081|CRT matches to AP013507 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G2, isolate: uvMED-CGR-C15A-MedDCM-OCT-S31-C20) position: , mismatch: 10, identity: 0.667

cgtcagcagttgcatcggcagtagcgtcag	CRISPR spacer
gagtagcagttggatcggcagtagctctta	Protospacer
 . .******** ************ .. .

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage

2. CP033082

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP033082_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP033082_1

92152-92331

Orphan

Consensus_repeat	Method
TTAACCACGTGCAATCGGTGACGCCTCATC	PILER-CR

2 spacers

The CRISPR arrays of CP033082_1

>merge|CP033082|1|92152-92331|PILER-CR
TTATCCACGTGCAATCGGTGACGCCCCTATTGCAGCGGGTGTGGATAATTTTCTGGAGGAGTTAATCCGTGTGTTTTCAGGGATGCAGCACGTGCAATCGGTGACGCTTCATCTCAGTGAAGGAAGTTTTCCACGTGCAATCGGTGACGCTTAACCACGTGCAATCGGTGACGTCTGATC

>CP033082|1|1|92152-92331|PILER-CR
TTATCCACGTGCAATCGGTGACGCCCCTAT	TGCAGCGGGTGTGGATAATTTTCTGGAGGAGTTAATCCGTGTGTTTTCAGGGATGCAGCACGT
GCAATCGGTGACGCTTCATCTCAGTGAAGG	AAGTTTTCCACGTGCAATCGGTGACGCTTAACCACGT
GCAATCGGTGACGTCTGATC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
CP033082_1	1.2\|92275\|37\|CP033082\|PILER-CR	92275-92311	37	NZ_CP033082	Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence	92265-92301	0	1.0
CP033082_1	1.1\|92182\|63\|CP033082\|PILER-CR	92182-92244	63	NZ_CP033082	Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence	92177-92239	3	0.952
CP033082_1	1.2\|92275\|37\|CP033082\|PILER-CR	92275-92311	37	NZ_CP033082	Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence	92139-92175	7	0.811

1. spacer 1.2|92275|37|CP033082|PILER-CR matches to NZ_CP033082 (Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcagtgaaggaagttttccacgtgcaatcggtgacgc	CRISPR spacer
tcagtgaaggaagttttccacgtgcaatcggtgacgc	Protospacer
*************************************

2. spacer 1.1|92182|63|CP033082|PILER-CR matches to NZ_CP033082 (Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.952

cctattgcagcgggtgtggataattttctggaggagttaatccgtgtgttttcagggatg	CRISPR spacer
cctattgcagcgggtgtggataattttctggaggagttaatccgtgtgttttcagggatg	Protospacer
************************************************************

3. spacer 1.2|92275|37|CP033082|PILER-CR matches to NZ_CP033082 (Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

tcagtgaaggaagttttccacgtgcaatcggtgacgc	CRISPR spacer
tggatagagcaagttatccacgtgcaatcggtgacgc	Protospacer
* ..*..** ***** *********************

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage

Overview of predicted results

Overview of the results

Cas Category Instructions

Results visualization

1. CP033081

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Click the colored protein region to show detailed information

Self-targeting detection

MGE targeting detection<

Prophage detection

Anti-CRISPR protein detection

2. CP033082

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Click the colored protein region to show detailed information

Self-targeting detection

MGE targeting detection<

Prophage detection

Anti-CRISPR protein detection