1. spacer 1.17|941431|33|CP033090|CRISPRCasFinder matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 4, identity: 0.879
caaacaccaagctcttccgccgcgcgttcctga CRISPR spacer
catttaccaagctcttccgctgcgcgttcctga Protospacer
** .***************.************
2. spacer 1.17|941431|33|CP033090|CRISPRCasFinder matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 4, identity: 0.879
caaacaccaagctcttccgccgcgcgttcctga CRISPR spacer
catttaccaagctcttccgctgcgcgttcctga Protospacer
** .***************.************
3. spacer 1.6|941368|34|CP033090|PILER-CR,CRT matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 5, identity: 0.853
ccaattt----aggggccggaactccgggaaaggcagc CRISPR spacer
----tttgagaaggggccggaactccgggaaaggcacc Protospacer
*** ************************* *
4. spacer 1.6|941368|34|CP033090|PILER-CR,CRT matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853
ccaattt----aggggccggaactccgggaaaggcagc CRISPR spacer
----tttgagaaggggccggaactccgggaaaggcacc Protospacer
*** ************************* *
5. spacer 1.7|941429|35|CP033090|PILER-CR,CRT matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 5, identity: 0.857
cgcaaacaccaagctcttccgccgcgcgttcctga CRISPR spacer
ggcatttaccaagctcttccgctgcgcgttcctga Protospacer
*** .***************.************
6. spacer 1.7|941429|35|CP033090|PILER-CR,CRT matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 5, identity: 0.857
cgcaaacaccaagctcttccgccgcgcgttcctga CRISPR spacer
ggcatttaccaagctcttccgctgcgcgttcctga Protospacer
*** .***************.************
7. spacer 1.6|941368|34|CP033090|PILER-CR,CRT matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.824
ccaattt----aggggccggaactccgggaaaggcagc CRISPR spacer
----tttgagaaggggccggaactccggaaaaggcacc Protospacer
*** *****************.******* *
8. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 6, identity: 0.812
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccgggaaaggcacc Protospacer
. ************************* *
9. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccgggaaaggcacc Protospacer
. ************************* *
10. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggaaaaggcacc Protospacer
. *****************.******* *
11. spacer 1.9|941552|34|CP033090|PILER-CR,CRT matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.765
cgcggtcgcagcctggcctgttgccgtagaatcg CRISPR spacer
cgcgatcgcagcctgggctgttgccgtgctcgcc Protospacer
****.*********** **********. *
12. spacer 1.14|941248|32|CP033090|CRISPRCasFinder matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75
ctgccggtctgtgctgttgtcgtcaataatca CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa Protospacer
*.* ************* ****** ** *
13. spacer 1.14|941248|32|CP033090|CRISPRCasFinder matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75
ctgccggtctgtgctgttgtcgtcaataatca CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa Protospacer
*.* ************* ****** ** *
14. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP053022 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence) position: , mismatch: 8, identity: 0.75
---aatttaggggccggaactccgggaaaggcagc CRISPR spacer
gtcagtt---gggccggaaagccgggaaaggcata Protospacer
*.** ********* ************
15. spacer 1.19|941554|32|CP033090|CRISPRCasFinder matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.75
cggtcgcagcctggcctgttgccgtagaatcg CRISPR spacer
cgatcgcagcctgggctgttgccgtgctcgcc Protospacer
**.*********** **********. *
16. spacer 1.11|941065|32|CP033090|CRISPRCasFinder matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 9, identity: 0.719
aggatttcgccgcgctgttggcctccagattc CRISPR spacer
cagggtcgaccgcgctgtcgccctccagattc Protospacer
.*. *. .*********.* ***********
17. spacer 1.14|941248|32|CP033090|CRISPRCasFinder matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719
ctgccggtctgtgctgttgtcgtcaataatca CRISPR spacer
tttggtgtctgtgccgttttcgtcaataagct Protospacer
.* ********.*** ********** *
18. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP048340 (Escherichia coli strain 142 plasmid p142_C, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
19. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_LR130559 (Escherichia coli strain MS14385 isolate MS14385 plasmid 5) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
20. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP020518 (Escherichia coli strain 222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
21. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP020497 (Escherichia coli strain 103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
22. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP040921 (Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
23. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to CP053252 (Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
24. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP042622 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
25. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_LT985302 (Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
26. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP028194 (Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
27. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP024865 (Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
28. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to AP019710 (Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
29. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP024829 (Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
30. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP009861 (Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
31. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to CP025877 (Escherichia coli strain 503458 plasmid p503458_49, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
32. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP023368 (Escherichia coli strain 1428 plasmid p48, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
33. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP032259 (Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
34. spacer 1.16|941370|32|CP033090|CRISPRCasFinder matches to NZ_CP037450 (Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aatttaggggccggaactccgggaaaggcagc CRISPR spacer
tgagaaggggccggaactccggtaaagggcac Protospacer
. ***************** ***** .*
35. spacer 1.17|941431|33|CP033090|CRISPRCasFinder matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
caaacaccaagctcttccgccgcgcgttcctga CRISPR spacer
gaaacaccaaggtcttccgccgcacgggcaaag Protospacer
********** ***********.** * ..
36. spacer 2.3|958039|32|CP033090|CRISPRCasFinder,CRT matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719
aatatatggcgctcacgcgcatgagcattctc CRISPR spacer
acgcaatggcgctgacgcgcatgatcatttcg Protospacer
* ******** ********** ****..
37. spacer 2.7|958283|32|CP033090|CRISPRCasFinder,CRT matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719
gattgctcagattgggaatttgaccagcggcc CRISPR spacer
agtcgctcagattgggaatttgtcaagatgta Protospacer
..*.****************** * ** *.
38. spacer 2.7|958283|32|CP033090|CRISPRCasFinder,CRT matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719
gattgctcagattgggaatttgaccagcggcc CRISPR spacer
agtcgctcagattgggaatttgtcaagatgta Protospacer
..*.****************** * ** *.
39. spacer 2.7|958283|32|CP033090|CRISPRCasFinder,CRT matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719
gattgctcagattgggaatttgaccagcggcc CRISPR spacer
agtcgctcagattgggaatttgtcaagatgta Protospacer
..*.****************** * ** *.
40. spacer 2.7|958283|32|CP033090|CRISPRCasFinder,CRT matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719
gattgctcagattgggaatttgaccagcggcc CRISPR spacer
agtcgctcagattgggaatttgtcaagatgta Protospacer
..*.****************** * ** *.
41. spacer 2.9|958405|32|CP033090|CRISPRCasFinder,CRT matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719
gttgggttgcatagatgacacgcttataaata CRISPR spacer
gaattatggcatagatgacatgattataaatt Protospacer
* .* ************.* ********
42. spacer 1.11|941065|32|CP033090|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
aggatttcgccgcgctgttggcctccagattc CRISPR spacer
gggatatcgccgcgctgatggcctatgaccac Protospacer
.**** *********** ****** ... . *
43. spacer 1.18|941493|32|CP033090|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688
ttgctctcattaaaggggtttccatgtttgat CRISPR spacer
gattcgtcattacagtggtttccatgttttag Protospacer
.. ****** ** ************* *
44. spacer 1.7|941429|35|CP033090|PILER-CR,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686
cgcaaacaccaagctcttccgccgcgcgttcctga CRISPR spacer
gagaaacaccaaggtcttccgccgcacgggcaaag Protospacer
. ********** ***********.** * ..
