Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033251 Escherichia coli strain ECCHD184 plasmid pTB211, complete sequence 0 crisprs RT,csa3 0 0 3 0
CP033252 Escherichia coli strain ECCHD184 plasmid pTB212, complete sequence 0 crisprs DEDDh 0 0 1 0
CP033250 Escherichia coli strain ECCHD184 chromosome, complete genome 10 crisprs csa3,PD-DExK,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,DEDDh,c2c9_V-U4,DinG,WYL 0 22 8 0

Results visualization

1. CP033251
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 200 : 66723 57 Escherichia_phage(41.94%) transposase,plate,integrase attL 55614:55630|attR 65967:65983
DBSCAN-SWA_2 70407 : 133933 54 Escherichia_phage(60.0%) transposase NA
DBSCAN-SWA_3 156911 : 163927 10 Salmonella_phage(50.0%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033252
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 159 : 109834 120 Salmonella_phage(90.1%) capsid,terminase,tail,integrase attL 11136:11150|attR 18960:18974

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP033250
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_1 1000642-1001097 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_2 1019329-1020150 TypeI-E I-E
13 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_3 1022568-1022778 TypeI-E I-E
3 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_4 1032978-1033190 TypeI-E I-E
3 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_5 1528709-1528826 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_6 3245382-3245526 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_7 3484492-3484588 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_8 4021275-4021408 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_9 4028845-4028986 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033250_10 4195581-4195730 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 214175-214207 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 106322-106354 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 161774-161806 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 16973-17005 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 207341-207373 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 162095-162127 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 161893-161925 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 104022-104054 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 163438-163470 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 161882-161914 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 162205-162237 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 162150-162182 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 28757-28789 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 161893-161925 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 160603-160635 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 161658-161690 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 161985-162017 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 161893-161925 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 161719-161751 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 162095-162127 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 161621-161653 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 159407-159439 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 153737-153769 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 161726-161758 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 161510-161542 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 95719-95751 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 170646-170678 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NC_002305 Salmonella typhi plasmid R27, complete sequence 140600-140632 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 57295-57327 0 1.0
CP033250_1 1.1|1000670|33|CP033250|PILER-CR 1000670-1000702 33 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 151002-151034 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 214175-214206 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 106322-106353 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 161774-161805 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 16973-17004 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 95720-95751 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 170647-170678 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 140601-140632 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 207341-207372 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 162095-162126 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 161893-161924 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 57296-57327 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 104022-104053 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 163438-163469 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 161882-161913 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 162205-162236 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 162150-162181 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 28757-28788 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 161893-161924 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 160603-160634 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 161658-161689 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 161985-162016 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 161893-161924 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 161719-161750 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 162095-162126 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 161621-161652 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 159407-159438 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 153737-153768 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 151003-151034 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 161726-161757 0 1.0
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 161510-161541 0 1.0
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP027448 Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence 44630-44660 0 1.0
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 CP043735 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence 40068-40098 0 1.0
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP047660 Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence 58891-58921 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11865 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36550 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9536 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65564 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64195 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119314 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85129 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42146 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87267 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70530 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63027 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 MH422554 Escherichia phage P1, complete genome 87194-87224 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NC_050152 Enterobacteria phage P7, complete genome 93995-94025 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58675 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 MH445381 Escherichia virus P1, complete genome 56870-56900 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42148-42178 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1558-1588 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94757-94787 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61917-61947 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20287-20317 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46689-46719 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81854-81884 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47862-47892 0 1.0
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NC_031129 Salmonella phage SJ46, complete genome 77364-77394 0 1.0
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP027448 Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence 44629-44660 0 1.0
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 CP043735 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence 40067-40098 0 1.0
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP047660 Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence 58891-58922 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
CP033250_8 8.1|4021293|41|CP033250|PILER-CR 4021293-4021333 41 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141125 0 1.0
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 143045-143075 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 66436-66466 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 108046-108076 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 288-318 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 67717-67747 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 57688-57718 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP025683 Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence 65861-65891 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP050841 Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence 71931-71961 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 98748-98778 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 66168-66198 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP012994 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence 2476-2506 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP041645 Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence 49059-49089 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 132702-132732 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 87153-87183 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 33752-33782 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 25730-25760 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP019890 Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence 122841-122871 2 0.935
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 102403-102433 2 0.935
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17470 2 0.935
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122340 2 0.935
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6059 2 0.935
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131432 2 0.935
CP033250_4 4.3|1033130|31|CP033250|PILER-CR,CRT 1033130-1033160 31 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15122-15152 2 0.935
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 143044-143075 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP050841 Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence 71931-71962 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 66435-66466 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 98748-98779 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 66168-66199 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP012994 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence 2476-2507 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP041645 Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence 49059-49090 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 132702-132733 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 108045-108076 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 87153-87184 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 287-318 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 33752-33783 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 67716-67747 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 25730-25761 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 57687-57718 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP019890 Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence 122841-122872 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 102403-102434 2 0.938
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP025683 Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence 65860-65891 2 0.938
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
CP033250_4 4.6|1033129|32|CP033250|CRISPRCasFinder 1033129-1033160 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
CP033250_1 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT 1000793-1000824 32 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3605 3 0.906
CP033250_1 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT 1000793-1000824 32 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3598 3 0.906
CP033250_1 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT 1000793-1000824 32 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21074 3 0.906
CP033250_8 8.2|4021352|39|CP033250|PILER-CR 4021352-4021390 39 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141066 3 0.923
CP033250_1 1.3|1000792|33|CP033250|PILER-CR 1000792-1000824 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
CP033250_1 1.3|1000792|33|CP033250|PILER-CR 1000792-1000824 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
CP033250_1 1.3|1000792|33|CP033250|PILER-CR 1000792-1000824 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
CP033250_1 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT 1000793-1000824 32 KY653119 Morganella phage IME1369_02, complete genome 18217-18248 5 0.844
CP033250_1 1.3|1000792|33|CP033250|PILER-CR 1000792-1000824 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24789-24826 6 0.842
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24902-24939 6 0.842
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4073-4110 6 0.842
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4072-4109 6 0.842
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4072-4109 6 0.842
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4072-4109 6 0.842
CP033250_1 1.11|1000854|32|CP033250|CRISPRCasFinder,CRT 1000854-1000885 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755173-755204 7 0.781
CP033250_2 2.5|1019602|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019602-1019633 32 NZ_AP017919 Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ5 DNA, complete sequence, phylotype ProJPt-1 5714-5745 7 0.781
CP033250_2 2.10|1019907|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019907-1019938 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1331538-1331569 7 0.781
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 372200-372231 7 0.781
CP033250_1 1.4|1000853|33|CP033250|PILER-CR 1000853-1000885 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
CP033250_1 1.11|1000854|32|CP033250|CRISPRCasFinder,CRT 1000854-1000885 32 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191951 8 0.75
CP033250_1 1.14|1001037|32|CP033250|CRISPRCasFinder,CRT 1001037-1001068 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP033250_2 2.5|1019602|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019602-1019633 32 MH745368 Escherichia phage fp01, complete genome 18433-18464 8 0.75
CP033250_2 2.10|1019907|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019907-1019938 32 NC_003091 Fusobacterium nucleatum plasmid pKH9, complete sequence 3246-3277 8 0.75
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3331-3368 8 0.789
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3330-3367 8 0.789
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3330-3367 8 0.789
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3330-3367 8 0.789
CP033250_1 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT 1000671-1000702 32 MN693476 Marine virus AFVG_25M323, complete genome 15107-15138 9 0.719
CP033250_1 1.9|1000732|32|CP033250|CRISPRCasFinder,CRT 1000732-1000763 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 246573-246604 9 0.719
CP033250_2 2.3|1019480|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019480-1019511 32 NZ_CP041206 Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence 474256-474287 9 0.719
CP033250_2 2.5|1019602|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019602-1019633 32 NZ_CP028885 Borrelia turcica IST7 plasmid lp129, complete sequence 72920-72951 9 0.719
CP033250_2 2.6|1019663|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019663-1019694 32 NZ_CP012501 Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence 222560-222591 9 0.719
CP033250_2 2.6|1019663|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019663-1019694 32 NZ_CP042297 Escherichia coli strain RM9088 plasmid p2RM9088, complete sequence 60002-60033 9 0.719
CP033250_2 2.13|1020090|32|CP033250|CRT 1020090-1020121 32 MN693721 Marine virus AFVG_250M181, complete genome 13812-13843 9 0.719
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1404899-1404929 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1367024-1367054 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1471122-1471152 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 969812-969842 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1091516-1091546 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 631548-631578 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 683918-683948 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1523230-1523260 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1299621-1299651 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1404906-1404936 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 336675-336705 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 335612-335642 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1573137-1573167 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 331703-331733 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 330856-330886 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 949767-949797 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 677508-677538 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 581426-581456 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 212989-213019 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1119650-1119680 9 0.71
CP033250_4 4.2|1033069|31|CP033250|PILER-CR,CRT 1033069-1033099 31 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 335137-335167 9 0.71
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14114-14151 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51843-51880 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229388-229425 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239882-239919 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230794-230831 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211764-211801 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40383-40420 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313601-313638 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386517-386554 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397090-397127 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404135-404172 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 114998-115035 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40307-40344 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 103-140 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31308-31345 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 8897-8934 9 0.763
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 17901-17938 9 0.763
CP033250_1 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT 1000793-1000824 32 MF158039 Shigella phage Sf12, complete genome 4975-5006 10 0.688
CP033250_1 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT 1000793-1000824 32 MF158042 Shigella phage Sd1, complete genome 938-969 10 0.688
CP033250_2 2.1|1019358|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019358-1019389 32 NZ_LR215005 Mycoplasma conjunctivae strain NCTC10147 plasmid 9 87506-87537 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 JB137888 Sequence 7 from Patent WO2012159774 23018-23049 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 KJ094025 Listeria phage LP-032 contig 2, partial genome 11870-11901 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 MN114083 Listeria phage LP-013, complete genome 25654-25685 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 MN128593 Listeria phage LP-031, complete genome 25617-25648 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 NC_021787 Listeria phage LP-037, complete genome 48031-48062 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 MN904502 Listeria phage LP-018, complete genome 25117-25148 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 JX442241 Listeria phage P70, complete genome 31182-31213 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 KJ094020 Listeria phage LP-026, complete genome 8121-8152 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 KJ094021 Listeria phage LP-114, complete genome 14545-14576 10 0.688
CP033250_2 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT 1019968-1019999 32 MN114082 Listeria phage LP-010, complete genome 25655-25686 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 336675-336706 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1404898-1404929 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1367023-1367054 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 335612-335643 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1471121-1471152 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1573137-1573168 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 331703-331734 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 330856-330887 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 969811-969842 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 949767-949798 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 677508-677539 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 581426-581457 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1091515-1091546 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 212989-213020 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 631547-631578 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1119650-1119681 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 683917-683948 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 335137-335168 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1523229-1523260 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1299620-1299651 10 0.688
CP033250_4 4.5|1033068|32|CP033250|CRISPRCasFinder 1033068-1033099 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1404905-1404936 10 0.688
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56040-56077 10 0.737
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 58275-58312 10 0.737
CP033250_9 9.1|4028897|38|CP033250|CRISPRCasFinder 4028897-4028934 38 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30215-30252 10 0.737
CP033250_1 1.3|1000792|33|CP033250|PILER-CR 1000792-1000824 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
CP033250_1 1.3|1000792|33|CP033250|PILER-CR 1000792-1000824 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667

1. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

2. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

3. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

4. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

5. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

6. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

7. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

8. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

9. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

10. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

11. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

12. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

13. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

14. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

15. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

16. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

17. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

18. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

19. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

20. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

21. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

22. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

23. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

24. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

25. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

26. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

27. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

28. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

29. spacer 1.1|1000670|33|CP033250|PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

30. spacer 1.1|1000670|33|CP033250|PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcataaccatcaagccaaatagtccccaacat	CRISPR spacer
gtcataaccatcaagccaaatagtccccaacat	Protospacer
*********************************

31. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

32. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

33. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

34. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

35. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

36. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

37. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

38. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

39. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

40. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

41. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

42. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

43. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

44. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

45. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

46. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

47. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

48. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

49. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

50. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

51. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

52. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

53. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

54. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

55. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

56. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

57. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

58. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

59. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

60. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
tcataaccatcaagccaaatagtccccaacat	Protospacer
********************************

61. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctccaccgtttggcgaatcggtgtgaggg	Protospacer
*******************************

62. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to CP043735 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctccaccgtttggcgaatcggtgtgaggg	Protospacer
*******************************

63. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP047660 (Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence) position: , mismatch: 0, identity: 1.0 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctccaccgtttggcgaatcggtgtgaggg	Protospacer
*******************************

64. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

65. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

66. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

67. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

68. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

69. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

70. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

71. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

72. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

73. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

74. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

75. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

76. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

77. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

78. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

79. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

80. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

81. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

82. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

83. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

84. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

85. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

86. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

87. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctgaaccgacattcatgt	Protospacer
*******************************

88. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctccaccgtttggcgaatcggtgtgaggg	Protospacer
********************************

89. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to CP043735 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-2, complete sequence) position: , mismatch: 0, identity: 1.0 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctccaccgtttggcgaatcggtgtgaggg	Protospacer
********************************

90. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP047660 (Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence) position: , mismatch: 0, identity: 1.0 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctccaccgtttggcgaatcggtgtgaggg	Protospacer
********************************

91. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

92. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

93. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

94. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

95. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

96. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

97. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

98. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

99. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

100. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

101. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

102. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

103. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

104. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

105. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

106. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

107. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

108. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

109. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

110. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

111. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

112. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

113. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

114. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

115. spacer 8.1|4021293|41|CP033250|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
gtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
*****************************************

116. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

117. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

118. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

119. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

120. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

121. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

122. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

123. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

124. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

125. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

126. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP012994 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

127. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

128. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

129. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

130. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

131. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

132. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP019890 (Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

133. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.935 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
ttctctaccgtttggcgaatcggtgtgagag	Protospacer
*****.***********************.*

134. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.935 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtgaaaacacgttctgaaccgacattcatgt	Protospacer
**.******** *******************

135. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.935 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtgaaaacacgttctgaaccgacattcatgt	Protospacer
**.******** *******************

136. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.935 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctaaaccgtcattcatgt	Protospacer
***************.***** *********

137. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.935 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacgttatgaaccgacattcatgt	Protospacer
*********** * *****************

138. spacer 4.3|1033130|31|CP033250|PILER-CR,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.935 

gtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
gtaaaaacacggtctaaaccgtcattcatgt	Protospacer
***************.***** *********

139. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

140. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

141. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

142. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

143. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

144. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP012994 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

145. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

146. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

147. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

148. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

149. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

150. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

151. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

152. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

153. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

154. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP019890 (Enterobacter hormaechei strain FRM plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

155. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

156. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 2, identity: 0.938 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
cttctctaccgtttggcgaatcggtgtgagag	Protospacer
******.***********************.*

157. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

158. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

159. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

160. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

161. spacer 4.6|1033129|32|CP033250|CRISPRCasFinder matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt	Protospacer
************ * *****************

162. spacer 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

163. spacer 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 3, identity: 0.906 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

164. spacer 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

165. spacer 8.2|4021352|39|CP033250|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 3, identity: 0.923 

acggcgtagcaaaaagaaattttcaatattgttttatgg	CRISPR spacer
atggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
*.******* *********************.*******

166. spacer 1.3|1000792|33|CP033250|PILER-CR matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

167. spacer 1.3|1000792|33|CP033250|PILER-CR matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

168. spacer 1.3|1000792|33|CP033250|PILER-CR matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

169. spacer 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 5, identity: 0.844 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggttgtgcggcgttaacgctgaccagcatttc	Protospacer
*  * ******.******** ***********

170. spacer 1.3|1000792|33|CP033250|PILER-CR matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
aggttgtgcggcgttaacgctgaccagcatttc	Protospacer
 *  * ******.******** ***********

171. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

172. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

173. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

174. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

175. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

176. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

177. spacer 1.11|1000854|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781 

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
ccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
 *******.**************** *.. *.

178. spacer 2.5|1019602|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017919 (Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ5 DNA, complete sequence, phylotype ProJPt-1) position: , mismatch: 7, identity: 0.781 

agcgaccgaaatacaaatcaaaatcagtataa	CRISPR spacer
tgtaaacaaaatacaaatctaaatcagtacaa	Protospacer
 *..* *.*********** *********.**

179. spacer 2.10|1019907|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.781 

aaaacccagcttgtactgaaaatgata-gacgt	CRISPR spacer
taaacccagcttgtcctgagaatgacgtggcg-	Protospacer
 ************* ****.*****.. *.**

180. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

cctgcgcgtcaaaccattctttc----ggtgataca	CRISPR spacer
cctgcgcctcaacccattctttcatgggatga----	Protospacer
******* **** **********    *.***

181. spacer 1.4|1000853|33|CP033250|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758 

gacgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
  *******.**************** *.. *.

182. spacer 1.11|1000854|32|CP033250|CRISPRCasFinder,CRT matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
atgcggtcatggatgctgatgttgcagtgatg	Protospacer
*.*.********.***** ******** * ..

183. spacer 1.14|1001037|32|CP033250|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75 

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **

184. spacer 2.5|1019602|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to MH745368 (Escherichia phage fp01, complete genome) position: , mismatch: 8, identity: 0.75 

agcgaccgaaatacaaatcaaaatcagtataa	CRISPR spacer
agcgaccgaaatgccaatcaaaatcgacactg	Protospacer
************.* **********...*. .

185. spacer 2.10|1019907|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NC_003091 (Fusobacterium nucleatum plasmid pKH9, complete sequence) position: , mismatch: 8, identity: 0.75 

aaaacccagcttgtactgaaaatgatagacgt	CRISPR spacer
aaaagacagcttgtactgaaaatcagattgct	Protospacer
****  ***************** * *    *

186. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

187. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

188. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

189. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

190. spacer 1.8|1000671|32|CP033250|CRISPRCasFinder,CRT matches to MN693476 (Marine virus AFVG_25M323, complete genome) position: , mismatch: 9, identity: 0.719 

tcataaccatcaagccaaatagtccccaacat	CRISPR spacer
cctttgccatcaagccaagttgtccccaaaca	Protospacer
.* * .************.* ********

191. spacer 1.9|1000732|32|CP033250|CRISPRCasFinder,CRT matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcaaaaaccgggcaatcgcaaaaaggcgtaat	CRISPR spacer
gaaaaaaccgcccaatcgcaaaaagatgacga	Protospacer
* ********  *************..*  .

192. spacer 2.3|1019480|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041206 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence) position: , mismatch: 9, identity: 0.719 

aatgcatcagttgaacacaaaagtagcttttc	CRISPR spacer
aatccatcagtcgaacacaaaaggtcggattg	Protospacer
*** *******.***********      **

193. spacer 2.5|1019602|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028885 (Borrelia turcica IST7 plasmid lp129, complete sequence) position: , mismatch: 9, identity: 0.719 

agcgaccgaaatacaaatcaaaatcagtataa	CRISPR spacer
aaatttgacaatacaaattaaaatcagtataa	Protospacer
*.   . . *********.*************

194. spacer 2.6|1019663|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012501 (Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence) position: , mismatch: 9, identity: 0.719 

attcccccataattccccgcacaaaaaacagg	CRISPR spacer
tccatcccataattgcccccacaaaaaacaca	Protospacer
 .. .********* *** *********** .

195. spacer 2.6|1019663|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042297 (Escherichia coli strain RM9088 plasmid p2RM9088, complete sequence) position: , mismatch: 9, identity: 0.719 

attcccccataattccccgcacaaaaaacagg	CRISPR spacer
tccatcccataattgcccccacaaaaaacaca	Protospacer
 .. .********* *** *********** .

196. spacer 2.13|1020090|32|CP033250|CRT matches to MN693721 (Marine virus AFVG_250M181, complete genome) position: , mismatch: 9, identity: 0.719 

gagtcgacgtttatcaatatcagttgcaccgg	CRISPR spacer
ttctctccgtttagcaatatcagttccaccca	Protospacer
   **  ****** *********** **** .

197. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

198. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

199. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

200. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

201. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

202. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

203. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

204. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

205. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

206. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

207. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

208. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

209. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

210. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

211. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

212. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

213. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

214. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

215. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

216. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

217. spacer 4.2|1033069|31|CP033250|PILER-CR,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71 

ttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
atctccaccgtttcgggaatcggttgcccga	Protospacer
 ************ * ********     *.

218. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tgattgccggatgcggcgtaaacgccttatccggccta	Protospacer
*...**.**********.**************..**..

219. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ctggtgccggatgcggcgtaaacgccttatccggccta	Protospacer
. * **.**********.**************..**..

220. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

221. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

222. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

223. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

224. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

225. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aaaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
 *. **.**********.**************..**..

226. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caagtgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

227. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caattgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*..**.**********.**************..**..

228. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttcttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

229. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
. .***.**********.**************. **..

230. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttatgccggatgcggcgtaaacgccttatccggccta	Protospacer
*   **.**********.**************..**..

231. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
atgttgccggatgcggcgtaaacgccttatccggccta	Protospacer
  *.**.**********.**************..**..

232. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

233. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cggttgccggatgcggcgtaaacgccttatccggccta	Protospacer
..*.**.**********.**************..**..

234. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
gacttgccggatgcggcgtaaacgccttatccggccac	Protospacer
 * .**.**********.**************..**

235. spacer 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 10, identity: 0.688 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctccccaagtgccg	Protospacer
 *******.************ ***.   ..

236. spacer 1.10|1000793|32|CP033250|CRISPRCasFinder,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 10, identity: 0.688 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctctccaagtgccg	Protospacer
 *******.************ ***.   ..

237. spacer 2.1|1019358|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR215005 (Mycoplasma conjunctivae strain NCTC10147 plasmid 9) position: , mismatch: 10, identity: 0.688 

aaaaaggcgatttttctctttgattacaccgg	CRISPR spacer
ttaaagccgatttttctttttgatttaattta	Protospacer
  **** **********.*******  *.. .

238. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

239. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to KJ094025 (Listeria phage LP-032 contig 2, partial genome) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

240. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

241. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

242. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

243. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

244. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

245. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

246. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

247. spacer 2.11|1019968|32|CP033250|PILER-CR,CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 10, identity: 0.688 

cctgcgcgtcaaaccattctttcggtgataca	CRISPR spacer
acaagcaatcaaatcattctttcggtcatacc	Protospacer
 * .   .*****.************ ****

248. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

249. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

250. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

251. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

252. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

253. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

254. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

255. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

256. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

257. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

258. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

259. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

260. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

261. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

262. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

263. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

264. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

265. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

266. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

267. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

268. spacer 4.5|1033068|32|CP033250|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctccaccgtttggcgaatcggtgtgaggg	CRISPR spacer
aatctccaccgtttcgggaatcggttgcccga	Protospacer
  ************ * ********     *.

269. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccattgccggatgcggcgtaaacgccttatccggccta	Protospacer
. ..**.**********.**************..**..

270. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aggttgccggatgcggcgtaaacgccttatccggcata	Protospacer
 .*.**.**********.**************..* ..

271. spacer 9.1|4028897|38|CP033250|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatctggccta	Protospacer
.*. **.**********.*************...**..

272. spacer 1.3|1000792|33|CP033250|PILER-CR matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg	Protospacer
  *******.************ ***.   ..

273. spacer 1.3|1000792|33|CP033250|PILER-CR matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg	Protospacer
  *******.************ ***.   ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1401119 : 1409361 8 Enterobacteria_phage(62.5%) NA NA
DBSCAN-SWA_2 1676214 : 1685655 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 2158122 : 2206255 57 Escherichia_phage(52.5%) coat,transposase,tRNA,tail,lysis,terminase NA
DBSCAN-SWA_4 2236569 : 2307654 56 Escherichia_phage(23.08%) transposase,protease NA
DBSCAN-SWA_5 2381524 : 2490785 104 Enterobacteria_phage(43.14%) integrase,transposase,tail,protease,lysis,terminase attL 2441358:2441373|attR 2478590:2478605
DBSCAN-SWA_6 3032991 : 3125935 95 Salmonella_phage(57.63%) plate,head,integrase,capsid,portal,tRNA,tail,protease,lysis attL 3025954:3025969|attR 3128880:3128895
DBSCAN-SWA_7 3209090 : 3243898 44 Enterobacteria_phage(57.14%) head,integrase,capsid,portal,tail,lysis,terminase attL 3215237:3215253|attR 3251937:3251953
DBSCAN-SWA_8 3738419 : 3812051 88 Shigella_phage(44.26%) plate,head,integrase,capsid,portal,holin,tail,protease,lysis,terminase attL 3738199:3738254|attR 3808140:3808195

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage