Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033398 Escherichia coli strain WCHEC020031 plasmid p2_020031, complete sequence 0 crisprs NA 0 0 0 0
CP033401 Escherichia coli strain WCHEC020031 chromosome, complete genome 9 crisprs DEDDh,c2c9_V-U4,DinG,cas3,RT,csa3,PD-DExK,cas5,cas6e,cas1,cas2 0 19 9 0
CP033397 Escherichia coli strain WCHEC020031 plasmid p1_020031, complete sequence 0 crisprs NA 0 0 0 0
CP033400 Escherichia coli strain WCHEC020031 plasmid pOXA1_020031, complete sequence 0 crisprs NA 0 0 2 0
CP033399 Escherichia coli strain WCHEC020031 plasmid pNDM5_020031, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP033400
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13932 : 53228 38 Escherichia_phage(53.33%) protease,integrase,transposase attL 9584:9643|attR 27116:27675
DBSCAN-SWA_2 83090 : 90520 7 Escherichia_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033401
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033401_1 371135-371252 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033401_2 976017-976140 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033401_4 1986833-1986977 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033401_5 2497646-2497799 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033401_6 2711093-2711225 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033401_7 4174124-4174263 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033401_8 4218662-4218779 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033401_9 4592112-4592567 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033401_10 4614952-4615530 Unclear I-E
9 spacers
cas2,cas1,cas6e,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033401_3 3.1|1680692|40|CP033401|CRISPRCasFinder 1680692-1680731 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP033401_6 6.1|2711110|42|CP033401|PILER-CR 2711110-2711151 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP033401_6 6.2|2711169|40|CP033401|PILER-CR 2711169-2711208 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
CP033401_2 2.1|976060|38|CP033401|CRISPRCasFinder 976060-976097 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP033401_5 5.1|2497699|48|CP033401|CRISPRCasFinder 2497699-2497746 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
CP033401_5 5.1|2497699|48|CP033401|CRISPRCasFinder 2497699-2497746 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
CP033401_5 5.1|2497699|48|CP033401|CRISPRCasFinder 2497699-2497746 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
CP033401_5 5.1|2497699|48|CP033401|CRISPRCasFinder 2497699-2497746 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
CP033401_7 7.1|4174173|42|CP033401|CRISPRCasFinder 4174173-4174214 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
CP033401_9 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592446-4592477 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
CP033401_10 10.1|4614982|31|CP033401|CRISPRCasFinder 4614982-4615012 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62712 7 0.774
CP033401_10 10.1|4614982|31|CP033401|CRISPRCasFinder 4614982-4615012 31 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222136 7 0.774
CP033401_10 10.1|4614982|31|CP033401|CRISPRCasFinder 4614982-4615012 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467672-2467702 7 0.774
CP033401_10 10.4|4615165|31|CP033401|CRISPRCasFinder 4615165-4615195 31 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18007 7 0.774
CP033401_10 10.7|4615348|31|CP033401|CRISPRCasFinder 4615348-4615378 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530641-530671 7 0.774
CP033401_7 7.1|4174173|42|CP033401|CRISPRCasFinder 4174173-4174214 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
CP033401_9 9.5|4592385|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592385-4592416 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
CP033401_10 10.4|4615165|31|CP033401|CRISPRCasFinder 4615165-4615195 31 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97498-97528 8 0.742
CP033401_10 10.7|4615348|31|CP033401|CRISPRCasFinder 4615348-4615378 31 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14983 8 0.742
CP033401_10 10.7|4615348|31|CP033401|CRISPRCasFinder 4615348-4615378 31 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15013 8 0.742
CP033401_10 10.7|4615348|31|CP033401|CRISPRCasFinder 4615348-4615378 31 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3484 8 0.742
CP033401_10 10.7|4615348|31|CP033401|CRISPRCasFinder 4615348-4615378 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148992-149022 8 0.742
CP033401_10 10.10|4614982|32|CP033401|PILER-CR,CRT 4614982-4615013 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62713 8 0.75
CP033401_10 10.10|4614982|32|CP033401|PILER-CR,CRT 4614982-4615013 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222137 8 0.75
CP033401_10 10.10|4614982|32|CP033401|PILER-CR,CRT 4614982-4615013 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467671-2467702 8 0.75
CP033401_10 10.10|4614982|32|CP033401|PILER-CR,CRT 4614982-4615013 32 NC_008759 Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence 12670-12701 8 0.75
CP033401_10 10.13|4615165|32|CP033401|PILER-CR,CRT 4615165-4615196 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18008 8 0.75
CP033401_10 10.13|4615165|32|CP033401|PILER-CR,CRT 4615165-4615196 32 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97497-97528 8 0.75
CP033401_10 10.16|4615348|32|CP033401|PILER-CR,CRT 4615348-4615379 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148991-149022 8 0.75
CP033401_10 10.16|4615348|32|CP033401|PILER-CR,CRT 4615348-4615379 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530640-530671 8 0.75
CP033401_10 10.17|4615409|32|CP033401|PILER-CR,CRT 4615409-4615440 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
CP033401_7 7.1|4174173|42|CP033401|CRISPRCasFinder 4174173-4174214 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
CP033401_10 10.1|4614982|31|CP033401|CRISPRCasFinder 4614982-4615012 31 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86182-86212 9 0.71
CP033401_10 10.2|4615043|31|CP033401|CRISPRCasFinder 4615043-4615073 31 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244716 9 0.71
CP033401_10 10.2|4615043|31|CP033401|CRISPRCasFinder 4615043-4615073 31 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78566 9 0.71
CP033401_10 10.4|4615165|31|CP033401|CRISPRCasFinder 4615165-4615195 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405905 9 0.71
CP033401_10 10.4|4615165|31|CP033401|CRISPRCasFinder 4615165-4615195 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248363-2248393 9 0.71
CP033401_10 10.8|4615409|31|CP033401|CRISPRCasFinder 4615409-4615439 31 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35770 9 0.71
CP033401_10 10.13|4615165|32|CP033401|PILER-CR,CRT 4615165-4615196 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405906 9 0.719
CP033401_10 10.16|4615348|32|CP033401|PILER-CR,CRT 4615348-4615379 32 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14984 9 0.719
CP033401_10 10.16|4615348|32|CP033401|PILER-CR,CRT 4615348-4615379 32 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15014 9 0.719
CP033401_10 10.16|4615348|32|CP033401|PILER-CR,CRT 4615348-4615379 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3485 9 0.719
CP033401_10 10.17|4615409|32|CP033401|PILER-CR,CRT 4615409-4615440 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
CP033401_9 9.1|4592141|32|CP033401|PILER-CR,CRISPRCasFinder,CRT 4592141-4592172 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
CP033401_10 10.10|4614982|32|CP033401|PILER-CR,CRT 4614982-4615013 32 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86181-86212 10 0.688
CP033401_10 10.11|4615043|32|CP033401|PILER-CR,CRT 4615043-4615074 32 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244717 10 0.688
CP033401_10 10.11|4615043|32|CP033401|PILER-CR,CRT 4615043-4615074 32 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78567 10 0.688
CP033401_10 10.13|4615165|32|CP033401|PILER-CR,CRT 4615165-4615196 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248362-2248393 10 0.688

1. spacer 3.1|1680692|40|CP033401|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 6.1|2711110|42|CP033401|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 6.2|2711169|40|CP033401|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

catggcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *****************************

4. spacer 2.1|976060|38|CP033401|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 5.1|2497699|48|CP033401|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

6. spacer 5.1|2497699|48|CP033401|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

7. spacer 5.1|2497699|48|CP033401|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

8. spacer 5.1|2497699|48|CP033401|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

9. spacer 7.1|4174173|42|CP033401|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
acaaatgccggatgcggcgtaaacgccttatctggcctacgc	Protospacer
***.  *.****************.*********.******.

10. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

11. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

12. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

13. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

14. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

15. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

16. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

17. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

18. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

19. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

20. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

21. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

22. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

23. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

24. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

25. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

26. spacer 9.6|4592446|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

27. spacer 10.1|4614982|31|CP033401|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
tccctatcgcaatgccggcagcatccgcaat	Protospacer
*. *.  ****** **** ************

28. spacer 10.1|4614982|31|CP033401|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatc	Protospacer
**** ************ ***** *  ** .

29. spacer 10.1|4614982|31|CP033401|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatc	Protospacer
**** ************ ***** *  ** .

30. spacer 10.4|4615165|31|CP033401|CRISPRCasFinder matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
agcgtcaccgacgcgcagggccgctaccaac	Protospacer
  **************** * *******.  

31. spacer 10.7|4615348|31|CP033401|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
ccgaacaggtggcgaagcaggtgatgggcca	Protospacer
******.* **************.. ***  

32. spacer 7.1|4174173|42|CP033401|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
attgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
*. *  ******************.*******.*******. 

33. spacer 9.5|4592385|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcaacgcgctcagacgttgcgtgagtgaacca	CRISPR spacer
acaacgcggtcggacgttgcgtgattaccccg	Protospacer
 ******* **.************ *.  **.

34. spacer 10.4|4615165|31|CP033401|CRISPRCasFinder matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacgtcaccgacgcgcagtcgcgcttcttca	Protospacer
  ***************** ***** *. ..

35. spacer 10.7|4615348|31|CP033401|CRISPRCasFinder matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgt	Protospacer
   ..*.******** ********** ****

36. spacer 10.7|4615348|31|CP033401|CRISPRCasFinder matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgt	Protospacer
   ..*.******** ********** ****

37. spacer 10.7|4615348|31|CP033401|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
ttgcgcagctggcgcagcaggtggctgccga	Protospacer
..* .*.******* ************ ** 

38. spacer 10.7|4615348|31|CP033401|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
gggtacggctggcgaaggaggcggctgcgga	Protospacer
  * ************* ***.*****  * 

39. spacer 10.10|4614982|32|CP033401|PILER-CR,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
tccctatcgcaatgccggcagcatccgcaatc	Protospacer
*. *.  ****** **** ************.

40. spacer 10.10|4614982|32|CP033401|PILER-CR,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

41. spacer 10.10|4614982|32|CP033401|PILER-CR,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

42. spacer 10.10|4614982|32|CP033401|PILER-CR,CRT matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcg-----caattccgggagcatccgcaatt	CRISPR spacer
-----cgtgaaactcatttccgggagcatccgcattt	Protospacer
     **.*     ** ***************** **

43. spacer 10.13|4615165|32|CP033401|PILER-CR,CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
agcgtcaccgacgcgcagggccgctaccaact	Protospacer
  **************** * *******.   

44. spacer 10.13|4615165|32|CP033401|PILER-CR,CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcaccgacgcgcagtcgcgcttcttcaa	Protospacer
  ***************** ***** *. ..*

45. spacer 10.16|4615348|32|CP033401|PILER-CR,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
gggtacggctggcgaaggaggcggctgcggaa	Protospacer
  * ************* ***.*****  * *

46. spacer 10.16|4615348|32|CP033401|PILER-CR,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ccgaacaggtggcgaagcaggtgatgggccag	Protospacer
******.* **************.. ***  .

47. spacer 10.17|4615409|32|CP033401|PILER-CR,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
catcatcctcccgcagatgcgctggccgatcc	Protospacer
  *.*.* .******** ******** *****

48. spacer 7.1|4174173|42|CP033401|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
gttgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
.. *  ******************.*******.*******. 

49. spacer 10.1|4614982|31|CP033401|CRISPRCasFinder matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 9, identity: 0.71

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
gctaccgcgcaattcgaggagcatccgctgg	Protospacer
 .  *********** .*********** . 

50. spacer 10.2|4615043|31|CP033401|CRISPRCasFinder matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

acggacaaaatatatattgatttgcgaatta	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaat	Protospacer
  .*.********* ******** ****   

51. spacer 10.2|4615043|31|CP033401|CRISPRCasFinder matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 9, identity: 0.71

acggacaaaatatatattgatttgcgaatta	CRISPR spacer
acggaaaaattatatattgattttacttctg	Protospacer
***** *** *************     .*.

52. spacer 10.4|4615165|31|CP033401|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacgtcactgacgcgcagtcgcgcttcttca	Protospacer
  ******.********** ***** *. ..

53. spacer 10.4|4615165|31|CP033401|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacatcaccgacgcccagtggcgcgacgtcc	Protospacer
  *.********** ********* **  . 

54. spacer 10.8|4615409|31|CP033401|CRISPRCasFinder matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

gtttaccgccccgcagaggcgctggcagatc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcga	Protospacer
    ******.*** *************   

55. spacer 10.13|4615165|32|CP033401|PILER-CR,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcactgacgcgcagtcgcgcttcttcaa	Protospacer
  ******.********** ***** *. ..*

56. spacer 10.16|4615348|32|CP033401|PILER-CR,CRT matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

57. spacer 10.16|4615348|32|CP033401|PILER-CR,CRT matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

58. spacer 10.16|4615348|32|CP033401|PILER-CR,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ttgcgcagctggcgcagcaggtggctgccgag	Protospacer
..* .*.******* ************ ** .

59. spacer 10.17|4615409|32|CP033401|PILER-CR,CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcgac	Protospacer
    ******.*** *************   *

60. spacer 9.1|4592141|32|CP033401|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

tccacgctgtaacggccatcattaagtttagt	CRISPR spacer
ccgctgctgtgacgcccatcattaagttactc	Protospacer
.*  .*****.*** *************   .

61. spacer 10.10|4614982|32|CP033401|PILER-CR,CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 10, identity: 0.688

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
gctaccgcgcaattcgaggagcatccgctggg	Protospacer
 .  *********** .*********** .  

62. spacer 10.11|4615043|32|CP033401|PILER-CR,CRT matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaata	Protospacer
  .*.********* ******** ****    

63. spacer 10.11|4615043|32|CP033401|PILER-CR,CRT matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
acggaaaaattatatattgattttacttctgg	Protospacer
***** *** *************     .*. 

64. spacer 10.13|4615165|32|CP033401|PILER-CR,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacatcaccgacgcccagtggcgcgacgtccc	Protospacer
  *.********** ********* **  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 499447 : 508889 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_2 1470551 : 1481329 11 Enterobacteria_phage(40.0%) integrase attL 1468524:1468547|attR 1480032:1480055
DBSCAN-SWA_3 1610136 : 1654789 38 Stx2-converting_phage(33.33%) transposase NA
DBSCAN-SWA_4 1868468 : 1878562 13 Salmonella_phage(90.0%) transposase,integrase attL 1868138:1868151|attR 1878604:1878617
DBSCAN-SWA_5 1958145 : 1985349 48 Enterobacteria_phage(47.06%) lysis,tail,integrase,capsid,terminase attL 1960061:1960075|attR 1985423:1985437
DBSCAN-SWA_6 2472839 : 2488527 17 Shigella_phage(33.33%) tail,integrase attL 2469943:2470002|attR 2484612:2484671
DBSCAN-SWA_7 2874406 : 2880965 7 uncultured_Caudovirales_phage(16.67%) transposase NA
DBSCAN-SWA_8 3297668 : 3316187 22 Escherichia_virus(30.0%) tail,lysis,integrase attL 3297511:3297557|attR 3313399:3313445
DBSCAN-SWA_9 4622955 : 4636138 12 Escherichia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage