Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP023865 Actinoplanes teichomyceticus ATCC 31121 chromosome, complete genome 45 crisprs NA 11 120 0 0

Results visualization

1. CP023865
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_1 71719-71814 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_2 229314-229550 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_3 596412-596653 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_4 819122-819181 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_5 947724-947811 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_6 1112222-1112360 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_7 1118974-1119051 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_8 1408540-1408620 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_9 1545730-1545895 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_10 1867839-1868031 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_12 2327777-2327880 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_11 2327156-2327433 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_13 2393863-2394077 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_14 2789883-2789972 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_15 2878657-2878835 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_16 2900337-2900408 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_17 3018704-3018768 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_18 3357345-3357458 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_19 3704226-3704314 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_20 3825916-3826012 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_21 4229582-4229693 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_22 4232770-4232858 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_23 4761053-4761278 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_24 4773036-4773270 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_25 4810328-4810416 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_26 5023919-5024020 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_27 5231565-5231672 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_28 6064563-6064657 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_29 6106667-6106755 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_30 6197970-6198058 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_31 6295881-6296015 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_32 6368688-6368792 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_33 6446317-6449099 Orphan NA
45 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_34 6458602-6461747 Orphan NA
51 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_35 6555212-6555306 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_36 6639693-6639791 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_37 6773382-6773497 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_38 6917430-6917523 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_39 7023812-7023914 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_40 7207972-7208077 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_41 7382535-7382655 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_42 7408026-7408104 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_43 7685018-7685101 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_44 7693571-7693663 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023865_45 7897133-7897236 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 CP023865.1 71709-71738 0 1.0
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 5040938-5040956 0 1.0
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 5040938-5040956 0 1.0
CP023865_10 10.4|1867993|18|CP023865|CRT 1867993-1868010 18 CP023865.1 1868032-1868049 0 1.0
CP023865_17 17.1|3018729|15|CP023865|CRISPRCasFinder 3018729-3018743 15 CP023865.1 4499684-4499698 0 1.0
CP023865_3 3.1|596435|19|CP023865|CRT 596435-596453 19 CP023865.1 5040938-5040956 1 0.947
CP023865_10 10.2|1867907|18|CP023865|CRT 1867907-1867924 18 CP023865.1 1868032-1868049 1 0.944
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 CP023865.1 4773020-4773044 1 0.96
CP023865_27 27.1|5231589|18|CP023865|CRISPRCasFinder 5231589-5231606 18 CP023865.1 3045945-3045962 1 0.944
CP023865_27 27.1|5231589|18|CP023865|CRISPRCasFinder 5231589-5231606 18 CP023865.1 4444135-4444152 1 0.944
CP023865_33 33.13|6447086|31|CP023865|CRISPRCasFinder 6447086-6447116 31 CP023865.1 5357678-5357708 1 0.968
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 CP023865.1 71686-71715 2 0.933
CP023865_3 3.1|596435|19|CP023865|CRT 596435-596453 19 CP023865.1 6509509-6509527 2 0.895
CP023865_3 3.1|596435|19|CP023865|CRT 596435-596453 19 CP023865.1 6608344-6608362 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 199402-199420 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 484302-484320 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 925572-925590 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 1426251-1426269 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 1533757-1533775 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 1977414-1977432 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 5374530-5374548 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 6172865-6172883 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 6778220-6778238 2 0.895
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 CP023865.1 7980896-7980914 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 199402-199420 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 484302-484320 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 925572-925590 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 1426251-1426269 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 1533757-1533775 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 1977414-1977432 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 5374530-5374548 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 6172865-6172883 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 6778220-6778238 2 0.895
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 CP023865.1 7980896-7980914 2 0.895
CP023865_11 11.5|2327347|22|CP023865|CRT 2327347-2327368 22 CP023865.1 4107408-4107429 2 0.909

1. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to position: 71709-71738, mismatch: 0, identity: 1.0 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
ccggccgccccgcaacccgaggcgccgccg	Protospacer
******************************

2. spacer 3.2|596477|19|CP023865|CRT matches to position: 5040938-5040956, mismatch: 0, identity: 1.0 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggcccggacgtg	Protospacer
*******************

3. spacer 3.3|596519|19|CP023865|CRT matches to position: 5040938-5040956, mismatch: 0, identity: 1.0 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggcccggacgtg	Protospacer
*******************

4. spacer 10.4|1867993|18|CP023865|CRT matches to position: 1868032-1868049, mismatch: 0, identity: 1.0 

tggcggggagcggcgctc	CRISPR spacer
tggcggggagcggcgctc	Protospacer
******************

5. spacer 17.1|3018729|15|CP023865|CRISPRCasFinder matches to position: 4499684-4499698, mismatch: 0, identity: 1.0 

accgccccgggcgct	CRISPR spacer
accgccccgggcgct	Protospacer
***************

6. spacer 3.1|596435|19|CP023865|CRT matches to position: 5040938-5040956, mismatch: 1, identity: 0.947 

cggcctgggtccggacgtg	CRISPR spacer
cggcctgggcccggacgtg	Protospacer
*********.*********

7. spacer 10.2|1867907|18|CP023865|CRT matches to position: 1868032-1868049, mismatch: 1, identity: 0.944 

tggcggggagcggtgctc	CRISPR spacer
tggcggggagcggcgctc	Protospacer
*************.****

8. spacer 24.3|4773205|25|CP023865|CRT matches to position: 4773020-4773044, mismatch: 1, identity: 0.96 

agtcccggcggccccggcccccgcg	CRISPR spacer
agtcccggcggccccgccccccgcg	Protospacer
**************** ********

9. spacer 27.1|5231589|18|CP023865|CRISPRCasFinder matches to position: 3045945-3045962, mismatch: 1, identity: 0.944 

acgggcgggcggcgaccc	CRISPR spacer
acgggcgggcggcgaacc	Protospacer
*************** **

10. spacer 27.1|5231589|18|CP023865|CRISPRCasFinder matches to position: 4444135-4444152, mismatch: 1, identity: 0.944 

acgggcgggcggcgaccc	CRISPR spacer
acgggcgggcggtgaccc	Protospacer
************.*****

11. spacer 33.13|6447086|31|CP023865|CRISPRCasFinder matches to position: 5357678-5357708, mismatch: 1, identity: 0.968 

gaccgcggcccggggttggcgtgtggcattg	CRISPR spacer
gaccgcggcccggggttggcatgtggcattg	Protospacer
********************.**********

12. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to position: 71686-71715, mismatch: 2, identity: 0.933 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
ccggccgccccgcaacccgaggcccggccg	Protospacer
*********************** * ****

13. spacer 3.1|596435|19|CP023865|CRT matches to position: 6509509-6509527, mismatch: 2, identity: 0.895 

cggcctgggtccggacgtg	CRISPR spacer
cggcctgcgtccgaacgtg	Protospacer
******* *****.*****

14. spacer 3.1|596435|19|CP023865|CRT matches to position: 6608344-6608362, mismatch: 2, identity: 0.895 

cggcctgggtccggacgtg	CRISPR spacer
cggcccgggtccgggcgtg	Protospacer
*****.********.****

15. spacer 3.2|596477|19|CP023865|CRT matches to position: 199402-199420, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctggtccgggacgtg	Protospacer
******** ** *******

16. spacer 3.2|596477|19|CP023865|CRT matches to position: 484302-484320, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggcccgaacatg	Protospacer
*************.**.**

17. spacer 3.2|596477|19|CP023865|CRT matches to position: 925572-925590, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcgtgggcgcggacgtg	Protospacer
**** ***** ********

18. spacer 3.2|596477|19|CP023865|CRT matches to position: 1426251-1426269, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcgtggacccggacgtg	Protospacer
**** ***.**********

19. spacer 3.2|596477|19|CP023865|CRT matches to position: 1533757-1533775, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctcggccgggacgtg	Protospacer
****** **** *******

20. spacer 3.2|596477|19|CP023865|CRT matches to position: 1977414-1977432, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggcccggtggtg	Protospacer
**************  ***

21. spacer 3.2|596477|19|CP023865|CRT matches to position: 5374530-5374548, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgcgcccggaggtg	Protospacer
******* ******* ***

22. spacer 3.2|596477|19|CP023865|CRT matches to position: 6172865-6172883, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggccagcacgtg	Protospacer
*********** * *****

23. spacer 3.2|596477|19|CP023865|CRT matches to position: 6778220-6778238, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctggccctggacgtg	Protospacer
******** **.*******

24. spacer 3.2|596477|19|CP023865|CRT matches to position: 7980896-7980914, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggccgggtcgtg	Protospacer
*********** ** ****

25. spacer 3.3|596519|19|CP023865|CRT matches to position: 199402-199420, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctggtccgggacgtg	Protospacer
******** ** *******

26. spacer 3.3|596519|19|CP023865|CRT matches to position: 484302-484320, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggcccgaacatg	Protospacer
*************.**.**

27. spacer 3.3|596519|19|CP023865|CRT matches to position: 925572-925590, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcgtgggcgcggacgtg	Protospacer
**** ***** ********

28. spacer 3.3|596519|19|CP023865|CRT matches to position: 1426251-1426269, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcgtggacccggacgtg	Protospacer
**** ***.**********

29. spacer 3.3|596519|19|CP023865|CRT matches to position: 1533757-1533775, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctcggccgggacgtg	Protospacer
****** **** *******

30. spacer 3.3|596519|19|CP023865|CRT matches to position: 1977414-1977432, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggcccggtggtg	Protospacer
**************  ***

31. spacer 3.3|596519|19|CP023865|CRT matches to position: 5374530-5374548, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgcgcccggaggtg	Protospacer
******* ******* ***

32. spacer 3.3|596519|19|CP023865|CRT matches to position: 6172865-6172883, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggccagcacgtg	Protospacer
*********** * *****

33. spacer 3.3|596519|19|CP023865|CRT matches to position: 6778220-6778238, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctggccctggacgtg	Protospacer
******** **.*******

34. spacer 3.3|596519|19|CP023865|CRT matches to position: 7980896-7980914, mismatch: 2, identity: 0.895 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggccgggtcgtg	Protospacer
*********** ** ****

35. spacer 11.5|2327347|22|CP023865|CRT matches to position: 4107408-4107429, mismatch: 2, identity: 0.909 

cccggcgtggcgccgtgaccgg	CRISPR spacer
cccggcgaggcgccgggaccgg	Protospacer
******* ******* ******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP023865_3 3.2|596477|19|CP023865|CRT 596477-596495 19 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 296868-296886 0 1.0
CP023865_3 3.3|596519|19|CP023865|CRT 596519-596537 19 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 296868-296886 0 1.0
CP023865_11 11.1|2327176|22|CP023865|CRT 2327176-2327197 22 NZ_CP039924 Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence 51062-51083 2 0.909
CP023865_11 11.4|2327305|22|CP023865|CRT 2327305-2327326 22 LN713926 Pseudomonas fluorescens SBW25 plasmid pQBR57, complete sequence 211703-211724 2 0.909
CP023865_11 11.5|2327347|22|CP023865|CRT 2327347-2327368 22 NZ_CP013108 Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence 154383-154404 2 0.909
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4752265-4752289 2 0.92
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 369530-369554 2 0.92
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 MH171094 Streptomyces phage Nabi, complete genome 31769-31800 2 0.938
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 MK433276 Streptomyces phage Asten, complete genome 31247-31278 2 0.938
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 MN096373 Streptomyces phage TuanPN, complete genome 31183-31214 2 0.938
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 MN284899 Streptomyces phage Whatever, complete genome 31258-31289 2 0.938
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 KX507343 Streptomyces phage Lorelei, complete genome 31769-31800 2 0.938
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 MN096379 Streptomyces phage Yasdnil, complete genome 31301-31332 2 0.938
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 MH171093 Streptomyces phage Rana, complete genome 31769-31800 2 0.938
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 MG757163 Streptomyces phage OzzyJ, complete genome 31248-31279 2 0.938
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 MH171095 Streptomyces phage Maneekul, complete genome 31273-31304 2 0.938
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP010859 Marinovum algicola DG 898 plasmid pMaD4, complete sequence 137991-138016 2 0.923
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 408937-408962 2 0.923
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 537834-537858 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 278495-278519 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1013360-1013384 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 437108-437132 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 782851-782875 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1015059-1015083 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 205127-205151 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1220715-1220739 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP025615 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence 56187-56211 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 438622-438646 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 796535-796559 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 777207-777231 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 782699-782723 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1416357-1416381 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1067841-1067865 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1622332-1622356 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 782677-782701 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 344978-345002 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 314092-314116 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 314092-314116 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NC_047861 Bordetella phage vB_BbrM_PHB04, complete genome 17944-17968 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 MN694324 Marine virus AFVG_250M884, complete genome 35431-35455 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 919272-919296 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1620881-1620905 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1644914-1644938 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 351197-351221 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1656795-1656819 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1686833-1686857 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 537870-537894 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1862444-1862468 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1337940-1337964 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1405615-1405639 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1644912-1644936 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1617560-1617584 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 229960-229984 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 605018-605042 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1696321-1696345 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1403933-1403957 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 924807-924831 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1628038-1628062 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1655479-1655503 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 921496-921520 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1622856-1622880 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1701049-1701073 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1576265-1576289 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1707801-1707825 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1701016-1701040 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1611576-1611600 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1684822-1684846 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1699810-1699834 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1598602-1598626 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1611888-1611912 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1684822-1684846 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1550491-1550515 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1391180-1391204 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1699846-1699870 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1611576-1611600 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1493691-1493715 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1599248-1599272 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1610779-1610803 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1684822-1684846 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1684822-1684846 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1684822-1684846 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1699846-1699870 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1699835-1699859 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1598624-1598648 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1611875-1611899 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1592522-1592546 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1647517-1647541 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1685558-1685582 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1682137-1682161 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1699835-1699859 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1598624-1598648 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1611887-1611911 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1711764-1711788 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1700836-1700860 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1598624-1598648 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1598624-1598648 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1699846-1699870 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1684825-1684849 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1699857-1699881 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1699658-1699682 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 MN694498 Marine virus AFVG_250M881, complete genome 430-454 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 MN693740 Marine virus AFVG_250M882, complete genome 430-454 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 186268-186292 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP024426 Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence 113144-113168 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP020445 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence 52965-52989 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NC_014035 Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence 63694-63718 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 470563-470587 3 0.88
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 200551-200575 3 0.88
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 34756-34780 3 0.88
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP049160 Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence 247573-247597 3 0.88
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 275077-275101 3 0.88
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP014303 Hymenobacter sp. PAMC 26628 plasmid unnamed, complete sequence 63108-63132 3 0.88
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 32236-32261 3 0.885
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 113299-113324 3 0.885
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 23099-23128 4 0.867
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP013381 Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence 33272-33299 4 0.857
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP009547 Burkholderia sp. 2002721687 plasmid pBTU, complete sequence 84590-84617 4 0.857
CP023865_7 7.1|1119001|24|CP023865|CRISPRCasFinder 1119001-1119024 24 NZ_CP045288 Curtobacterium flaccumfaciens pv. flaccumfaciens strain P990 plasmid pCff1, complete sequence 37183-37206 4 0.833
CP023865_7 7.1|1119001|24|CP023865|CRISPRCasFinder 1119001-1119024 24 CP041260 Curtobacterium flaccumfaciens pv. flaccumfaciens strain Cff1037 plasmid pCFF113, complete sequence 31612-31635 4 0.833
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NC_013531 Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence 20750-20774 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 334643-334667 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 779278-779302 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 79546-79570 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP015811 Microbacterium chocolatum strain SIT 101 plasmid 1, complete sequence 7363-7387 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP015812 Microbacterium chocolatum strain SIT 101 plasmid 2, complete sequence 2284-2308 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 84761-84785 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 370250-370274 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 599221-599245 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NC_031267 Gordonia phage Lucky10, complete genome 9335-9359 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 855050-855074 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 967681-967705 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1214319-1214343 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 237029-237053 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 183508-183532 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1345295-1345319 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP044333 Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence 79100-79124 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP026654 Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence 17187-17211 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 142558-142582 4 0.84
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 MN694036 Marine virus AFVG_250M883, complete genome 431-455 4 0.84
CP023865_16 16.1|2900360|26|CP023865|CRISPRCasFinder 2900360-2900385 26 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 198199-198224 4 0.846
CP023865_16 16.1|2900360|26|CP023865|CRISPRCasFinder 2900360-2900385 26 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 168496-168521 4 0.846
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 149291-149317 4 0.852
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 755196-755222 4 0.852
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1037327-1037351 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 775806-775830 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_DQ996271 Burkholderia glumae BGR1 plasmid pBGF3, complete sequence 1526-1550 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1707530-1707554 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP020041 Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence 77109-77133 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 117589-117613 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NC_010879 Burkholderia glumae strain BGR1 plasmid pBGF2, complete sequence 19489-19513 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP041164 Leisingera aquaemixtae strain R2C4 plasmid unnamed3, complete sequence 44197-44221 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP054602 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed3, complete sequence 20027-20051 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 117277-117301 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 229502-229526 4 0.84
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 MG009575 Mycobacterium phage Kumao, complete genome 17629-17653 4 0.84
CP023865_32 32.1|6368728|25|CP023865|CRISPRCasFinder 6368728-6368752 25 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 7021-7045 4 0.84
CP023865_32 32.1|6368728|25|CP023865|CRISPRCasFinder 6368728-6368752 25 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 393905-393929 4 0.84
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 381108-381139 4 0.875
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP016291 Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence 184503-184534 4 0.875
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP040642 Agrobacterium sp. T29 plasmid unnamed2, complete sequence 232655-232683 4 0.862
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1458081-1458106 4 0.846
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 109066-109091 4 0.846
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 609719-609750 5 0.844
CP023865_10 10.1|1867860|26|CP023865|CRT 1867860-1867885 26 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 408793-408818 5 0.808
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 756261-756285 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 761784-761808 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 2046704-2046728 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1019413-1019437 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 543260-543284 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 419884-419908 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 519047-519071 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1211936-1211960 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 2004427-2004451 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1885217-1885241 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1910070-1910094 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1943015-1943039 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1976843-1976867 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 49361-49385 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1592746-1592770 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1874659-1874683 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 484704-484728 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 847982-848006 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1951323-1951347 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1660956-1660980 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1892626-1892650 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1889768-1889792 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1888652-1888676 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1955850-1955874 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1825563-1825587 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1888835-1888859 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1962791-1962815 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1955817-1955841 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1863608-1863632 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1942318-1942342 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1954560-1954584 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1976851-1976875 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1857825-1857849 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1863920-1863944 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1942318-1942342 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1954659-1954683 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1863608-1863632 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1858474-1858498 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1862811-1862835 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1942318-1942342 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1942318-1942342 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1942318-1942342 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1954655-1954679 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 2014652-2014676 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1954644-1954668 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1857850-1857874 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1868900-1868924 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1849535-1849559 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1912126-1912150 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1940552-1940576 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1939633-1939657 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1954644-1954668 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1857850-1857874 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1863919-1863943 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1903080-1903104 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1955640-1955664 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1857850-1857874 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1857850-1857874 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1954655-1954679 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1942323-1942347 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 2019254-2019278 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1954666-1954690 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1954467-1954491 5 0.8
CP023865_11 11.3|2327260|25|CP023865|CRT 2327260-2327284 25 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 2019254-2019278 5 0.8
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 NZ_CP050100 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence 174826-174850 5 0.8
CP023865_11 11.6|2327389|25|CP023865|CRT 2327389-2327413 25 MN234216 Streptomyces phage Gilgamesh, complete genome 37387-37411 5 0.8
CP023865_19 19.1|3704257|27|CP023865|CRISPRCasFinder 3704257-3704283 27 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 342438-342464 5 0.815
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 455078-455104 5 0.815
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 15645-15671 5 0.815
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 49872-49898 5 0.815
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261819-261845 5 0.815
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 942744-942770 5 0.815
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1458777-1458801 5 0.8
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 36660-36684 5 0.8
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 354490-354514 5 0.8
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 773417-773441 5 0.8
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 561186-561210 5 0.8
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 AB981620 Couchioplanes caeruleus subsp. azureus plasmid pCAZ1 DNA, complete sequence, strain: NBRC 13993 4125-4149 5 0.8
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 375186-375210 5 0.8
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 173728-173752 5 0.8
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 32443-32467 5 0.8
CP023865_24 24.3|4773205|25|CP023865|CRT 4773205-4773229 25 MF766044 Streptomyces phage Amethyst, complete genome 22213-22237 5 0.8
CP023865_33 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR 6447512-6447543 32 NZ_CP009295 Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence 37331-37362 5 0.844
CP023865_33 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR 6447512-6447543 32 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 41449-41480 5 0.844
CP023865_33 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR 6447878-6447910 33 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 168915-168947 5 0.848
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 94763-94794 5 0.844
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 57186-57217 5 0.844
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 MK433272 Gordonia phage IDyn, complete genome 33525-33556 5 0.844
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 MK376954 Gordonia phage WhoseManz, complete genome 33030-33061 5 0.844
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 MH669007 Gordonia phage Marietta, complete genome 33417-33448 5 0.844
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 MN428063 Gordonia phage NadineRae, complete genome 32677-32708 5 0.844
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP021042 Phaeobacter gallaeciensis strain P129 plasmid pP129_b, complete sequence 123517-123548 5 0.844
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP010652 Phaeobacter inhibens strain P54 plasmid pP54_b, complete sequence 77494-77525 5 0.844
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP010699 Phaeobacter inhibens strain P24 plasmid pP24_c, complete sequence 89236-89267 5 0.844
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_LR027556 Epibacterium mobile isolate EPIB1 plasmid 4, complete sequence 52001-52032 5 0.844
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP004395 Celeribacter indicus strain P73 plasmid pP73B, complete sequence 83395-83426 5 0.844
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 89968-89999 5 0.844
CP023865_34 34.49|6461565|32|CP023865|CRISPRCasFinder,CRT 6461565-6461596 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 419146-419177 5 0.844
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 89968-89999 5 0.844
CP023865_34 34.65|6461570|32|CP023865|PILER-CR 6461570-6461601 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 419146-419177 5 0.844
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1186609-1186634 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1141189-1141214 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP015089 Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence 75218-75243 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1519208-1519233 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1141178-1141203 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1141196-1141221 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 352563-352588 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 896384-896409 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP023039 Komagataeibacter saccharivorans strain CV1 plasmid unnamed3, complete sequence 20442-20467 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 CP054934 Nocardiopsis flavescens strain NA01583 plasmid unnamed1, complete sequence 125426-125451 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1185255-1185280 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1068974-1068999 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1026104-1026129 5 0.808
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 263571-263596 5 0.808
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP050118 Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence 106815-106844 6 0.8
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP050122 Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence 51315-51344 6 0.8
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NC_000958 Deinococcus radiodurans R1 plasmid MP1, complete sequence 95017-95046 6 0.8
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP031502 Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence 61872-61901 6 0.8
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 329483-329512 6 0.8
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1216483-1216510 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1564726-1564753 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1315867-1315894 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1134847-1134874 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1564856-1564883 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1315874-1315901 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1194567-1194594 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1133944-1133971 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1168144-1168171 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1168133-1168160 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1134839-1134866 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1134195-1134222 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1134830-1134857 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1242533-1242560 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1189024-1189051 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1216598-1216625 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1216582-1216609 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1216575-1216602 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 653828-653855 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 132231-132258 6 0.786
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 193437-193464 6 0.786
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 464782-464813 6 0.812
CP023865_9 9.2|1545830|32|CP023865|CRISPRCasFinder 1545830-1545861 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1272342-1272373 6 0.812
CP023865_9 9.2|1545830|32|CP023865|CRISPRCasFinder 1545830-1545861 32 MH536819 Gordonia phage Fury, complete genome 8900-8931 6 0.812
CP023865_9 9.2|1545830|32|CP023865|CRISPRCasFinder 1545830-1545861 32 MH576960 Gordonia phage Pleakley, complete genome 8900-8931 6 0.812
CP023865_19 19.1|3704257|27|CP023865|CRISPRCasFinder 3704257-3704283 27 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 180211-180237 6 0.778
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP024907 Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence 161028-161056 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 366405-366433 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 249064-249092 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 271203-271231 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 28738-28766 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 39431-39459 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 63377-63405 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 28669-28697 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 39141-39169 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 28227-28255 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 28664-28692 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 25105-25133 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 567541-567569 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 293952-293980 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 453637-453665 6 0.793
CP023865_23 23.2|4761150|29|CP023865|CRISPRCasFinder 4761150-4761178 29 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 39446-39474 6 0.793
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP035422 Leisingera sp. NJS204 plasmid unnamed5, complete sequence 58974-59000 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP021406 Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence 148729-148755 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP049038 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_1, complete sequence 46124-46150 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP010872 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6003, complete sequence 99559-99585 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP040823 Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence 1920-1946 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP040823 Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence 108060-108086 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 127603-127629 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP010611 Phaeobacter inhibens strain P92 plasmid pP92_a, complete sequence 169156-169182 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP019460 Streptomyces autolyticus strain CGMCC0516 plasmid unnamed3, complete sequence 1148-1174 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP019460 Streptomyces autolyticus strain CGMCC0516 plasmid unnamed3, complete sequence 16604-16630 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP038240 Leisingera sp. NJS201 plasmid unnamed6, complete sequence 26775-26801 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP010716 Phaeobacter piscinae strain P18 plasmid pP18_a, complete sequence 169156-169182 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP010658 Phaeobacter piscinae strain P71 plasmid pP71_b, complete sequence 123408-123434 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP010601 Phaeobacter inhibens strain P83 plasmid pP83_b, complete sequence 115076-115102 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP010770 Phaeobacter piscinae strain P13 plasmid pP13_c, complete sequence 115109-115135 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP010707 Phaeobacter inhibens strain P66 plasmid pP66_b, complete sequence 115076-115102 6 0.778
CP023865_24 24.1|4773077|27|CP023865|CRT 4773077-4773103 27 NZ_CP010662 Phaeobacter inhibens strain P74 plasmid pP74_a, complete sequence 169156-169182 6 0.778
CP023865_28 28.1|6064595|31|CP023865|CRISPRCasFinder 6064595-6064625 31 MH834623 Arthrobacter phage Peas, complete genome 19766-19796 6 0.806
CP023865_28 28.1|6064595|31|CP023865|CRISPRCasFinder 6064595-6064625 31 NC_048094 Arthrobacter phage Eileen, complete genome 19766-19796 6 0.806
CP023865_32 32.1|6368728|25|CP023865|CRISPRCasFinder 6368728-6368752 25 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 4896-4920 6 0.76
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 613470-613501 6 0.812
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NZ_CP045723 Pantoea eucalypti strain LMG 24197 plasmid unnamed3, complete sequence 36865-36896 6 0.812
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NZ_CP016283 Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence 54037-54068 6 0.812
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP006993 Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence 68089-68120 6 0.812
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 KF626665 Phage Sano, complete genome 40521-40553 6 0.818
CP023865_33 33.16|6447268|32|CP023865|CRISPRCasFinder,PILER-CR 6447268-6447299 32 NC_049432 Ralstonia phage RsoM1USA, complete genome 23023-23054 6 0.812
CP023865_33 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR 6447756-6447787 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 98314-98345 6 0.812
CP023865_33 33.27|6447940|32|CP023865|CRISPRCasFinder,PILER-CR 6447940-6447971 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 453844-453875 6 0.812
CP023865_33 33.29|6448062|32|CP023865|CRISPRCasFinder,PILER-CR 6448062-6448093 32 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 323970-324001 6 0.812
CP023865_33 33.29|6448062|32|CP023865|CRISPRCasFinder,PILER-CR 6448062-6448093 32 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 415368-415399 6 0.812
CP023865_33 33.34|6448367|32|CP023865|CRISPRCasFinder,PILER-CR 6448367-6448398 32 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 194330-194361 6 0.812
CP023865_33 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR 6448916-6448947 32 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 23891-23922 6 0.812
CP023865_33 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR 6448916-6448947 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 211593-211624 6 0.812
CP023865_33 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR 6448916-6448947 32 NZ_CP013125 Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence 134771-134802 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 306957-306988 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 684684-684715 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 730365-730396 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 733766-733797 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 732364-732395 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 345210-345241 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1255691-1255722 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1911191-1911222 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 841312-841343 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1293723-1293754 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1378124-1378155 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1098141-1098172 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 803397-803428 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 826539-826570 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 983209-983240 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 558375-558406 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 613491-613522 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1280949-1280980 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 841319-841350 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1153285-1153316 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 719722-719753 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1890405-1890436 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 304601-304632 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 808934-808965 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1133227-1133258 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 635103-635134 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 920299-920330 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1116875-1116906 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 717517-717548 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 808923-808954 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 920266-920297 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 782210-782241 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 826601-826632 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 920267-920298 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1116821-1116852 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 704091-704122 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 782210-782241 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 826601-826632 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 849778-849809 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 605463-605494 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 920280-920311 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 782210-782241 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 813024-813055 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 704119-704150 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 782214-782245 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 826601-826632 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 826601-826632 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 826601-826632 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 920280-920311 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1228990-1229021 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 920269-920300 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 704119-704150 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 736897-736928 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 717593-717624 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 772720-772751 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 808109-808140 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1358559-1358590 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 920269-920300 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 704119-704150 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 782210-782241 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 867394-867425 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 920263-920294 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 704119-704150 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 704119-704150 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 920280-920311 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 826603-826634 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1256677-1256708 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 920291-920322 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 920269-920300 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1256677-1256708 6 0.812
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 138042-138073 6 0.812
CP023865_34 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT 6459365-6459396 32 NZ_LN831788 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence 2844-2875 6 0.812
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 975832-975863 6 0.812
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 NZ_CP005191 Sphingobium sp. MI1205 plasmid pMI2, complete sequence 157037-157068 6 0.812
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NZ_CP022991 Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence 450790-450821 6 0.812
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 97728-97760 6 0.818
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 97728-97760 6 0.818
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 279465-279496 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 361059-361090 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 154336-154367 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 420473-420504 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 152584-152615 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 359093-359124 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 154975-155006 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 121132-121163 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 420473-420504 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 179341-179372 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 152138-152169 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 223749-223780 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 848192-848223 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 1174730-1174761 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 359441-359472 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 445328-445359 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP041157 Leisingera aquaemixtae strain R2C4 plasmid unnamed2, complete sequence 23403-23434 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP015092 Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence 72148-72179 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP015233 Epibacterium mobile F1926 plasmid unnamed3, complete sequence 86368-86399 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP014277 Martelella sp. AD-3 plasmid unnamed2, complete sequence 72184-72215 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP031600 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_02, complete sequence 55257-55288 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP049815 Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence 107342-107373 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP010861 Marinovum algicola DG 898 plasmid pMaD6, complete sequence 91232-91263 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045375 Sulfitobacter sp. THAF37 plasmid pTHAF37_c, complete sequence 26054-26085 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045320 Roseivivax sp. THAF197b plasmid pTHAF197b_b, complete sequence 84531-84562 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 AY369265 Burkholderia cenocepacia phage Bcep1, complete genome 47764-47795 6 0.812
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NC_005263 Burkholderia phage Bcep1, complete genome 47764-47795 6 0.812
CP023865_34 34.37|6460833|30|CP023865|CRISPRCasFinder,CRT 6460833-6460862 30 AJ630128 Bacteriophage S-PM2 complete genome 5831-5860 6 0.8
CP023865_34 34.37|6460833|30|CP023865|CRISPRCasFinder,CRT 6460833-6460862 30 NC_006820 Synechococcus phage S-PM2, complete genome 5831-5860 6 0.8
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 378503-378534 6 0.812
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 507365-507396 6 0.812
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 618925-618956 6 0.812
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 131289-131320 6 0.812
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 378514-378545 6 0.812
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 268749-268780 6 0.812
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 251715-251746 6 0.812
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 99956-99987 6 0.812
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 207970-208001 6 0.812
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 51987-52018 6 0.812
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 MK977705 Gordonia Phage Mollymur, complete genome 71612-71643 6 0.812
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_025041 Sulfobacillus thermotolerans strain L15 plasmid pL15, complete sequence 52976-53007 6 0.812
CP023865_34 34.53|6460838|30|CP023865|PILER-CR 6460838-6460867 30 AJ630128 Bacteriophage S-PM2 complete genome 5831-5860 6 0.8
CP023865_34 34.53|6460838|30|CP023865|PILER-CR 6460838-6460867 30 NC_006820 Synechococcus phage S-PM2, complete genome 5831-5860 6 0.8
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 378503-378534 6 0.812
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 507365-507396 6 0.812
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 618925-618956 6 0.812
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 131289-131320 6 0.812
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 378514-378545 6 0.812
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 268749-268780 6 0.812
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 251715-251746 6 0.812
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 99956-99987 6 0.812
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 207970-208001 6 0.812
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 51987-52018 6 0.812
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 MK977705 Gordonia Phage Mollymur, complete genome 71612-71643 6 0.812
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_025041 Sulfobacillus thermotolerans strain L15 plasmid pL15, complete sequence 52976-53007 6 0.812
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP036456 Streptomonospora sp. M2 plasmid phiM2, complete sequence 43771-43799 6 0.793
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1007358-1007386 6 0.793
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 597753-597781 6 0.793
CP023865_45 45.1|7897172|26|CP023865|CRISPRCasFinder 7897172-7897197 26 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 113840-113865 6 0.769
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 502720-502749 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 1148789-1148818 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1112924-1112953 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 1001448-1001477 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 1148498-1148527 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 1136343-1136372 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 1021763-1021792 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 937864-937893 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1091445-1091474 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 1027699-1027728 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1112924-1112953 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 1021762-1021791 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 1136343-1136372 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 1044805-1044834 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1485895-1485924 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_CP045303 Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence 100864-100893 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 278083-278112 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NC_004688 Mycobacterium phage Omega, complete genome 72836-72865 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 MF133445 Mycobacterium phage Lucky2013, complete genome 68032-68061 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 MF072690 Mycobacterium phage Porcelain, complete genome 68978-69007 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 AY129338 Mycobacterium virus Omega, complete genome 72836-72865 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 JF937101 Mycobacterium virus LittleE, complete genome 71155-71184 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 KM400683 Mycobacterium phage Ariel, complete genome 68313-68342 7 0.767
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 MF668284 Mycobacterium phage Squint, complete genome 69283-69312 7 0.767
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 718160-718192 7 0.788
CP023865_2 2.4|229500|33|CP023865|CRT 229500-229532 33 NZ_CP017565 Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence 356867-356899 7 0.788
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP040763 Paracoccus sp. 2251 plasmid unnamed4, complete sequence 89576-89603 7 0.75
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP035514 Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence 12171-12198 7 0.75
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 KX241618 Xanthomonas phage Xoo-sp2, complete genome 10968-10995 7 0.75
CP023865_3 3.5|596603|28|CP023865|CRT 596603-596630 28 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 123238-123265 7 0.75
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 170670-170701 7 0.781
CP023865_9 9.2|1545830|32|CP023865|CRISPRCasFinder 1545830-1545861 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 265006-265037 7 0.781
CP023865_9 9.2|1545830|32|CP023865|CRISPRCasFinder 1545830-1545861 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 57343-57374 7 0.781
CP023865_15 15.2|2878764|37|CP023865|CRISPRCasFinder 2878764-2878800 37 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 328825-328861 7 0.811
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1582031-1582062 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 182418-182449 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 212471-212502 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 230460-230491 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 307683-307714 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_LR134457 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence 47587-47618 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 268225-268256 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1232050-1232081 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 581483-581514 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP019465 Streptomyces autolyticus strain CGMCC0516 plasmid unnamed8, complete sequence 3962-3993 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 719539-719570 7 0.781
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 266959-266990 7 0.781
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 817907-817938 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1799287-1799318 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1353836-1353867 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1205326-1205357 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 892865-892896 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 843061-843092 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 941567-941598 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1185778-1185809 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1486069-1486100 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 757148-757179 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 917008-917039 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 934019-934050 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1205468-1205499 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 941528-941559 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1108269-1108300 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 962063-962094 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 701655-701686 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1192785-1192816 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 941574-941605 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1261230-1261261 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 831626-831657 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1781260-1781291 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 194421-194452 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 921355-921386 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1240860-1240891 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 640801-640832 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 846601-846632 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 746157-746188 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 845203-845234 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1325159-1325190 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1205043-1205074 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 238263-238294 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 841345-841376 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1144069-1144100 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 921344-921375 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1325126-1325157 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 910923-910954 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 952065-952096 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1323931-1323962 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1204987-1205018 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 934061-934092 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 811716-811747 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 910923-910954 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 952065-952096 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 693621-693652 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1323968-1323999 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 910923-910954 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 811739-811770 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 910927-910958 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 952065-952096 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 952065-952096 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 952065-952096 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1323968-1323999 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1118039-1118070 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1323957-1323988 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 811739-811770 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 848735-848766 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 829426-829457 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 883662-883693 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 922027-922058 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1233095-1233126 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1323957-1323988 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 811739-811770 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 910923-910954 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 986465-986496 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1325124-1325155 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 811739-811770 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 811739-811770 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1323968-1323999 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 952067-952098 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1146884-1146915 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1323979-1324010 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1323957-1323988 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1146884-1146915 7 0.781
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1444887-1444918 7 0.781
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 MN908694 Microbacterium phage RubyRalph, complete genome 23281-23312 7 0.781
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP036351 Planctomycetes bacterium K2D plasmid pK2D_1, complete sequence 66438-66469 7 0.781
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 NZ_CP046575 Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence 65785-65816 7 0.781
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 309301-309333 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NC_007763 Rhizobium etli CFN 42 plasmid p42b, complete sequence 149570-149602 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 125619-125651 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP020907 Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence 148692-148724 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 231439-231471 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NC_021906 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence 147594-147626 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 231439-231471 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 229880-229912 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 234127-234159 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 228245-228277 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 121553-121585 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 231439-231471 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP017565 Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence 226094-226126 7 0.788
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 223343-223375 7 0.788
CP023865_33 33.15|6447207|32|CP023865|CRISPRCasFinder,PILER-CR 6447207-6447238 32 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 161858-161889 7 0.781
CP023865_33 33.17|6447329|32|CP023865|CRISPRCasFinder,PILER-CR 6447329-6447360 32 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 785965-785996 7 0.781
CP023865_33 33.17|6447329|32|CP023865|CRISPRCasFinder,PILER-CR 6447329-6447360 32 NZ_CP032230 Streptomyces seoulensis strain KCTC 9819 plasmid unnamed 32735-32766 7 0.781
CP023865_33 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR 6447512-6447543 32 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 93881-93912 7 0.781
CP023865_33 33.21|6447573|32|CP023865|CRISPRCasFinder,PILER-CR 6447573-6447604 32 NC_031230 Gordonia phage Yvonnetastic, complete genome 12969-13000 7 0.781
CP023865_33 33.23|6447695|32|CP023865|CRISPRCasFinder,PILER-CR 6447695-6447726 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2096227-2096258 7 0.781
CP023865_33 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR 6447878-6447910 33 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 491976-492008 7 0.788
CP023865_33 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR 6447878-6447910 33 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 270740-270772 7 0.788
CP023865_33 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR 6447878-6447910 33 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 691064-691096 7 0.788
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 576511-576542 7 0.781
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 NC_021347 Rhodococcus phage E3, complete genome 13890-13921 7 0.781
CP023865_33 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR 6448428-6448459 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1001282-1001313 7 0.781
CP023865_33 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR 6448916-6448947 32 NZ_CP029177 Acidibrevibacterium fodinaquatile strain G45-3 plasmid unnamed1, complete sequence 14012-14043 7 0.781
CP023865_33 33.44|6448977|33|CP023865|CRISPRCasFinder,PILER-CR 6448977-6449009 33 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 452641-452673 7 0.788
CP023865_33 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR 6449039-6449070 32 NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 93144-93175 7 0.781
CP023865_33 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR 6449039-6449070 32 NC_008538 Arthrobacter sp. FB24 plasmid 2, complete sequence 36448-36479 7 0.781
CP023865_33 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR 6449039-6449070 32 NC_008539 Arthrobacter sp. FB24 plasmid 3, complete sequence 32229-32260 7 0.781
CP023865_33 33.56|6446963|39|CP023865|CRT 6446963-6447001 39 MH171094 Streptomyces phage Nabi, complete genome 31762-31800 7 0.821
CP023865_33 33.56|6446963|39|CP023865|CRT 6446963-6447001 39 MK433276 Streptomyces phage Asten, complete genome 31240-31278 7 0.821
CP023865_33 33.56|6446963|39|CP023865|CRT 6446963-6447001 39 MN096373 Streptomyces phage TuanPN, complete genome 31176-31214 7 0.821
CP023865_33 33.56|6446963|39|CP023865|CRT 6446963-6447001 39 MN284899 Streptomyces phage Whatever, complete genome 31251-31289 7 0.821
CP023865_33 33.56|6446963|39|CP023865|CRT 6446963-6447001 39 KX507343 Streptomyces phage Lorelei, complete genome 31762-31800 7 0.821
CP023865_33 33.56|6446963|39|CP023865|CRT 6446963-6447001 39 MN096379 Streptomyces phage Yasdnil, complete genome 31294-31332 7 0.821
CP023865_33 33.56|6446963|39|CP023865|CRT 6446963-6447001 39 MH171093 Streptomyces phage Rana, complete genome 31762-31800 7 0.821
CP023865_33 33.56|6446963|39|CP023865|CRT 6446963-6447001 39 MG757163 Streptomyces phage OzzyJ, complete genome 31241-31279 7 0.821
CP023865_33 33.56|6446963|39|CP023865|CRT 6446963-6447001 39 MH171095 Streptomyces phage Maneekul, complete genome 31266-31304 7 0.821
CP023865_34 34.1|6458631|32|CP023865|CRISPRCasFinder,CRT 6458631-6458662 32 NC_048733 Microbacterium phage Burro, complete genome 33834-33865 7 0.781
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 55764-55795 7 0.781
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1077220-1077251 7 0.781
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 395674-395705 7 0.781
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP021368 Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence 121410-121441 7 0.781
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP021364 Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence 140484-140515 7 0.781
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 841320-841351 7 0.781
CP023865_34 34.4|6458814|32|CP023865|CRISPRCasFinder,CRT 6458814-6458845 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 184530-184561 7 0.781
CP023865_34 34.4|6458814|32|CP023865|CRISPRCasFinder,CRT 6458814-6458845 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 431878-431909 7 0.781
CP023865_34 34.4|6458814|32|CP023865|CRISPRCasFinder,CRT 6458814-6458845 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 316636-316667 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 576272-576303 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 142290-142321 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 188034-188065 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP021796 Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence 111675-111706 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 465308-465339 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 575940-575971 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MN234205 Mycobacterium phage Veliki, complete genome 43338-43369 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MT188704 Mesorhizobium phage Cp1R7A-A1, complete genome 77120-77151 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MN234198 Mycobacterium phage Zavala, complete genome 43643-43674 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 KX585253 Mycobacterium phage HedwigODU, complete genome 42916-42947 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MF140428 Mycobacterium phage Slimphazie, complete genome 43369-43400 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MG962371 Mycobacterium phage LaterM, complete genome 43765-43796 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 JN185608 Mycobacterium virus JAWS, complete genome 43347-43378 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MN234231 Mycobacterium phage Rapunzel97, complete genome 43369-43400 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MF373841 Mycobacterium phage Hurricane, complete genome 43548-43579 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NC_023747 Mycobacterium phage BarrelRoll, complete genome 43354-43385 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MG962364 Mycobacterium phage Deby, complete genome 43554-43585 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 KR080206 Mycobacterium phage ShedlockHolmes, complete genome 43588-43619 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 KM677211 Mycobacterium phage Murucutumbu, complete genome 44340-44371 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MF668267 Mycobacterium phage Apocalypse, complete genome 43870-43901 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MH051246 Mycobacterium phage ActinUp, complete genome 42916-42947 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MH513977 Mycobacterium phage Mynx, complete genome 43683-43714 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MN234197 Mycobacterium phage Ramen, complete genome 42918-42949 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 495796-495827 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 153138-153169 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 35290-35321 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1313510-1313541 7 0.781
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 818862-818893 7 0.781
CP023865_34 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT 6459121-6459152 32 NZ_CP018727 Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.2, complete sequence 26149-26180 7 0.781
CP023865_34 34.12|6459304|32|CP023865|CRISPRCasFinder,CRT 6459304-6459335 32 NC_013283 Cronobacter turicensis z3032 plasmid pCTU1, complete sequence 51363-51394 7 0.781
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 JQ067089 Pseudomonas phage PaMx28, partial genome 8816-8847 7 0.781
CP023865_34 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT 6459732-6459763 32 NZ_CP049039 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_2, complete sequence 97402-97433 7 0.781
CP023865_34 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT 6459732-6459763 32 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 115327-115358 7 0.781
CP023865_34 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT 6459915-6459946 32 MF477236 Nocardia phage NTR1, complete genome 17941-17972 7 0.781
CP023865_34 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT 6459915-6459946 32 MN694194 Marine virus AFVG_250M1056, complete genome 18725-18756 7 0.781
CP023865_34 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT 6459915-6459946 32 MN694435 Marine virus AFVG_250M1055, complete genome 27696-27727 7 0.781
CP023865_34 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT 6459915-6459946 32 MN693636 Marine virus AFVG_250M1057, complete genome 18703-18734 7 0.781
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 129779-129810 7 0.781
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 265106-265137 7 0.781
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NZ_CP026974 Achromobacter insolitus strain FDAARGOS_88 plasmid unnamed1, complete sequence 225723-225754 7 0.781
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NC_014642 Achromobacter xylosoxidans A8 plasmid pA82, complete sequence 78759-78790 7 0.781
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 647860-647891 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 667931-667962 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 AY320035 Bacteriophage VWB, complete genome 9100-9131 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_005345 Streptomyces phage VWB, complete genome 9100-9131 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 371375-371406 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MN234179 Gordonia phage Pipp, complete genome 8302-8333 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MN010762 Gordonia phage MintFen, complete genome 8326-8357 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MT553336 Gordonia phage BlingBling, complete genome 8326-8357 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_031265 Gordonia phage Guacamole, complete genome 8330-8361 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MF919521 Gordonia phage Lysidious, complete genome 8326-8357 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MN586031 Gordonia phage Gambino, complete genome 8670-8701 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MN369740 Gordonia phage Delian, complete genome 8329-8360 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 KU998236 Gordonia phage Blueberry, complete genome 8670-8701 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MN096365 Gordonia phage Samba, complete genome 8434-8465 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MH576969 Gordonia phage Zarbodnamra, complete genome 8325-8356 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MK864263 Gordonia phage Melba, complete genome 8326-8357 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MN062704 Gordonia phage JuJu, complete genome 8254-8285 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MK878896 Gordonia phage Begonia, complete genome 8329-8360 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MK501729 Gordonia phage Walrus, complete genome 8528-8559 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MT723942 Gordonia phage Archis, complete genome 8538-8569 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MK967389 Gordonia phage JasperJr, complete genome 8330-8361 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MK501730 Gordonia phage Barco, complete genome 8326-8357 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MH020241 Gordonia phage Fenry, complete genome 8075-8106 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MT723935 Gordonia phage Azula, complete genome 8670-8701 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 KU963251 Gordonia phage UmaThurman, complete genome 8433-8464 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 KX557274 Gordonia phage CaptainKirk2, complete genome 8329-8360 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MH153808 Gordonia phage Petra, complete genome 8706-8737 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MT723936 Gordonia phage Hitter, complete genome 8326-8357 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MH536818 Gordonia phage Frokostdame, complete genome 8321-8352 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_030921 Gordonia phage Utz, complete genome 8299-8330 7 0.781
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 KX557275 Gordonia phage CarolAnn, complete genome 8225-8256 7 0.781
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 CP021131 Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence 119108-119139 7 0.781
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 54850-54881 7 0.781
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NC_021278 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 1, complete sequence 68818-68849 7 0.781
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 204255-204286 7 0.781
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 KR063280 Gordonia phage GMA6, complete genome 31975-32006 7 0.781
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 MK279853 Gordonia phage Gray, complete genome 40658-40689 7 0.781
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 MN586022 Gordonia phage Chidiebere, complete genome 40657-40688 7 0.781
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NZ_CP024896 Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence 8878-8909 7 0.781
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 DQ123818 Actinomyces phage Av-1, complete genome 11371-11402 7 0.781
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 1006499-1006530 7 0.781
CP023865_34 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460525-6460556 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 177164-177195 7 0.781
CP023865_34 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460525-6460556 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1483411-1483442 7 0.781
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 120983-121015 7 0.788
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 2413224-2413256 7 0.788
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 557856-557888 7 0.788
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1526247-1526279 7 0.788
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 1554-1586 7 0.788
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 267225-267256 7 0.781
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1568836-1568867 7 0.781
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1191363-1191394 7 0.781
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1482448-1482479 7 0.781
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 324642-324673 7 0.781
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 61365-61396 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 776740-776771 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045330 Labrenzia sp. THAF191b plasmid pTHAF191b_b, complete sequence 98376-98407 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045331 Labrenzia sp. THAF191b plasmid pTHAF191b_c, complete sequence 72639-72670 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045346 Labrenzia sp. THAF187b plasmid pTHAF187b_b, complete sequence 98376-98407 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045347 Labrenzia sp. THAF187b plasmid pTHAF187b_c, complete sequence 74796-74827 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045334 Labrenzia sp. THAF191a plasmid pTHAF191a_a, complete sequence 105826-105857 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045336 Labrenzia sp. THAF191a plasmid pTHAF191a_c, complete sequence 51994-52025 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045382 Labrenzia sp. THAF35 plasmid pTHAF35_b, complete sequence 110100-110131 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045383 Labrenzia sp. THAF35 plasmid pTHAF35_c, complete sequence 46472-46503 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP019632 Labrenzia aggregata strain RMAR6-6 plasmid unnamed2, complete sequence 71237-71268 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP030100 Roseovarius sp. AK1035 plasmid unnamed, complete sequence 78721-78752 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP020475 Roseovarius mucosus strain SMR3 plasmid pSMR3-1, complete sequence 17940-17971 7 0.781
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP011928 Labrenzia sp. CP4 plasmid pBCL1, complete sequence 21865-21896 7 0.781
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 33382-33413 7 0.781
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 160068-160099 7 0.781
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 779864-779895 7 0.781
CP023865_34 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT 6461197-6461228 32 NC_022061 Mycobacterium phage KayaCho, complete genome 49560-49591 7 0.781
CP023865_34 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT 6461197-6461228 32 NC_024145 Mycobacterium phage Hosp, complete genome 47935-47966 7 0.781
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 171566-171597 7 0.781
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP044551 Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence 25081-25112 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 617124-617155 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 82307-82338 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 177678-177709 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 784110-784141 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 KP027201 Mycobacterium phage Sbash, complete genome 5726-5757 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_004683 Mycobacterium phage Che9c, complete genome 5741-5772 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 AY129333 Mycobacterium virus Che9c, complete genome 5741-5772 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_018583 Gordonia sp. KTR9 plasmid pGKT3, complete sequence 166965-166996 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 51353-51384 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 79935-79966 7 0.781
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 MH588547 Caulobacter phage CcrSC, complete genome 260536-260567 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP017991 Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence 82705-82736 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NC_015963 UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS01, complete sequence 79246-79277 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 631950-631981 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 272525-272556 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 292515-292546 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 275066-275097 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 272698-272729 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 273068-273099 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 273068-273099 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 276404-276435 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 273063-273094 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 292515-292546 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 371245-371276 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 371245-371276 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 371245-371276 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 272698-272729 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 371245-371276 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 371746-371777 7 0.781
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 278702-278733 7 0.781
CP023865_34 34.51|6461687|32|CP023865|CRISPRCasFinder,CRT 6461687-6461718 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 624632-624663 7 0.781
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 33382-33413 7 0.781
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 160068-160099 7 0.781
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 779864-779895 7 0.781
CP023865_34 34.59|6461202|32|CP023865|PILER-CR 6461202-6461233 32 NC_022061 Mycobacterium phage KayaCho, complete genome 49560-49591 7 0.781
CP023865_34 34.59|6461202|32|CP023865|PILER-CR 6461202-6461233 32 NC_024145 Mycobacterium phage Hosp, complete genome 47935-47966 7 0.781
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 171566-171597 7 0.781
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP044551 Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence 25081-25112 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 617124-617155 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 82307-82338 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 177678-177709 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 784110-784141 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 KP027201 Mycobacterium phage Sbash, complete genome 5726-5757 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_004683 Mycobacterium phage Che9c, complete genome 5741-5772 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 AY129333 Mycobacterium virus Che9c, complete genome 5741-5772 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_018583 Gordonia sp. KTR9 plasmid pGKT3, complete sequence 166965-166996 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 51353-51384 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 79935-79966 7 0.781
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 MH588547 Caulobacter phage CcrSC, complete genome 260536-260567 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP017991 Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence 82705-82736 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NC_015963 UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS01, complete sequence 79246-79277 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 631950-631981 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 272525-272556 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 292515-292546 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 275066-275097 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 272698-272729 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 273068-273099 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 273068-273099 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 276404-276435 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 273063-273094 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 292515-292546 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 371245-371276 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 371245-371276 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 371245-371276 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 272698-272729 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 371245-371276 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 371746-371777 7 0.781
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 278702-278733 7 0.781
CP023865_34 34.67|6461692|32|CP023865|PILER-CR 6461692-6461723 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 624632-624663 7 0.781
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 696227-696255 7 0.759
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 113342-113370 7 0.759
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP015204 Rhodococcus sp. 008 plasmid pR8C1, complete sequence 78263-78291 7 0.759
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 50701-50729 7 0.759
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP025961 Rhodococcus qingshengii strain djl-6-2 plasmid pDJL2, complete sequence 24861-24889 7 0.759
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 184829-184857 7 0.759
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 77772-77800 7 0.759
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NC_020562 Sphingomonas sp. MM-1 plasmid pISP1, complete sequence 93867-93895 7 0.759
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 858523-858551 7 0.759
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 MN813686 Mycobacterium phage BirdsNest, complete genome 29441-29469 7 0.759
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 345730-345759 8 0.733
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 MT889384 Mycobacterium phage STLscum, complete genome 1121-1150 8 0.733
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NC_023862 Mycobacterium phage Alsfro, complete genome 1038-1067 8 0.733
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 KT818595 Mycobacterium phage Pepe, complete genome 1120-1149 8 0.733
CP023865_1 1.1|71752|30|CP023865|CRISPRCasFinder 71752-71781 30 NC_023748 Mycobacterium phage SkiPole, complete genome 1121-1150 8 0.733
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NC_015952 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence 67234-67266 8 0.758
CP023865_2 2.4|229500|33|CP023865|CRT 229500-229532 33 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 530829-530861 8 0.758
CP023865_2 2.4|229500|33|CP023865|CRT 229500-229532 33 HM486077 Tsukamurella phage TPA2, complete sequence 51324-51356 8 0.758
CP023865_2 2.4|229500|33|CP023865|CRT 229500-229532 33 NC_015210 Tsukamurella phage TPA2, complete genome 51324-51356 8 0.758
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 772233-772264 8 0.75
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1122202-1122233 8 0.75
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1275621-1275652 8 0.75
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1275565-1275596 8 0.75
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 763977-764008 8 0.75
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 503283-503314 8 0.75
CP023865_9 9.2|1545830|32|CP023865|CRISPRCasFinder 1545830-1545861 32 NC_014120 Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence 338464-338495 8 0.75
CP023865_25 25.1|4810356|33|CP023865|CRISPRCasFinder 4810356-4810388 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 554738-554770 8 0.758
CP023865_25 25.1|4810356|33|CP023865|CRISPRCasFinder 4810356-4810388 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1258329-1258361 8 0.758
CP023865_28 28.1|6064595|31|CP023865|CRISPRCasFinder 6064595-6064625 31 MN693610 Marine virus AFVG_250M347, complete genome 9816-9846 8 0.742
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP015268 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence 42620-42651 8 0.75
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 38331-38362 8 0.75
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 56285-56316 8 0.75
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 346261-346292 8 0.75
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 394513-394544 8 0.75
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2574933-2574964 8 0.75
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 325780-325811 8 0.75
CP023865_33 33.5|6446597|32|CP023865|CRISPRCasFinder,PILER-CR 6446597-6446628 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 575194-575225 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4982063-4982094 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_016021 Komagataeibacter medellinensis NBRC 3288 plasmid pGXY020, complete sequence 38708-38739 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_017130 Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence 55580-55611 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_017134 Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence 55604-55635 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_017101 Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence 55588-55619 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP021923 Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-1 75513-75544 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP021512 Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 plasmid pAP1342-3, complete sequence 16681-16712 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_013210 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence 55960-55991 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_013211 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-020, complete sequence 131366-131397 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_017136 Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence 55572-55603 8 0.75
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 15208-15239 8 0.75
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 389019-389050 8 0.75
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 177833-177864 8 0.75
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 165330-165361 8 0.75
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 366831-366862 8 0.75
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NC_014213 Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence 208871-208902 8 0.75
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 AP014194 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C71-MedDCM-OCT-S28-C33, *** SEQUENCING IN PROGRESS *** 4014-4045 8 0.75
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MH338234 Mycobacterium phage Crucio, complete genome 40076-40108 8 0.758
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MH697591 Mycobacterium phage QueenBeesly, complete genome 40057-40089 8 0.758
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MT498060 Mycobacterium Phage FiringLine, complete genome 40057-40089 8 0.758
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 KM463009 Mycobacterium phage Power, complete genome 40101-40133 8 0.758
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MT498066 Mycobacterium phage Georgie2, complete genome 40102-40134 8 0.758
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MN234203 Mycobacterium phage SemperFi, complete genome 40325-40357 8 0.758
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MF919531 Mycobacterium phage SnapTap, complete genome 40136-40168 8 0.758
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NC_029043 Mycobacterium phage SweetiePie, complete genome 40268-40300 8 0.758
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 192751-192783 8 0.758
CP023865_33 33.13|6447086|31|CP023865|CRISPRCasFinder 6447086-6447116 31 DQ115813 Cyanobacteria phage AS-1 contig_6 genomic sequence 1592-1622 8 0.742
CP023865_33 33.16|6447268|32|CP023865|CRISPRCasFinder,PILER-CR 6447268-6447299 32 NC_010580 Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence 36942-36973 8 0.75
CP023865_33 33.17|6447329|32|CP023865|CRISPRCasFinder,PILER-CR 6447329-6447360 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 465989-466020 8 0.75
CP023865_33 33.18|6447390|32|CP023865|CRISPRCasFinder,PILER-CR 6447390-6447421 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 319567-319598 8 0.75
CP023865_33 33.18|6447390|32|CP023865|CRISPRCasFinder,PILER-CR 6447390-6447421 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 318776-318807 8 0.75
CP023865_33 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR 6447512-6447543 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 817949-817980 8 0.75
CP023865_33 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR 6447512-6447543 32 NC_048139 Streptomyces phage Hiyaa, complete genome 59437-59468 8 0.75
CP023865_33 33.21|6447573|32|CP023865|CRISPRCasFinder,PILER-CR 6447573-6447604 32 NZ_CP040642 Agrobacterium sp. T29 plasmid unnamed2, complete sequence 157742-157773 8 0.75
CP023865_33 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR 6447756-6447787 32 NZ_LR134453 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence 8053-8084 8 0.75
CP023865_33 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR 6447756-6447787 32 NC_047800 Ralstonia virus phiAp1, complete genome 32281-32312 8 0.75
CP023865_33 33.25|6447817|32|CP023865|CRISPRCasFinder,PILER-CR 6447817-6447848 32 NZ_CP035418 Leisingera sp. NJS204 plasmid unnamed1, complete sequence 67885-67916 8 0.75
CP023865_33 33.25|6447817|32|CP023865|CRISPRCasFinder,PILER-CR 6447817-6447848 32 NZ_CP022543 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-3, complete sequence 30058-30089 8 0.75
CP023865_33 33.25|6447817|32|CP023865|CRISPRCasFinder,PILER-CR 6447817-6447848 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 176079-176110 8 0.75
CP023865_33 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR 6447878-6447910 33 NZ_CP023779 Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence 12308-12340 8 0.758
CP023865_33 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR 6447878-6447910 33 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 9722-9754 8 0.758
CP023865_33 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR 6447878-6447910 33 MN329675 Microbacterium phage SansAfet, complete genome 14687-14719 8 0.758
CP023865_33 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR 6447878-6447910 33 MT818427 Microbacterium phage AnnaLie, complete genome 15085-15117 8 0.758
CP023865_33 33.30|6448123|32|CP023865|CRISPRCasFinder,PILER-CR 6448123-6448154 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 782401-782432 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 495486-495517 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK524525 Mycobacterium phage Ringer, complete genome 12332-12363 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG944220 Mycobacterium phage Ruotula, complete genome 12283-12314 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK494116 Mycobacterium phage Dulcie, complete genome 11672-11703 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN234212 Mycobacterium phage Paphu, complete genome 11461-11492 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH001458 Mycobacterium phage Smeagol, complete genome 12887-12918 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK814754 Mycobacterium phage Sumter, complete genome 11590-11621 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN369760 Mycobacterium phage KyMonks1A, complete genome 12349-12380 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN585991 Mycobacterium phage Snazzy, complete genome 11480-11511 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH479919 Mycobacterium phage Moose, complete genome 12035-12066 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG925342 Mycobacterium phage Forsytheast, complete genome 12035-12066 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK359354 Mycobacterium phage PinkPlastic, complete genome 11839-11870 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH371110 Mycobacterium phage Magnar, complete genome 11748-11779 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG872836 Mycobacterium phage Fajezeel, complete genome 12345-12376 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK112540 Mycobacterium phage Froghopper, complete genome 11714-11745 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN585985 Mycobacterium phage Watermelon, complete genome 12887-12918 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_042326 Mycobacterium virus KSSJEB, complete genome 11843-11874 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN586000 Mycobacterium phage Sagefire, complete genome 12875-12906 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH632117 Mycobacterium phage Homines, complete genome 12052-12083 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG925344 Mycobacterium phage Ichabod, complete genome 12058-12089 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH576974 Mycobacterium phage Sibs6, complete genome 12300-12331 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK359299 Mycobacterium phage Petp2012, complete genome 12973-13004 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK359331 Mycobacterium phage Rajelicia, complete genome 11981-12012 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK524531 Mycobacterium phage Rutherferd, complete genome 12624-12655 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH744414 Mycobacterium phage Arcanine, complete genome 11952-11983 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN585997 Mycobacterium phage Traft412, complete genome 12686-12717 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MT771340 Mycobacterium phage Jorgensen, complete genome 11830-11861 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KX574454 Mycobacterium phage PacerPaul, complete genome 12272-12303 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 EU826470 Mycobacterium phage Solon, complete genome 12631-12662 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG920060 Mycobacterium phage Bob3, complete genome 11587-11618 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH338239 Mycobacterium phage Mryolo, complete genome 11786-11817 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK524506 Mycobacterium phage Zeuska, complete genome 12567-12598 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG872833 Mycobacterium phage BeesKnees, complete genome 12081-12112 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KY224001 Mycobacterium phage Blue, complete genome 12138-12169 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MF919508 Mycobacterium phage ILeeKay, complete genome 12206-12237 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK967387 Mycobacterium phage Big3, complete genome 12666-12697 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KR080201 Mycobacterium phage Nerujay, complete genome 12492-12523 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 JN020140 Mycobacterium virus MrGordo, complete genome 11755-11786 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 EU744251 Mycobacterium phage Jasper, complete genome 11869-11900 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG925351 Mycobacterium phage MPlant7149, complete genome 11601-11632 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK820638 Mycobacterium phage HermioneGrange, complete genome 11747-11778 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 AY500153 Mycobacteriophage Bethlehem, complete genome 13309-13340 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK967401 Mycobacterium phage Carlyle, complete genome 12618-12649 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH590595 Mycobacterium phage NEHalo, complete genome 11597-11628 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK305893 Mycobacterium phage Beatrix, complete genome 12722-12753 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 JN572689 Mycobacterium phage Perseus, complete genome 12156-12187 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH338238 Mycobacterium phage Michley, complete genome 11942-11973 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KJ690250 Mycobacterium phage Pinto, complete genome 12147-12178 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_023862 Mycobacterium phage Alsfro, complete genome 12820-12851 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KM597531 Mycobacterium phage Abrogate, complete genome 12689-12720 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_023723 Mycobacterium phage Aeneas, complete genome 12366-12397 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH000606 Mycobacterium phage Fascinus, complete genome 11772-11803 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN617845 Mycobacterium phage BaconJack, complete genome 12058-12089 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_028941 Mycobacterium phage Turj99, complete genome 11779-11810 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK359312 Mycobacterium phage Fushigi, complete genome 12437-12468 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KF493880 Mycobacterium phage HanShotFirst, complete genome 11637-11668 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN585970 Mycobacterium phage Killigrew, complete genome 11479-11510 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH450133 Mycobacterium phage SwissCheese, complete genome 12035-12066 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN428054 Mycobacterium phage JackSparrow, complete genome 12374-12405 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH651180 Mycobacterium phage Maroc7, complete genome 11773-11804 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_022329 Mycobacterium phage PhrostyMug, complete genome 12070-12101 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN813700 Mycobacterium phage Atkinbua, complete genome 11994-12025 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_024136 Mycobacterium phage Seabiscuit, complete genome 12080-12111 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KF560331 Mycobacterium phage Graduation, complete genome 12795-12826 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MT639644 Mycobacterium phage MaryBeth, complete genome 12195-12226 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MT639654 Mycobacterium phage Jerm2, complete genome 12247-12278 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 JF937108 Mycobacterium phage Switzer, complete genome 11958-11989 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 JN660814 Mycobacterium phage Dreamboat, complete genome 11925-11956 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG812486 Mycobacterium phage Acme, complete genome 12380-12411 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_031067 Mycobacterium phage Makemake, complete genome 13232-13263 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH669011 Mycobacterium phage PherrisBueller, complete genome 11925-11956 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 JF937103 Mycobacterium virus Museum, complete genome 12089-12120 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 JF937099 Mycobacterium virus JC27, complete genome 12658-12689 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK359300 Mycobacterium phage AFIS, complete genome 11944-11975 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH230876 Mycobacterium phage ConceptII, complete genome 12251-12282 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH450113 Mycobacterium phage BigMau, complete genome 12247-12278 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KJ409696 Mycobacterium phage Lamina13, complete genome 11625-11656 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_042327 Mycobacterium virus BBPiebs31, complete genome 12279-12310 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KY213952 Mycobacterium phage Petruchio, complete genome 11714-11745 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG812495 Mycobacterium phage Pippin, complete genome 12408-12439 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KF279416 Mycobacterium phage SargentShorty9, complete genome 12077-12108 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 JQ698665 Mycobacterium phage Nepal, complete genome 12367-12398 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MG812489 Mycobacterium phage Greg, complete genome 12345-12376 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MT310897 Mycobacterium phage Manatee, complete genome 12032-12063 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK310142 Mycobacterium phage MetalQZJ, complete genome 12195-12226 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_028784 Mycobacterium phage Tasp14, complete genome 12275-12306 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH020244 Mycobacterium phage Lopton, complete genome 13391-13422 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 KT259047 Mycobacterium phage Rufus, complete genome 12163-12194 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_009878 Mycobacterium phage Bethlehem, complete genome 13309-13340 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH513971 Mycobacterium phage Hope4ever, complete genome 12154-12185 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MH450130 Mycobacterium phage Rohr, complete genome 12280-12311 8 0.75
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MK112530 Mycobacterium phage BigPaolini, complete genome 12673-12704 8 0.75
CP023865_33 33.32|6448245|32|CP023865|CRISPRCasFinder,PILER-CR 6448245-6448276 32 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 220265-220296 8 0.75
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 330227-330258 8 0.75
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 885130-885161 8 0.75
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 MK737944 Microbacterium phage Warren, complete genome 15043-15074 8 0.75
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 537315-537346 8 0.75
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1367849-1367880 8 0.75
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 30667-30698 8 0.75
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1534590-1534621 8 0.75
CP023865_33 33.34|6448367|32|CP023865|CRISPRCasFinder,PILER-CR 6448367-6448398 32 NZ_CP039900 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877b, complete sequence 53247-53278 8 0.75
CP023865_33 33.34|6448367|32|CP023865|CRISPRCasFinder,PILER-CR 6448367-6448398 32 NZ_CP039891 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499b, complete sequence 53247-53278 8 0.75
CP023865_33 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR 6448428-6448459 32 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 238008-238039 8 0.75
CP023865_33 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR 6448428-6448459 32 NC_007950 Polaromonas sp. JS666 plasmid 2, complete sequence 284453-284484 8 0.75
CP023865_33 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR 6448611-6448642 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 49795-49826 8 0.75
CP023865_33 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR 6448611-6448642 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 49795-49826 8 0.75
CP023865_33 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR 6448611-6448642 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 191251-191282 8 0.75
CP023865_33 33.41|6448794|32|CP023865|CRISPRCasFinder,PILER-CR 6448794-6448825 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 606617-606648 8 0.75
CP023865_33 33.41|6448794|32|CP023865|CRISPRCasFinder,PILER-CR 6448794-6448825 32 MG962360 Microbacterium phage AlexAdler, complete genome 7182-7213 8 0.75
CP023865_33 33.44|6448977|33|CP023865|CRISPRCasFinder,PILER-CR 6448977-6449009 33 NZ_KY000048 Agrobacterium rhizogenes strain CFBP2746 plasmid pTi_CFBP2746, complete sequence 102751-102783 8 0.758
CP023865_33 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR 6449039-6449070 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 168459-168490 8 0.75
CP023865_33 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR 6449039-6449070 32 NC_009806 Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence 104874-104905 8 0.75
CP023865_33 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR 6449039-6449070 32 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 449350-449381 8 0.75
CP023865_34 34.1|6458631|32|CP023865|CRISPRCasFinder,CRT 6458631-6458662 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 644668-644699 8 0.75
CP023865_34 34.2|6458692|32|CP023865|CRISPRCasFinder,CRT 6458692-6458723 32 NZ_CP032687 Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence 82987-83018 8 0.75
CP023865_34 34.2|6458692|32|CP023865|CRISPRCasFinder,CRT 6458692-6458723 32 NZ_CP032692 Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence 94130-94161 8 0.75
CP023865_34 34.2|6458692|32|CP023865|CRISPRCasFinder,CRT 6458692-6458723 32 NC_020061 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence 84503-84534 8 0.75
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 326572-326603 8 0.75
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 560982-561013 8 0.75
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 487552-487583 8 0.75
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 59481-59512 8 0.75
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP023524 Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence 61961-61992 8 0.75
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 47823-47854 8 0.75
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 193119-193150 8 0.75
CP023865_34 34.4|6458814|32|CP023865|CRISPRCasFinder,CRT 6458814-6458845 32 CP053919 Serratia marcescens strain LY1 plasmid unnamed1, complete sequence 2252-2283 8 0.75
CP023865_34 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT 6458875-6458906 32 NZ_CP005961 Pseudomonas mandelii JR-1 plasmid unnamed, complete sequence 205319-205350 8 0.75
CP023865_34 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT 6458875-6458906 32 NC_011273 Mycobacterium phage Myrna, complete genome 69309-69340 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 LR606152 Rhizobium sp. Q54 genome assembly, plasmid: 9 117399-117430 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2079280-2079311 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2339340-2339371 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 932193-932224 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 350075-350106 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1712504-1712535 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 124378-124409 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1767974-1768005 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1420292-1420323 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1698720-1698751 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 697415-697446 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1777470-1777501 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 697576-697607 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1485094-1485125 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1719750-1719781 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1738636-1738667 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1714570-1714601 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1783402-1783433 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1714035-1714066 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1788950-1788981 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1783369-1783400 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1768391-1768422 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1782104-1782135 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1679298-1679329 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1768391-1768422 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1782203-1782234 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1679945-1679976 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1768391-1768422 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1768391-1768422 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1768391-1768422 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1782199-1782230 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 263818-263849 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1782188-1782219 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1679321-1679352 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1693036-1693067 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1673682-1673713 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1734726-1734757 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1766707-1766738 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1765706-1765737 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1782188-1782219 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1679321-1679352 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1783193-1783224 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1679321-1679352 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1679321-1679352 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1782199-1782230 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1768396-1768427 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 231678-231709 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1782210-1782241 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1782011-1782042 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 231678-231709 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MN234216 Streptomyces phage Gilgamesh, complete genome 84445-84476 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NC_026603 Mycobacterium phage Keshu, complete genome 43646-43677 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NC_023498 Mycobacterium phage Validus, complete genome 43936-43967 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 127950-127981 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 71228-71259 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MT723940 Mycobacterium phage Ellie, complete genome 42881-42912 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MH744418 Streptomyces phage JustBecause, complete genome 144195-144226 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MF324915 Mycobacterium phage Amgine, complete genome 44021-44052 8 0.75
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MT310898 Streptomyces phage Kela, complete genome 144778-144809 8 0.75
CP023865_34 34.8|6459059|33|CP023865|CRISPRCasFinder,CRT 6459059-6459091 33 MN908686 Microbacterium phage Zepp, complete genome 18346-18378 8 0.758
CP023865_34 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT 6459121-6459152 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 24927-24958 8 0.75
CP023865_34 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT 6459121-6459152 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 607620-607651 8 0.75
CP023865_34 34.12|6459304|32|CP023865|CRISPRCasFinder,CRT 6459304-6459335 32 NZ_CP012265 Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence 126413-126444 8 0.75
CP023865_34 34.12|6459304|32|CP023865|CRISPRCasFinder,CRT 6459304-6459335 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 78168-78199 8 0.75
CP023865_34 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT 6459365-6459396 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1236776-1236807 8 0.75
CP023865_34 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT 6459365-6459396 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 576757-576788 8 0.75
CP023865_34 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT 6459365-6459396 32 NZ_CP014690 Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence 116604-116635 8 0.75
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 NZ_CP021368 Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence 11764-11795 8 0.75
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 NZ_CP021364 Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence 30846-30877 8 0.75
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 175036-175067 8 0.75
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 NC_009939 Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence 50687-50718 8 0.75
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 70937-70968 8 0.75
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 MF140427 Arthrobacter phage Shrooms, complete genome 40031-40062 8 0.75
CP023865_34 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT 6459732-6459763 32 NC_010518 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD05, complete sequence 3405-3436 8 0.75
CP023865_34 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT 6459732-6459763 32 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 257633-257664 8 0.75
CP023865_34 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT 6459732-6459763 32 NZ_AP014707 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_3p, complete sequence 19159-19190 8 0.75
CP023865_34 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT 6459854-6459885 32 MH617132 Microviridae sp. isolate ctcg164, complete genome 2771-2802 8 0.75
CP023865_34 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT 6459854-6459885 32 KX670786 Arthrobacter phage Chubster, complete genome 40441-40472 8 0.75
CP023865_34 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT 6459854-6459885 32 MN234234 Arthrobacter phage Lymara, complete genome 40646-40677 8 0.75
CP023865_34 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT 6459915-6459946 32 NC_008242 Chelativorans sp. BNC1 plasmid 1, complete sequence 151227-151258 8 0.75
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 262281-262312 8 0.75
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 250884-250915 8 0.75
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NZ_AP022334 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence 226170-226201 8 0.75
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 38530-38561 8 0.75
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 526373-526404 8 0.75
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 313653-313684 8 0.75
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 KU958700 Streptomyces phage Chymera, complete genome 33522-33553 8 0.75
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NZ_LR134467 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence 69640-69671 8 0.75
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 115346-115377 8 0.75
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 103686-103717 8 0.75
CP023865_34 34.27|6460220|32|CP023865|CRISPRCasFinder,CRT 6460220-6460251 32 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 320885-320916 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 595357-595388 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 463243-463274 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 401250-401281 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 618706-618737 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 519004-519035 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 129930-129961 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 427461-427492 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 496323-496354 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 458090-458121 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 476408-476439 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 645075-645106 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 381229-381260 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 7677-7708 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 491715-491746 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 203446-203477 8 0.75
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 349361-349392 8 0.75
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 MN204493 Streptomyces phage Zuko, complete genome 40875-40906 8 0.75
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NZ_CP041606 Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence 79564-79595 8 0.75
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NZ_CP009113 Rhodococcus opacus strain 1CP plasmid pR1CP2, complete sequence 44725-44756 8 0.75
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 983031-983062 8 0.75
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1792033-1792064 8 0.75
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 21228-21259 8 0.75
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 16934-16965 8 0.75
CP023865_34 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460525-6460556 32 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 209765-209796 8 0.75
CP023865_34 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460525-6460556 32 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 25737-25768 8 0.75
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NC_048021 Gordonia phage Daredevil, complete genome 30560-30592 8 0.758
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 62004-62036 8 0.758
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 37082-37114 8 0.758
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 90142-90174 8 0.758
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 263003-263035 8 0.758
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 5568-5599 8 0.75
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 695344-695375 8 0.75
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP015237 Rhodococcus fascians D188 plasmid unnamed2, complete sequence 4357-4388 8 0.75
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP015237 Rhodococcus fascians D188 plasmid unnamed2, complete sequence 155661-155692 8 0.75
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_CP026653 Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence 81053-81084 8 0.75
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2324193-2324224 8 0.75
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1303111-1303142 8 0.75
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 MG945435 UNVERIFIED: Microviridae sp. isolate 5111-1801, complete genome 4288-4319 8 0.75
CP023865_34 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT 6460892-6460923 32 NZ_CP032625 Gryllotalpicola sp. 2DFW10M-5 plasmid unnamed1, complete sequence 1177-1208 8 0.75
CP023865_34 34.39|6460953|32|CP023865|CRISPRCasFinder,CRT 6460953-6460984 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 487656-487687 8 0.75
CP023865_34 34.39|6460953|32|CP023865|CRISPRCasFinder,CRT 6460953-6460984 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 487664-487695 8 0.75
CP023865_34 34.39|6460953|32|CP023865|CRISPRCasFinder,CRT 6460953-6460984 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 484515-484546 8 0.75
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NZ_CP021406 Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence 171436-171467 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 196845-196876 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 449308-449339 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 409085-409116 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 KY130461 Mycobacterium phage Taptic, complete genome 59162-59193 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 MH001446 Mycobacterium phage Megabear, complete genome 58768-58799 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 MK967402 Mycobacterium phage NihilNomen, complete genome 78711-78742 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 AP018462 Mycobacterium phage D12 DNA, complete genome 59479-59510 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 MK494131 Mycobacterium phage GodPhather, complete genome 59622-59653 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 MK494114 Mycobacterium phage Argie, complete genome 59736-59767 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 MK494132 Mycobacterium phage Cepens, complete genome 58845-58876 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 AP018463 Mycobacterium phage PR DNA, complete genome 59456-59487 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 MH001450 Mycobacterium phage Jeon, complete genome 59115-59146 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 MN183286 Mycobacteriophage Yeet, complete genome 78669-78700 8 0.75
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 KF114875 Mycobacterium phage Redno2, complete genome 76713-76744 8 0.75
CP023865_34 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT 6461197-6461228 32 NC_023600 Mycobacterium phage Jolie1, complete genome 49833-49864 8 0.75
CP023865_34 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT 6461197-6461228 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 217758-217789 8 0.75
CP023865_34 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT 6461197-6461228 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 314936-314967 8 0.75
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 381771-381803 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 NC_011165 Pseudomonas phage LBL3, complete genome 18294-18326 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MT119375 Pseudomonas phage chumba, complete genome 18367-18399 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MT119364 Pseudomonas phage elmo, complete genome 18577-18609 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 FM201281 Pseudomonas phage LBL3 complete genome 18294-18326 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 KU198331 Pseudomonas phage NP3, complete genome 19598-19630 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 NC_007810 Pseudomonas phage F8, complete genome 19330-19362 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MT119374 Pseudomonas phage antinowhere, complete genome 18579-18611 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 GU815091 Pseudomonas phage JG024, complete genome 19608-19640 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MT119372 Pseudomonas phage cory, complete genome 39016-39048 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MT119370 Pseudomonas phage steven, complete genome 18451-18483 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MT108726 Pseudomonas phage Epa6, complete genome 19123-19155 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 KF981875 Pseudomonas phage SPM-1, complete genome 1623-1655 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 NC_050151 Pseudomonas phage crassa, complete genome 18723-18755 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MT119378 Pseudomonas phage datas, complete genome 18359-18391 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 JQ067083 UNVERIFIED: Pseudomonas phage PaMx13, complete genome 47202-47234 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 DQ163917 Bacteriophage F8, complete genome 19330-19362 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 NC_048745 Pseudomonas phage vB_PaeM_SCUT-S1, complete genome 19376-19408 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 NC_026600 Pseudomonas phage vB_PaeM_C1-14_Ab28, complete genome 26567-26599 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MN508620 UNVERIFIED: Pseudomonas phage E2005-24-39, complete genome 9504-9536 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MN871454 UNVERIFIED: Pseudomonas phage Pa-A, complete genome 9502-9534 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MN564818 Pseudomonas phage DRL-P1, complete genome 7969-8001 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MT118303 Pseudomonas phage Epa39, complete genome 9667-9699 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 NC_028745 Pseudomonas phage DL60, complete genome 55718-55750 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 MK317959 Pseudomonas phage EPa61, complete genome 49099-49131 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 NC_048626 Pseudomonas phage PA01 DNA, nearly complete genome 9502-9534 8 0.758
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 KR054028 Pseudomonas phage DL52, complete genome 55474-55506 8 0.758
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NC_014911 Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence 28827-28858 8 0.75
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NC_006823 Aromatoleum aromaticum EbN1 plasmid 1, complete sequence 2232-2263 8 0.75
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 91423-91454 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 296887-296918 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 AM261282 Uncultured bacterium IncP-1 plasmid pKJK5 complete sequence 38826-38857 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 NZ_CP028340 Thauera aromatica K172 plasmid pKJK172, complete sequence 38204-38235 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 KC964605 Uncultured bacterium plasmid pMLUA1, complete sequence 43288-43319 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 KC964606 Uncultured bacterium plasmid pMLUA3, complete sequence 42302-42333 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 KC964607 Uncultured bacterium plasmid pMLUA4, complete sequence 39918-39949 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 JQ004406 Uncultured bacterium plasmid pHH128, complete sequence 34333-34364 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 JQ004407 Uncultured bacterium plasmid pHH3408, complete sequence 34341-34372 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 JQ004408 Uncultured bacterium plasmid pHH3414, complete sequence 34341-34372 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 JQ004409 Uncultured bacterium plasmid pKS77, complete sequence 34212-34243 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 NZ_MN366356 Bacterium plasmid pALTS27, complete sequence 41973-42004 8 0.75
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 NZ_MN366360 Bacterium plasmid pALTS32, complete sequence 41078-41109 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 75875-75906 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1084383-1084414 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1274054-1274085 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 88805-88836 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1366117-1366148 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1109017-1109048 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 733894-733925 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1612471-1612502 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1612417-1612448 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1343710-1343741 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1100015-1100046 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1274175-1274206 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1274158-1274189 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1274151-1274182 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 410021-410052 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 171936-171967 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 303902-303933 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 40645-40676 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 219467-219498 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 219803-219834 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 212332-212363 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP011046 Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI3, complete sequence 24236-24267 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP010421 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence 239492-239523 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP021037 Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI3, complete sequence 24235-24266 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 79918-79949 8 0.75
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 MT024859 Gordonia phage DumpsterDude, complete genome 8247-8278 8 0.75
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 685069-685100 8 0.75
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 75470-75501 8 0.75
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 848671-848702 8 0.75
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 117744-117775 8 0.75
CP023865_34 34.54|6460897|32|CP023865|PILER-CR 6460897-6460928 32 NZ_CP032625 Gryllotalpicola sp. 2DFW10M-5 plasmid unnamed1, complete sequence 1177-1208 8 0.75
CP023865_34 34.55|6460958|32|CP023865|PILER-CR 6460958-6460989 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 487656-487687 8 0.75
CP023865_34 34.55|6460958|32|CP023865|PILER-CR 6460958-6460989 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 487664-487695 8 0.75
CP023865_34 34.55|6460958|32|CP023865|PILER-CR 6460958-6460989 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 484515-484546 8 0.75
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NZ_CP021406 Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence 171436-171467 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 196845-196876 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 449308-449339 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 409085-409116 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 KY130461 Mycobacterium phage Taptic, complete genome 59162-59193 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 MH001446 Mycobacterium phage Megabear, complete genome 58768-58799 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 MK967402 Mycobacterium phage NihilNomen, complete genome 78711-78742 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 AP018462 Mycobacterium phage D12 DNA, complete genome 59479-59510 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 MK494131 Mycobacterium phage GodPhather, complete genome 59622-59653 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 MK494114 Mycobacterium phage Argie, complete genome 59736-59767 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 MK494132 Mycobacterium phage Cepens, complete genome 58845-58876 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 AP018463 Mycobacterium phage PR DNA, complete genome 59456-59487 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 MH001450 Mycobacterium phage Jeon, complete genome 59115-59146 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 MN183286 Mycobacteriophage Yeet, complete genome 78669-78700 8 0.75
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 KF114875 Mycobacterium phage Redno2, complete genome 76713-76744 8 0.75
CP023865_34 34.59|6461202|32|CP023865|PILER-CR 6461202-6461233 32 NC_023600 Mycobacterium phage Jolie1, complete genome 49833-49864 8 0.75
CP023865_34 34.59|6461202|32|CP023865|PILER-CR 6461202-6461233 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 217758-217789 8 0.75
CP023865_34 34.59|6461202|32|CP023865|PILER-CR 6461202-6461233 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 314936-314967 8 0.75
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 381771-381803 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 NC_011165 Pseudomonas phage LBL3, complete genome 18294-18326 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MT119375 Pseudomonas phage chumba, complete genome 18367-18399 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MT119364 Pseudomonas phage elmo, complete genome 18577-18609 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 FM201281 Pseudomonas phage LBL3 complete genome 18294-18326 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 KU198331 Pseudomonas phage NP3, complete genome 19598-19630 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 NC_007810 Pseudomonas phage F8, complete genome 19330-19362 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MT119374 Pseudomonas phage antinowhere, complete genome 18579-18611 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 GU815091 Pseudomonas phage JG024, complete genome 19608-19640 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MT119372 Pseudomonas phage cory, complete genome 39016-39048 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MT119370 Pseudomonas phage steven, complete genome 18451-18483 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MT108726 Pseudomonas phage Epa6, complete genome 19123-19155 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 KF981875 Pseudomonas phage SPM-1, complete genome 1623-1655 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 NC_050151 Pseudomonas phage crassa, complete genome 18723-18755 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MT119378 Pseudomonas phage datas, complete genome 18359-18391 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 JQ067083 UNVERIFIED: Pseudomonas phage PaMx13, complete genome 47202-47234 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 DQ163917 Bacteriophage F8, complete genome 19330-19362 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 NC_048745 Pseudomonas phage vB_PaeM_SCUT-S1, complete genome 19376-19408 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 NC_026600 Pseudomonas phage vB_PaeM_C1-14_Ab28, complete genome 26567-26599 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MN508620 UNVERIFIED: Pseudomonas phage E2005-24-39, complete genome 9504-9536 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MN871454 UNVERIFIED: Pseudomonas phage Pa-A, complete genome 9502-9534 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MN564818 Pseudomonas phage DRL-P1, complete genome 7969-8001 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MT118303 Pseudomonas phage Epa39, complete genome 9667-9699 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 NC_028745 Pseudomonas phage DL60, complete genome 55718-55750 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 MK317959 Pseudomonas phage EPa61, complete genome 49099-49131 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 NC_048626 Pseudomonas phage PA01 DNA, nearly complete genome 9502-9534 8 0.758
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 KR054028 Pseudomonas phage DL52, complete genome 55474-55506 8 0.758
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NC_014911 Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence 28827-28858 8 0.75
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NC_006823 Aromatoleum aromaticum EbN1 plasmid 1, complete sequence 2232-2263 8 0.75
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 91423-91454 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 296887-296918 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 AM261282 Uncultured bacterium IncP-1 plasmid pKJK5 complete sequence 38826-38857 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 NZ_CP028340 Thauera aromatica K172 plasmid pKJK172, complete sequence 38204-38235 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 KC964605 Uncultured bacterium plasmid pMLUA1, complete sequence 43288-43319 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 KC964606 Uncultured bacterium plasmid pMLUA3, complete sequence 42302-42333 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 KC964607 Uncultured bacterium plasmid pMLUA4, complete sequence 39918-39949 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 JQ004406 Uncultured bacterium plasmid pHH128, complete sequence 34333-34364 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 JQ004407 Uncultured bacterium plasmid pHH3408, complete sequence 34341-34372 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 JQ004408 Uncultured bacterium plasmid pHH3414, complete sequence 34341-34372 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 JQ004409 Uncultured bacterium plasmid pKS77, complete sequence 34212-34243 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 NZ_MN366356 Bacterium plasmid pALTS27, complete sequence 41973-42004 8 0.75
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 NZ_MN366360 Bacterium plasmid pALTS32, complete sequence 41078-41109 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 75875-75906 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1084383-1084414 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1274054-1274085 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 88805-88836 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1366117-1366148 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1109017-1109048 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 733894-733925 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1612471-1612502 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1612417-1612448 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1343710-1343741 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1100015-1100046 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1274175-1274206 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1274158-1274189 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1274151-1274182 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 410021-410052 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 171936-171967 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 303902-303933 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 40645-40676 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 219467-219498 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 219803-219834 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 212332-212363 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP011046 Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI3, complete sequence 24236-24267 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP010421 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence 239492-239523 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP021037 Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI3, complete sequence 24235-24266 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 79918-79949 8 0.75
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 MT024859 Gordonia phage DumpsterDude, complete genome 8247-8278 8 0.75
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 685069-685100 8 0.75
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 75470-75501 8 0.75
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 848671-848702 8 0.75
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 117744-117775 8 0.75
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 756211-756239 8 0.724
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP045361 Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence 187070-187098 8 0.724
CP023865_42 42.1|7408051|29|CP023865|CRISPRCasFinder 7408051-7408079 29 NZ_CP045319 Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence 79341-79369 8 0.724
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NC_010399 Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence 48099-48131 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1916101-1916133 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1919768-1919800 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 87089-87121 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 87089-87121 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1892492-1892524 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MN497953 Mycobacterium phage GtownJaz, complete genome 18733-18765 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KX523125 Mycobacterium phage BuzzBuzz, complete genome 18816-18848 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KC661272 Mycobacterium phage Methuselah, complete genome 18815-18847 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MG925341 Mycobacteriophage EpicPhail, complete genome 18732-18764 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KX808129 Mycobacterium phage Sabinator, complete genome 18730-18762 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MK359341 Mycobacterium phage GingkoMaracino, complete genome 18618-18650 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 JF704114 Mycobacterium phage Vix, complete genome 18814-18846 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MK279913 Mycobacterium phage PotatoSplit, complete genome 18732-18764 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MG757161 Mycobacterium phage LugYA, complete genome 18732-18764 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MF185729 Mycobacterium phage KADY, complete genome 18816-18848 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MN096368 Mycobacterium phage Soshari, complete genome 18815-18847 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH536825 Mycobacterium phage Ollie, complete genome 18602-18634 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH020238 Mycobacterium phage Lilith, complete genome 18725-18757 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH077583 Mycobacterium phage PGHhamlin, complete genome 18724-18756 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MT897907 Mycobacterium phage Grif, complete genome 18815-18847 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NC_004682 Mycobacterium virus Bxz2, complete genome 18826-18858 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MK433273 Mycobacterium phage Daishi, complete genome 17657-17689 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH155864 Mycobacterium phage Beauxregard13, complete genome 18732-18764 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH727554 Mycobacterium phage MuchMore, complete genome 18724-18756 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH338240 Mycobacterium phage Sabia, complete genome 18725-18757 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MN813699 Mycobacterium phage P28Green, complete genome 18733-18765 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KM233455 Mycobacterium phage Farber, complete genome 18725-18757 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KX670788 Mycobacterium phage Louie6, complete genome 18819-18851 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MN585984 Mycobacterium phage AgronaGT15, complete genome 18640-18672 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 HM755814 Mycobacterium phage Wonder, complete genome 18181-18213 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KU578077 Mycobacterium phage Marie, complete genome 18731-18763 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KT381277 Mycobacterium phage Wooldri, complete genome 18643-18675 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH513975 Mycobacterium phage Misomonster, complete genome 18815-18847 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MK875800 Mycobacterium phage MoneyMay, complete genome 18731-18763 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KX664448 Mycobacterium phage Watson, complete genome 18724-18756 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KX507362 Mycobacterium phage Aglet, complete genome 18733-18765 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MN586048 Mycobacterium phage Fernando, complete genome 18731-18763 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KU985091 Mycobacterium phage Hercules11, complete genome 18739-18771 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NC_042310 Mycobacterium virus JHC117, complete genome 18730-18762 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH576949 Mycobacterium phage BreSam8, complete genome 18725-18757 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KP027202 Mycobacterium phage Taurus, complete genome 18731-18763 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH399776 Mycobacterium phage Grum1, complete genome 18725-18757 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MN585969 Mycobacterium phage Dieselweasel, complete genome 18733-18765 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KU255188 Mycobacterium phage JenCasNa, complete genome 18731-18763 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KX458237 Mycobacterium phage Penny1, complete genome 18732-18764 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KP017310 Mycobacterium phage Phoxy, complete genome 18816-18848 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NC_021535 Mycobacterium phage Jobu08, complete genome 18804-18836 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH536813 Mycobacterium phage AugsMagnumOpus, complete genome 18724-18756 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MF185733 Mycobacterium phage StepMih, complete genome 18725-18757 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MF185732 Mycobacterium phage Stagni, complete genome 18734-18766 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MK494096 Mycobacterium phage Mainiac, complete genome 18725-18757 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KU984914 Mycobacterium phage Malinsilva, complete genome 18724-18756 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 JF704101 Mycobacterium virus Microwolf, complete genome 18733-18765 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NC_028757 Mycobacterium phage Tiffany, complete genome 18626-18658 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MN062718 Mycobacterium phage SoilDragon, complete genome 18420-18452 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KT359365 Mycobacterium phage DaHudson, complete genome 18724-18756 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 MH651179 Mycobacterium phage MadMarie, complete genome 18734-18766 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KP017311 Mycobacterium phage Spike509, complete genome 18816-18848 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 KF279418 Mycobacterium phage Anubis, complete genome 18618-18650 9 0.727
CP023865_2 2.1|229332|33|CP023865|CRT 229332-229364 33 NC_028798 Mycobacterium phage MarQuardt, complete genome 18733-18765 9 0.727
CP023865_2 2.2|229383|39|CP023865|CRT 229383-229421 39 NZ_CP019193 Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 plasmid pATCC10717, complete sequence 124057-124095 9 0.769
CP023865_2 2.4|229500|33|CP023865|CRT 229500-229532 33 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 370242-370274 9 0.727
CP023865_2 2.4|229500|33|CP023865|CRT 229500-229532 33 NZ_CP017944 Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence 160998-161030 9 0.727
CP023865_2 2.4|229500|33|CP023865|CRT 229500-229532 33 NZ_CP023740 Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence 59188-59220 9 0.727
CP023865_9 9.1|1545764|32|CP023865|CRISPRCasFinder 1545764-1545795 32 MH727546 Mycobacterium phage Eaglehorse, complete genome 63306-63337 9 0.719
CP023865_15 15.2|2878764|37|CP023865|CRISPRCasFinder 2878764-2878800 37 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 182307-182343 9 0.757
CP023865_25 25.1|4810356|33|CP023865|CRISPRCasFinder 4810356-4810388 33 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 15811-15843 9 0.727
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP027794 Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence 42815-42846 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1608211-1608242 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 508799-508830 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 34700-34731 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 167805-167836 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_MF600313 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence 53585-53616 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 KY971609 Pseudomonas phage PspYZU01, complete genome 2297-2328 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_015377 Burkholderia gladioli BSR3 plasmid bgla_2p, complete sequence 9521-9552 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 9848-9879 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_004041 Rhizobium etli CFN 42 plasmid p42d, complete sequence 30724-30755 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 357197-357228 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP021027 Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence 47978-48009 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013633 Rhizobium sp. N324 plasmid pRspN324c, complete sequence 58319-58350 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 33268-33299 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 51538-51569 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013561 Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence 50611-50642 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013550 Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence 49063-49094 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013530 Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence 49064-49095 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP018385 Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence 22880-22911 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 49063-49094 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013540 Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence 67834-67865 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 2062-2093 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 351272-351303 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 51462-51493 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013583 Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence 49064-49095 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 51538-51569 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 51539-51570 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP021125 Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence 59386-59417 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 51537-51568 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013514 Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence 50610-50641 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 51537-51568 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 72056-72087 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 51462-51493 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 55748-55779 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 49304-49335 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP013604 Rhizobium sp. N731 plasmid pRspN731c, complete sequence 50610-50641 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 46943-46974 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 6374-6405 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 CP003955 Rhodococcus opacus PD630 plasmid 6, complete sequence 27778-27809 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 MN234183 Mycobacterium phage Antsirabe, complete genome 25978-26009 9 0.719
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 MT536174 Stenotrophomonas phage vB_SmaS-AXL_3, complete genome 5550-5581 9 0.719
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NZ_CP034366 Pantoea sp. CCBC3-3-1 plasmid unnamed3, complete sequence 22945-22976 9 0.719
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NZ_CP048816 Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed 170514-170545 9 0.719
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 296046-296077 9 0.719
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 3012-3043 9 0.719
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 898812-898843 9 0.719
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 551001-551032 9 0.719
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 686522-686553 9 0.719
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 528457-528488 9 0.719
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 1074541-1074572 9 0.719
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP049734 Rhizobium leguminosarum strain A1 plasmid unnamed1, complete sequence 27678-27709 9 0.719
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 CP049734 Rhizobium leguminosarum strain A1 plasmid pRLa11, complete sequence 144917-144948 9 0.719
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP054024 Rhizobium sp. JKLM12A2 plasmid pPR12A203, complete sequence 181315-181346 9 0.719
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP054030 Rhizobium sp. JKLM19E plasmid pPR19E03 225640-225671 9 0.719
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP054035 Rhizobium sp. JKLM13E plasmid pPR13E04, complete sequence 306968-306999 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP043960 Streptomyces tendae strain 139 plasmid unnamed1, complete sequence 301317-301348 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 200650-200681 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 154726-154757 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 588615-588646 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 48900-48931 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2281866-2281897 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 67869-67900 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 LR606151 Rhizobium sp. Q54 genome assembly, plasmid: 8 130441-130472 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NC_009339 Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence 243473-243504 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_LR723678 Arsenite-oxidising bacterium NT-25 plasmid 2 65472-65503 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP024896 Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence 48159-48190 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP025432 Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence 172947-172978 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP020812 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed3, complete sequence 70019-70050 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_FO082821 Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence 146693-146724 9 0.719
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 AP014497 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C71-MedDCM-OCT-S32-C181, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces 2873-2904 9 0.719
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 NC_027296 Rhizobium phage RHEph06, complete genome 40968-40999 9 0.719
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 JX483877 Rhizobium phage RHEph05, complete genome 38152-38183 9 0.719
CP023865_33 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR 6446963-6446994 32 JX483876 Rhizobium phage RHEph04, complete genome 40475-40506 9 0.719
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MT498041 Mycobacterium phage KingCyrus, complete genome 41670-41702 9 0.727
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 KU985095 Mycobacterium phage ChipMunk, complete genome 41674-41706 9 0.727
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 KU985093 Mycobacterium phage EvilGenius, complete genome 41675-41707 9 0.727
CP023865_33 33.13|6447086|31|CP023865|CRISPRCasFinder 6447086-6447116 31 LR745207 uncultured phage genome assembly, chromosome: 1 83346-83376 9 0.71
CP023865_33 33.14|6447146|32|CP023865|CRISPRCasFinder 6447146-6447177 32 NZ_CP024426 Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence 168518-168549 9 0.719
CP023865_33 33.14|6447146|32|CP023865|CRISPRCasFinder 6447146-6447177 32 NZ_CP020445 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence 108134-108165 9 0.719
CP023865_33 33.14|6447146|32|CP023865|CRISPRCasFinder 6447146-6447177 32 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 122170-122201 9 0.719
CP023865_33 33.14|6447146|32|CP023865|CRISPRCasFinder 6447146-6447177 32 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 299176-299207 9 0.719
CP023865_33 33.16|6447268|32|CP023865|CRISPRCasFinder,PILER-CR 6447268-6447299 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 33530-33561 9 0.719
CP023865_33 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR 6447512-6447543 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 720910-720941 9 0.719
CP023865_33 33.21|6447573|32|CP023865|CRISPRCasFinder,PILER-CR 6447573-6447604 32 NZ_CP030842 Acidisarcina polymorpha strain SBC82 plasmid pACPOL2, complete sequence 23452-23483 9 0.719
CP023865_33 33.21|6447573|32|CP023865|CRISPRCasFinder,PILER-CR 6447573-6447604 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1232660-1232691 9 0.719
CP023865_33 33.22|6447634|32|CP023865|CRISPRCasFinder,PILER-CR 6447634-6447665 32 NZ_CP034471 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_2, complete sequence 139415-139446 9 0.719
CP023865_33 33.22|6447634|32|CP023865|CRISPRCasFinder,PILER-CR 6447634-6447665 32 NZ_CP034476 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_2, complete sequence 56392-56423 9 0.719
CP023865_33 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR 6447756-6447787 32 KT381879 Caulobacter phage Percy, complete genome 11532-11563 9 0.719
CP023865_33 33.27|6447940|32|CP023865|CRISPRCasFinder,PILER-CR 6447940-6447971 32 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 285658-285689 9 0.719
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 278133-278164 9 0.719
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_015724 Cupriavidus necator N-1 plasmid pBB2, complete sequence 108411-108442 9 0.719
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 263747-263778 9 0.719
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 NZ_CP048425 Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence 223280-223311 9 0.719
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 NZ_CP022370 Bosea sp. AS-1 plasmid unnamed1, complete sequence 120622-120653 9 0.719
CP023865_33 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR 6448611-6448642 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 138779-138810 9 0.719
CP023865_33 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR 6448611-6448642 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 135270-135301 9 0.719
CP023865_33 33.39|6448672|32|CP023865|CRISPRCasFinder,PILER-CR 6448672-6448703 32 MT639646 Microbacterium phage Rasputia, complete genome 66062-66093 9 0.719
CP023865_33 33.40|6448733|32|CP023865|CRISPRCasFinder,PILER-CR 6448733-6448764 32 MT639646 Microbacterium phage Rasputia, complete genome 66062-66093 9 0.719
CP023865_33 33.41|6448794|32|CP023865|CRISPRCasFinder,PILER-CR 6448794-6448825 32 NC_007960 Nitrobacter hamburgensis X14 plasmid 2, complete sequence 33031-33062 9 0.719
CP023865_33 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR 6448916-6448947 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 392199-392230 9 0.719
CP023865_33 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR 6448916-6448947 32 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 278017-278048 9 0.719
CP023865_33 33.44|6448977|33|CP023865|CRISPRCasFinder,PILER-CR 6448977-6449009 33 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 475086-475118 9 0.727
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NC_014035 Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence 3745-3776 9 0.719
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 466186-466217 9 0.719
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP028352 Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence 41036-41067 9 0.719
CP023865_34 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT 6458875-6458906 32 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 16477-16508 9 0.719
CP023865_34 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT 6458875-6458906 32 NZ_CP011046 Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI3, complete sequence 6784-6815 9 0.719
CP023865_34 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT 6458875-6458906 32 NZ_CP021037 Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI3, complete sequence 6784-6815 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2371665-2371696 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 117693-117724 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 372255-372286 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_LR134470 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 28, complete sequence 54395-54426 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 5407-5438 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 311436-311467 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 428646-428677 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 126408-126439 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MN703413 Arthrobacter phage Powerpuff, complete genome 13626-13657 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MT024869 Arthrobacter phage Lego, complete genome 13575-13606 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MT024871 Arthrobacter phage YesChef, complete genome 13626-13657 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NC_031004 Gordonia phage Nyceirae, complete genome 10208-10239 9 0.719
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 26611-26642 9 0.719
CP023865_34 34.10|6459182|32|CP023865|CRISPRCasFinder,CRT 6459182-6459213 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 275847-275878 9 0.719
CP023865_34 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT 6459365-6459396 32 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 799304-799335 9 0.719
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 114865-114896 9 0.719
CP023865_34 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT 6459732-6459763 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 219854-219885 9 0.719
CP023865_34 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT 6459732-6459763 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 140015-140046 9 0.719
CP023865_34 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT 6459854-6459885 32 NZ_CP014675 Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence 8580-8611 9 0.719
CP023865_34 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT 6459854-6459885 32 NZ_LT900339 Gluconobacter oxydans 621H isolate WT-DSMZ plasmid 2 149411-149442 9 0.719
CP023865_34 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT 6459854-6459885 32 NC_006672 Gluconobacter oxydans 621H plasmid pGOX1, complete sequence 149408-149439 9 0.719
CP023865_34 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT 6459854-6459885 32 NZ_CP015167 Acetobacter ascendens strain LMG 1590 plasmid unnamed3, complete sequence 40881-40912 9 0.719
CP023865_34 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT 6459854-6459885 32 NZ_CP043044 Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence 109963-109994 9 0.719
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 85002-85033 9 0.719
CP023865_34 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT 6459976-6460007 32 KY676784 Streptomyces phage ToastyFinz, complete genome 1509-1540 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_015724 Cupriavidus necator N-1 plasmid pBB2, complete sequence 371648-371679 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 129427-129458 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NZ_KT070138 Klebsiella pneumoniae strain KP01 plasmid pGES-GZ, complete sequence 3965-3996 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 529885-529916 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NZ_CP013513 Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence 326238-326269 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NZ_CP013603 Rhizobium sp. N731 plasmid pRspN731b, complete sequence 326238-326269 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MK977714 Corynebacterium phage Bran, complete genome 23643-23674 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MH651167 Gordonia phage Angelique, complete genome 21882-21913 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_048780 Corynebacterium phage StAB, complete genome 23652-23683 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 EF579802 Microbacterium phage Min1, complete genome 17435-17466 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MH926061 Corynebacterium phage Troy, complete genome 23217-23248 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_048069 Corynebacterium phage SamW, complete genome 23217-23248 9 0.719
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_048790 Corynebacterium phage Lederberg, complete genome 23602-23633 9 0.719
CP023865_34 34.26|6460159|32|CP023865|CRISPRCasFinder,CRT 6460159-6460190 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 423262-423293 9 0.719
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 645045-645076 9 0.719
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 256477-256508 9 0.719
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 547608-547639 9 0.719
CP023865_34 34.29|6460342|32|CP023865|CRISPRCasFinder,CRT 6460342-6460373 32 NZ_CP010386 Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence 67870-67901 9 0.719
CP023865_34 34.29|6460342|32|CP023865|CRISPRCasFinder,CRT 6460342-6460373 32 NZ_CP042485 Klebsiella pneumoniae strain C51 plasmid pC51_004 5468-5499 9 0.719
CP023865_34 34.29|6460342|32|CP023865|CRISPRCasFinder,CRT 6460342-6460373 32 NZ_CP022425 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF2, complete sequence 31883-31914 9 0.719
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 112298-112329 9 0.719
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NZ_CP010991 Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence 105447-105478 9 0.719
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 326935-326966 9 0.719
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 717010-717041 9 0.719
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 118489-118520 9 0.719
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 760-791 9 0.719
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 106049-106080 9 0.719
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NC_013531 Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence 15416-15447 9 0.719
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 849-880 9 0.719
CP023865_34 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460525-6460556 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1788232-1788263 9 0.719
CP023865_34 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460525-6460556 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1839071-1839102 9 0.719
CP023865_34 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460525-6460556 32 MF324911 Mycobacterium phage SirPhilip, complete genome 59942-59973 9 0.719
CP023865_34 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460586-6460618 33 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 26727-26759 9 0.727
CP023865_34 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460648-6460679 32 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 101547-101578 9 0.719
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 136627-136658 9 0.719
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1348106-1348137 9 0.719
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 563585-563616 9 0.719
CP023865_34 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT 6460892-6460923 32 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 329064-329095 9 0.719
CP023865_34 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT 6460892-6460923 32 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 326250-326281 9 0.719
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2976598-2976629 9 0.719
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 386464-386495 9 0.719
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_LN832561 Paracoccus aminovorans isolate JCM7685 plasmid III, complete sequence 3904-3935 9 0.719
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1311759-1311790 9 0.719
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 501775-501806 9 0.719
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 310589-310620 9 0.719
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 448-479 9 0.719
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 153587-153618 9 0.719
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 637256-637287 9 0.719
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 241754-241785 9 0.719
CP023865_34 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT 6461258-6461290 33 NZ_CP015585 Roseomonas gilardii strain U14-5 plasmid 1, complete sequence 11461-11493 9 0.727
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1212159-1212190 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 899698-899729 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 948400-948431 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1212301-1212332 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 948361-948392 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 708485-708516 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1185955-1185986 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 948407-948438 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1211873-1211904 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1211817-1211848 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 940873-940904 9 0.719
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 700449-700480 9 0.719
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 887066-887097 9 0.719
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 706542-706573 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 266133-266164 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 269086-269117 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 550871-550902 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 354553-354584 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 87702-87733 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 64220-64251 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 238619-238650 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 809991-810022 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP050118 Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence 166350-166381 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1328562-1328593 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1199009-1199040 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 561207-561238 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP050122 Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence 110849-110880 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1258712-1258743 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_000958 Deinococcus radiodurans R1 plasmid MP1, complete sequence 35480-35511 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1198106-1198137 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1532404-1532435 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1231034-1231065 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1231025-1231056 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1199001-1199032 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1198357-1198388 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1198992-1199023 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 545880-545911 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 138883-138914 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1348599-1348630 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1503961-1503992 9 0.719
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP031502 Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence 121411-121442 9 0.719
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 67931-67962 9 0.719
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 474333-474364 9 0.719
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 KR827394 Uncultured bacterium plasmid pKAZ5, complete sequence 144377-144408 9 0.719
CP023865_34 34.51|6461687|32|CP023865|CRISPRCasFinder,CRT 6461687-6461718 32 MN284895 Mycobacterium phage Marshawn, complete genome 56234-56265 9 0.719
CP023865_34 34.54|6460897|32|CP023865|PILER-CR 6460897-6460928 32 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 329064-329095 9 0.719
CP023865_34 34.54|6460897|32|CP023865|PILER-CR 6460897-6460928 32 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 326250-326281 9 0.719
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2976598-2976629 9 0.719
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 386464-386495 9 0.719
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_LN832561 Paracoccus aminovorans isolate JCM7685 plasmid III, complete sequence 3904-3935 9 0.719
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1311759-1311790 9 0.719
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 501775-501806 9 0.719
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 310589-310620 9 0.719
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 448-479 9 0.719
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 153587-153618 9 0.719
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 637256-637287 9 0.719
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 241754-241785 9 0.719
CP023865_34 34.60|6461263|33|CP023865|PILER-CR 6461263-6461295 33 NZ_CP015585 Roseomonas gilardii strain U14-5 plasmid 1, complete sequence 11461-11493 9 0.727
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1212159-1212190 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 899698-899729 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 948400-948431 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1212301-1212332 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 948361-948392 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 708485-708516 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1185955-1185986 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 948407-948438 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1211873-1211904 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1211817-1211848 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 940873-940904 9 0.719
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 700449-700480 9 0.719
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 887066-887097 9 0.719
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 706542-706573 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 266133-266164 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 269086-269117 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 550871-550902 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 354553-354584 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 87702-87733 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 64220-64251 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 238619-238650 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 809991-810022 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP050118 Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence 166350-166381 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1328562-1328593 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1199009-1199040 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 561207-561238 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP050122 Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence 110849-110880 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1258712-1258743 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_000958 Deinococcus radiodurans R1 plasmid MP1, complete sequence 35480-35511 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1198106-1198137 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1532404-1532435 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1231034-1231065 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1231025-1231056 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1199001-1199032 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1198357-1198388 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1198992-1199023 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 545880-545911 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 138883-138914 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1348599-1348630 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1503961-1503992 9 0.719
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP031502 Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence 121411-121442 9 0.719
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 67931-67962 9 0.719
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 474333-474364 9 0.719
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 KR827394 Uncultured bacterium plasmid pKAZ5, complete sequence 144377-144408 9 0.719
CP023865_34 34.67|6461692|32|CP023865|PILER-CR 6461692-6461723 32 MN284895 Mycobacterium phage Marshawn, complete genome 56234-56265 9 0.719
CP023865_28 28.1|6064595|31|CP023865|CRISPRCasFinder 6064595-6064625 31 MK799832 Synechococcus phage S-B05, complete genome 57428-57458 10 0.677
CP023865_28 28.1|6064595|31|CP023865|CRISPRCasFinder 6064595-6064625 31 MN018232 Synechococcus phage S-B43, complete genome 5230-5260 10 0.677
CP023865_28 28.1|6064595|31|CP023865|CRISPRCasFinder 6064595-6064625 31 MH920637 Synechoccus phage S-B43, partial genome 5230-5260 10 0.677
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 720646-720677 10 0.688
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 408103-408134 10 0.688
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1638460-1638491 10 0.688
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_AP014708 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence 39066-39097 10 0.688
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 183338-183369 10 0.688
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 481942-481973 10 0.688
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NC_009507 Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence 13501-13532 10 0.688
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 748225-748256 10 0.688
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NC_010070 Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence 65181-65212 10 0.688
CP023865_33 33.4|6446536|32|CP023865|CRISPRCasFinder 6446536-6446567 32 NC_010802 Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence 48274-48305 10 0.688
CP023865_33 33.5|6446597|32|CP023865|CRISPRCasFinder,PILER-CR 6446597-6446628 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 218194-218225 10 0.688
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 392544-392575 10 0.688
CP023865_33 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR 6446719-6446750 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1185834-1185865 10 0.688
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 660754-660785 10 0.688
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 610780-610811 10 0.688
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 669196-669227 10 0.688
CP023865_33 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR 6446841-6446872 32 NC_019220 Burkholderia pseudomallei plasmid pPHB194, complete sequence 638-669 10 0.688
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 63275-63307 10 0.697
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 NZ_CP037921 Hymenobacter sp. 17J36-26 plasmid unnamed1, complete sequence 164769-164801 10 0.697
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MF919500 Mycobacterium phage Dalmatian, complete genome 40273-40305 10 0.697
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MK524491 Mycobacterium phage Whabigail7, complete genome 40343-40375 10 0.697
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MN585983 Mycobacterium phage Retro23, complete genome 40293-40325 10 0.697
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 MF919490 Mycobacterium phage Anselm, complete genome 40300-40332 10 0.697
CP023865_33 33.12|6447024|33|CP023865|CRISPRCasFinder 6447024-6447056 33 KX576639 Mycobacterium phage DudeLittle, complete genome 40039-40071 10 0.697
CP023865_33 33.14|6447146|32|CP023865|CRISPRCasFinder 6447146-6447177 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2651858-2651889 10 0.688
CP023865_33 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR 6447756-6447787 32 KX507344 Streptomyces phage Godpower, complete genome 27309-27340 10 0.688
CP023865_33 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR 6447878-6447910 33 NZ_CP023993 Streptomyces malaysiensis strain DSM 4137 plasmid unnamed, complete sequence 28516-28548 10 0.697
CP023865_33 33.29|6448062|32|CP023865|CRISPRCasFinder,PILER-CR 6448062-6448093 32 MK511056 Pseudomonas phage BR293, partial genome 14519-14550 10 0.688
CP023865_33 33.29|6448062|32|CP023865|CRISPRCasFinder,PILER-CR 6448062-6448093 32 MK511055 Pseudomonas phage BR204, partial genome 14531-14562 10 0.688
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 255736-255767 10 0.688
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 304522-304553 10 0.688
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 NZ_CP031468 Paraburkholderia caffeinilytica strain CF1 plasmid p1, complete sequence 19328-19359 10 0.688
CP023865_33 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR 6448184-6448215 32 MN369758 Gordonia phage NHagos, complete genome 33845-33876 10 0.688
CP023865_33 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR 6448306-6448337 32 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 69925-69956 10 0.688
CP023865_33 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR 6448428-6448459 32 MT553347 Mycobacterium phage Awesomesauce, complete genome 41538-41569 10 0.688
CP023865_33 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR 6448428-6448459 32 MK977707 Mycobacterium phage LilSpotty, complete genome 40246-40277 10 0.688
CP023865_33 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR 6448428-6448459 32 MH020243 Mycobacterium phage TootsiePop, complete genome 41543-41574 10 0.688
CP023865_33 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR 6448428-6448459 32 MH020242 Mycobacterium phage Misha28, complete genome 41543-41574 10 0.688
CP023865_33 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR 6448428-6448459 32 MK494120 Mycobacterium phage Piper2020, complete genome 42438-42469 10 0.688
CP023865_33 33.37|6448550|32|CP023865|CRISPRCasFinder,PILER-CR 6448550-6448581 32 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 36043-36074 10 0.688
CP023865_33 33.41|6448794|32|CP023865|CRISPRCasFinder,PILER-CR 6448794-6448825 32 MK962628 Achromobacter phage vB_AxyP_19-32_Axy09, complete genome 7388-7419 10 0.688
CP023865_33 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR 6449039-6449070 32 NC_015169 Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence 295733-295764 10 0.688
CP023865_33 33.65|6447512|39|CP023865|CRT 6447512-6447550 39 NZ_CP009295 Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence 37331-37369 10 0.744
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP012641 Massilia sp. WG5 plasmid unnamed 1, complete sequence 76035-76066 10 0.688
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 531515-531546 10 0.688
CP023865_34 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT 6458875-6458906 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 220428-220459 10 0.688
CP023865_34 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT 6458875-6458906 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 242178-242209 10 0.688
CP023865_34 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT 6458875-6458906 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 79409-79440 10 0.688
CP023865_34 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT 6458875-6458906 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 137964-137995 10 0.688
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP046258 Gordonia sp. 135 plasmid pG135, complete sequence 57173-57204 10 0.688
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 75510-75541 10 0.688
CP023865_34 34.8|6459059|33|CP023865|CRISPRCasFinder,CRT 6459059-6459091 33 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 27479-27511 10 0.697
CP023865_34 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT 6459121-6459152 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 559387-559418 10 0.688
CP023865_34 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT 6459121-6459152 32 NZ_CP045385 Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence 745628-745659 10 0.688
CP023865_34 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT 6459365-6459396 32 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 159088-159119 10 0.688
CP023865_34 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT 6459732-6459763 32 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 146407-146438 10 0.688
CP023865_34 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT 6459732-6459763 32 NC_007491 Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence 149118-149149 10 0.688
CP023865_34 34.20|6459793|32|CP023865|CRISPRCasFinder,CRT 6459793-6459824 32 NZ_CP006370 Aureimonas sp. AU20 plasmid pAU20c, complete sequence 267200-267231 10 0.688
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 572966-572997 10 0.688
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 MK977706 Corynebacterium phage Dina, complete genome 23478-23509 10 0.688
CP023865_34 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT 6460098-6460129 32 NC_048789 Corynebacterium phage Stiles, complete genome 23207-23238 10 0.688
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1882158-1882189 10 0.688
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1745145-1745176 10 0.688
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 622246-622277 10 0.688
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 964030-964061 10 0.688
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 683453-683484 10 0.688
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 268654-268685 10 0.688
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 429905-429936 10 0.688
CP023865_34 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT 6460281-6460312 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 163088-163119 10 0.688
CP023865_34 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT 6460403-6460434 32 MT310898 Streptomyces phage Kela, complete genome 73786-73817 10 0.688
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 984674-984705 10 0.688
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 95565-95596 10 0.688
CP023865_34 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460464-6460495 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 269335-269366 10 0.688
CP023865_34 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460525-6460556 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 538677-538708 10 0.688
CP023865_34 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460525-6460556 32 NC_042014 Arthrobacter phage Piccoletto, complete genome 47707-47738 10 0.688
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP015092 Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence 71755-71786 10 0.688
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP049815 Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence 106949-106980 10 0.688
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP010861 Marinovum algicola DG 898 plasmid pMaD6, complete sequence 90839-90870 10 0.688
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP045320 Roseivivax sp. THAF197b plasmid pTHAF197b_b, complete sequence 84138-84169 10 0.688
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP030100 Roseovarius sp. AK1035 plasmid unnamed, complete sequence 78328-78359 10 0.688
CP023865_34 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR 6460709-6460740 32 NZ_CP020475 Roseovarius mucosus strain SMR3 plasmid pSMR3-1, complete sequence 18333-18364 10 0.688
CP023865_34 34.37|6460833|30|CP023865|CRISPRCasFinder,CRT 6460833-6460862 30 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 227379-227408 10 0.667
CP023865_34 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT 6461197-6461228 32 MN746332 Rauchvirus SR18, complete genome 34662-34693 10 0.688
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1487024-1487055 10 0.688
CP023865_34 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT 6461382-6461413 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2432065-2432096 10 0.688
CP023865_34 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT 6461443-6461474 32 MT104122 Sporosarcina phage Lietuvens, complete genome 33150-33181 10 0.688
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 45878-45909 10 0.688
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1977592-1977623 10 0.688
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 25323-25354 10 0.688
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 25323-25354 10 0.688
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 45548-45579 10 0.688
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP049749 Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence 102073-102104 10 0.688
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 114719-114750 10 0.688
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP048421 Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence 97369-97400 10 0.688
CP023865_34 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT 6461626-6461657 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1023220-1023251 10 0.688
CP023865_34 34.53|6460838|30|CP023865|PILER-CR 6460838-6460867 30 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 227379-227408 10 0.667
CP023865_34 34.59|6461202|32|CP023865|PILER-CR 6461202-6461233 32 MN746332 Rauchvirus SR18, complete genome 34662-34693 10 0.688
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1487024-1487055 10 0.688
CP023865_34 34.62|6461387|32|CP023865|PILER-CR 6461387-6461418 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2432065-2432096 10 0.688
CP023865_34 34.63|6461448|32|CP023865|PILER-CR 6461448-6461479 32 MT104122 Sporosarcina phage Lietuvens, complete genome 33150-33181 10 0.688
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 45878-45909 10 0.688
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1977592-1977623 10 0.688
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 25323-25354 10 0.688
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 25323-25354 10 0.688
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 45548-45579 10 0.688
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP049749 Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence 102073-102104 10 0.688
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 114719-114750 10 0.688
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP048421 Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence 97369-97400 10 0.688
CP023865_34 34.66|6461631|32|CP023865|PILER-CR 6461631-6461662 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1023220-1023251 10 0.688
CP023865_33 33.5|6446597|32|CP023865|CRISPRCasFinder,PILER-CR 6446597-6446628 32 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 386914-386945 11 0.656
CP023865_33 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR 6447512-6447543 32 KT887559 Pseudomonas phage phi3, complete genome 6726-6757 11 0.656
CP023865_33 33.27|6447940|32|CP023865|CRISPRCasFinder,PILER-CR 6447940-6447971 32 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 581530-581561 11 0.656
CP023865_33 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR 6449039-6449070 32 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 75522-75553 11 0.656
CP023865_33 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR 6449039-6449070 32 NC_047751 Ralstonia phage phiITL-1, complete genome 18845-18876 11 0.656
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 253714-253745 11 0.656
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 193467-193498 11 0.656
CP023865_34 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT 6458753-6458784 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 13543-13574 11 0.656
CP023865_34 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT 6458936-6458967 32 NZ_CP044550 Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence 275677-275708 11 0.656
CP023865_34 34.17|6459610|32|CP023865|CRISPRCasFinder,CRT 6459610-6459641 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1014078-1014109 11 0.656
CP023865_34 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT 6459671-6459702 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 515621-515652 11 0.656
CP023865_34 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT 6460892-6460923 32 MK962641 Achromobacter phage vB_AxyP_19-32_Axy24, complete genome 23210-23241 11 0.656
CP023865_34 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT 6460892-6460923 32 MK962626 Achromobacter phage vB_AxyP_19-32_Axy04, complete genome 22333-22364 11 0.656
CP023865_34 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT 6460892-6460923 32 MK962631 Achromobacter phage vB_AxyP_19-32_Axy12, complete genome 23284-23315 11 0.656
CP023865_34 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT 6460892-6460923 32 KT321317 Achromobacter phage phiAxp-3, complete genome 21855-21886 11 0.656
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 276393-276424 11 0.656
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 292345-292376 11 0.656
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NZ_CP013550 Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence 267771-267802 11 0.656
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 267771-267802 11 0.656
CP023865_34 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT 6461014-6461045 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 267072-267103 11 0.656
CP023865_34 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT 6461075-6461106 32 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 63592-63623 11 0.656
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 MN657143 Planococcus sp. (in: Bacteria) strain ANT_H26 plasmid pA26H3, complete sequence 7224-7255 11 0.656
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 NZ_CP013660 Planococcus kocurii strain ATCC 43650 plasmid unnamed, complete sequence 6423-6454 11 0.656
CP023865_34 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT 6461504-6461535 32 MN033734 Leviviridae sp. isolate H1_Bulk_29_scaffold_203 RNA-dependent RNA polymerase (H1Bulk29203_000001) gene, partial cds; and hypothetical protein (H1Bulk29203_000002) and hypothetical protein (H1Bulk29203_000003) genes, complete cds 2519-2550 11 0.656
CP023865_34 34.54|6460897|32|CP023865|PILER-CR 6460897-6460928 32 MK962641 Achromobacter phage vB_AxyP_19-32_Axy24, complete genome 23210-23241 11 0.656
CP023865_34 34.54|6460897|32|CP023865|PILER-CR 6460897-6460928 32 MK962626 Achromobacter phage vB_AxyP_19-32_Axy04, complete genome 22333-22364 11 0.656
CP023865_34 34.54|6460897|32|CP023865|PILER-CR 6460897-6460928 32 MK962631 Achromobacter phage vB_AxyP_19-32_Axy12, complete genome 23284-23315 11 0.656
CP023865_34 34.54|6460897|32|CP023865|PILER-CR 6460897-6460928 32 KT321317 Achromobacter phage phiAxp-3, complete genome 21855-21886 11 0.656
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 276393-276424 11 0.656
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 292345-292376 11 0.656
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NZ_CP013550 Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence 267771-267802 11 0.656
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 267771-267802 11 0.656
CP023865_34 34.56|6461019|32|CP023865|PILER-CR 6461019-6461050 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 267072-267103 11 0.656
CP023865_34 34.57|6461080|32|CP023865|PILER-CR 6461080-6461111 32 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 63592-63623 11 0.656
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 MN657143 Planococcus sp. (in: Bacteria) strain ANT_H26 plasmid pA26H3, complete sequence 7224-7255 11 0.656
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 NZ_CP013660 Planococcus kocurii strain ATCC 43650 plasmid unnamed, complete sequence 6423-6454 11 0.656
CP023865_34 34.64|6461509|32|CP023865|PILER-CR 6461509-6461540 32 MN033734 Leviviridae sp. isolate H1_Bulk_29_scaffold_203 RNA-dependent RNA polymerase (H1Bulk29203_000001) gene, partial cds; and hypothetical protein (H1Bulk29203_000002) and hypothetical protein (H1Bulk29203_000003) genes, complete cds 2519-2550 11 0.656
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1626410-1626441 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1387622-1387653 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 933526-933557 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1242261-1242292 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 576174-576205 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1328670-1328701 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1498250-1498281 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1243291-1243322 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1248297-1248328 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1245034-1245065 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1777954-1777985 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1214021-1214052 16 0.5
CP023865_33 33.2|6446406|32|CP023865|CRISPRCasFinder 6446406-6446437 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 744472-744503 16 0.5

1. spacer 3.2|596477|19|CP023865|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggcccggacgtg	Protospacer
*******************

2. spacer 3.3|596519|19|CP023865|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

cggcctgggcccggacgtg	CRISPR spacer
cggcctgggcccggacgtg	Protospacer
*******************

3. spacer 11.1|2327176|22|CP023865|CRT matches to NZ_CP039924 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence) position: , mismatch: 2, identity: 0.909 

gcgggcgtggcgccgtgacggg	CRISPR spacer
ccgggcgtggcgcggtgacggg	Protospacer
 ************ ********

4. spacer 11.4|2327305|22|CP023865|CRT matches to LN713926 (Pseudomonas fluorescens SBW25 plasmid pQBR57, complete sequence) position: , mismatch: 2, identity: 0.909 

gcgggcgtggcgccgtgaccga	CRISPR spacer
gcgggcgtggcgccttgaccgc	Protospacer
************** ******

5. spacer 11.5|2327347|22|CP023865|CRT matches to NZ_CP013108 (Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909 

cccggcgtggcgccgtgaccgg	CRISPR spacer
cccggcgcggcgccgtgaccga	Protospacer
*******.*************.

6. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.92 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggtgtcgggcgccgtggcgac	Protospacer
******.****************.*

7. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcgacgcgcgccgtggcggc	Protospacer
******** ** *************

8. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH171094 (Streptomyces phage Nabi, complete genome) position: , mismatch: 2, identity: 0.938 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgg	Protospacer
** ***********.*****************

9. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK433276 (Streptomyces phage Asten, complete genome) position: , mismatch: 2, identity: 0.938 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgg	Protospacer
** ***********.*****************

10. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN096373 (Streptomyces phage TuanPN, complete genome) position: , mismatch: 2, identity: 0.938 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
aggtgggcgtacagcgtgttcgccgtcttcgg	Protospacer
** *********** *****************

11. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN284899 (Streptomyces phage Whatever, complete genome) position: , mismatch: 2, identity: 0.938 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgg	Protospacer
** ***********.*****************

12. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to KX507343 (Streptomyces phage Lorelei, complete genome) position: , mismatch: 2, identity: 0.938 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgg	Protospacer
** ***********.*****************

13. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN096379 (Streptomyces phage Yasdnil, complete genome) position: , mismatch: 2, identity: 0.938 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
aggtgggcgtacagcgtgttcgccgtcttcgg	Protospacer
** *********** *****************

14. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH171093 (Streptomyces phage Rana, complete genome) position: , mismatch: 2, identity: 0.938 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgg	Protospacer
** ***********.*****************

15. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG757163 (Streptomyces phage OzzyJ, complete genome) position: , mismatch: 2, identity: 0.938 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgg	Protospacer
** ***********.*****************

16. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH171095 (Streptomyces phage Maneekul, complete genome) position: , mismatch: 2, identity: 0.938 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
aggtgggcgtacagcgtgttcgccgtcttcgg	Protospacer
** *********** *****************

17. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP010859 (Marinovum algicola DG 898 plasmid pMaD4, complete sequence) position: , mismatch: 2, identity: 0.923 

ggcccggcccggcagggcggcacagg	CRISPR spacer
ggccaggcccggaagggcggcacagg	Protospacer
**** ******* *************

18. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 2, identity: 0.923 

ggcccggcccggcagggcggcacagg-	CRISPR spacer
ggccgggcccggcagggcggc-caggt	Protospacer
**** **************** ****

19. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 3, identity: 0.88 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcggcgggctgggcatcgtgcaggc	Protospacer
*********. ************.*

20. spacer 11.6|2327389|25|CP023865|CRT matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
tggcgtcgtcgggcgccgtggcggc	Protospacer
. *** *******************

21. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

22. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

23. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

24. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

25. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

26. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

27. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP025615 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
tcgcggcctcgggcgccttggcggc	Protospacer
.****** ********* *******

28. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

29. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

30. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

31. spacer 11.6|2327389|25|CP023865|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

32. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

33. spacer 11.6|2327389|25|CP023865|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggtctcgggcgccgtggcggc	Protospacer
 *****. *****************

34. spacer 11.6|2327389|25|CP023865|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

35. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

36. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

37. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

38. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

39. spacer 11.6|2327389|25|CP023865|CRT matches to NC_047861 (Bordetella phage vB_BbrM_PHB04, complete genome) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcggacgcggtggcggc	Protospacer
 ***********.*** ********

40. spacer 11.6|2327389|25|CP023865|CRT matches to MN694324 (Marine virus AFVG_250M884, complete genome) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgtggcgtggggcgccgtggcgga	Protospacer
***.***** **************

41. spacer 11.6|2327389|25|CP023865|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggtctcgggcgccgtggcggc	Protospacer
 *****. *****************

42. spacer 11.6|2327389|25|CP023865|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

43. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

44. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcggtcgccgtcgcggc	Protospacer
 *********** ****** *****

45. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

46. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

47. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgccgggcgccgtggccgc	Protospacer
 *******.************* **

48. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

49. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

50. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

51. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

52. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

53. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

54. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

55. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

56. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

57. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggtctcgggcgccgtggcggc	Protospacer
 *****. *****************

58. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

59. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

60. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggtctcgggcgccgtggcggc	Protospacer
 *****. *****************

61. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

62. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

63. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

64. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

65. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

66. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

67. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

68. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

69. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

70. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

71. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

72. spacer 11.6|2327389|25|CP023865|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

73. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

74. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

75. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

76. spacer 11.6|2327389|25|CP023865|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggggccgtgtcggc	Protospacer
 ************ ****** ****

77. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

78. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

79. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

80. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

81. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

82. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

83. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

84. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

85. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

86. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

87. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

88. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

89. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

90. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

91. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

92. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

93. spacer 11.6|2327389|25|CP023865|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

94. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

95. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

96. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

97. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

98. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

99. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

100. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcgtcgggcgcggtgtcggc	Protospacer
 *************** *** ****

101. spacer 11.6|2327389|25|CP023865|CRT matches to MN694498 (Marine virus AFVG_250M881, complete genome) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgtggcgtggggcgccgtggcgga	Protospacer
***.***** **************

102. spacer 11.6|2327389|25|CP023865|CRT matches to MN693740 (Marine virus AFVG_250M882, complete genome) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgtggcgtggggcgccgtggcgga	Protospacer
***.***** **************

103. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
cggcggagtcgggctccgtggcggc	Protospacer
* **** ******* **********

104. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
cggcggcgccgggcgccgtggctgc	Protospacer
* ******.************* **

105. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
cggcggcgccgggcgccgtggctgc	Protospacer
* ******.************* **

106. spacer 11.6|2327389|25|CP023865|CRT matches to NC_014035 (Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
cggcggcgccgggcgccggggcggc	Protospacer
* ******.********* ******

107. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
cggcggggtccggcgccgtggcggc	Protospacer
* **** *** **************

108. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 3, identity: 0.88 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcatcgggcgccgtgggcgc	Protospacer
*******.*************  **

109. spacer 24.3|4773205|25|CP023865|CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

agtcccggcggccccggcccccgcg	CRISPR spacer
ggccccggcggccccggcctccgcg	Protospacer
.*.****************.*****

110. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP049160 (Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence) position: , mismatch: 3, identity: 0.88 

agtcccggcggccccggcccccgcg	CRISPR spacer
ggtcccggcggctccggcgcccgcg	Protospacer
.***********.***** ******

111. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 3, identity: 0.88 

agtcccggcggccccggcccccgcg	CRISPR spacer
ggtctcggcggcaccggcccccgcg	Protospacer
.***.******* ************

112. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP014303 (Hymenobacter sp. PAMC 26628 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

agtcccggcggccccggcccccgcg	CRISPR spacer
cgacccggcggccccggccccggcg	Protospacer
 * ****************** ***

113. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 3, identity: 0.885 

ggcccggcccggcagggcggcacagg	CRISPR spacer
ggcccgccccggcagggcggcaccga	Protospacer
****** **************** *.

114. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 3, identity: 0.885 

ggcccggcccggcagggcggcacagg	CRISPR spacer
ggcccggcgcggcagggcggcaaagc	Protospacer
******** ************* **

115. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.867 

ccggccgccccgcaacccgaggcgccgccg--	CRISPR spacer
ccagccgccccgcaccccgaggcg--gccgac	Protospacer
**.*********** *********  ****

116. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 4, identity: 0.857 

-cgtgccgccggaggcgcccggccccggt	CRISPR spacer
tcgt-ccgccgctggcgcccggccccggc	Protospacer
 *** ******  ***************.

117. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 4, identity: 0.857 

-cgtgccgccggaggcgcccggccccggt	CRISPR spacer
tcgt-ccgccgctggcgcccggccccggc	Protospacer
 *** ******  ***************.

118. spacer 7.1|1119001|24|CP023865|CRISPRCasFinder matches to NZ_CP045288 (Curtobacterium flaccumfaciens pv. flaccumfaciens strain P990 plasmid pCff1, complete sequence) position: , mismatch: 4, identity: 0.833 

ttccggttcggctgtcgttcccgt	CRISPR spacer
ttcgggttcggctgtcgttccgcc	Protospacer
*** *****************  .

119. spacer 7.1|1119001|24|CP023865|CRISPRCasFinder matches to CP041260 (Curtobacterium flaccumfaciens pv. flaccumfaciens strain Cff1037 plasmid pCFF113, complete sequence) position: , mismatch: 4, identity: 0.833 

ttccggttcggctgtcgttcccgt	CRISPR spacer
ttcgggttcggctgtcgttccgcc	Protospacer
*** *****************  .

120. spacer 11.3|2327260|25|CP023865|CRT matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 4, identity: 0.84 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcggcgcgcccggcctcgtgcaggt	Protospacer
****** ******* ********..

121. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
cactggcgtcgggcgccgtggtggc	Protospacer
*  .*****************.***

122. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
tcgcggcgtcgggcgccgcgccgga	Protospacer
.*****************.* ***

123. spacer 11.6|2327389|25|CP023865|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcgttgggcaccgtggcgtt	Protospacer
*********.****.******** .

124. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP015811 (Microbacterium chocolatum strain SIT 101 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcgtcgcgccccgtggcgat	Protospacer
*********** ** ********..

125. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP015812 (Microbacterium chocolatum strain SIT 101 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcgtcgcgccccgtggcgat	Protospacer
*********** ** ********..

126. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
aagcggcggcgggcgccggggcggc	Protospacer
  ****** ********* ******

127. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
tcgcggcgtcgggcgccgtcgccgg	Protospacer
.****************** ** *

128. spacer 11.6|2327389|25|CP023865|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcggcgggcgcggtggcgga	Protospacer
 ******* ******* *******

129. spacer 11.6|2327389|25|CP023865|CRT matches to NC_031267 (Gordonia phage Lucky10, complete genome) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcgtcgggcgcctcggcgaa	Protospacer
***************** .****.

130. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcgtcgggcgccgcggttcc	Protospacer
******************.**.  *

131. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcgttgggcaccgtggcgtt	Protospacer
*********.****.******** .

132. spacer 11.6|2327389|25|CP023865|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gcgcggcggcgggcgcggtggcgga	Protospacer
 ******* ******* *******

133. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcctcgggcgccgcggcgag	Protospacer
******* **********.****.

134. spacer 11.6|2327389|25|CP023865|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gccgggcgtcgggcgccatggcggc	Protospacer
 *  *************.*******

135. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
tcgcggcgttgggcgcggtggcggt	Protospacer
.********.****** *******.

136. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcgtcgggcgccgcgtcgct	Protospacer
******************.* ** .

137. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgcggcgacgggcgccgtggtcgt	Protospacer
******** ************. *.

138. spacer 11.6|2327389|25|CP023865|CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
gggcggcgtccggcgcggtggcggc	Protospacer
  ******** ***** ********

139. spacer 11.6|2327389|25|CP023865|CRT matches to MN694036 (Marine virus AFVG_250M883, complete genome) position: , mismatch: 4, identity: 0.84 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
ccgtggcgtggggcgccgtggcgtg	Protospacer
***.***** *************

140. spacer 16.1|2900360|26|CP023865|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.846 

cgacccggccggtggatgcggctgac	CRISPR spacer
cgaccccgccggtggatgcggtcgaa	Protospacer
****** **************..**

141. spacer 16.1|2900360|26|CP023865|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 4, identity: 0.846 

cgacccggccggtggatgcggctgac	CRISPR spacer
cgaccccgccggtggatgcggtcgaa	Protospacer
****** **************..**

142. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.852 

agtcccggcggccccgcccctcgcacc-	CRISPR spacer
cgtcctggcggccccgcccctc-cgccg	Protospacer
 ****.**************** *.**

143. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.852 

agtcccggcggccccgcccctcgcacc-	CRISPR spacer
cgtcctggcggccccgcccctc-cgccg	Protospacer
 ****.**************** *.**

144. spacer 24.3|4773205|25|CP023865|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
caccccggcgaccccggcccccgcg	Protospacer
 ..*******.**************

145. spacer 24.3|4773205|25|CP023865|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
caccccggcgaccccggcccccgcg	Protospacer
 ..*******.**************

146. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_DQ996271 (Burkholderia glumae BGR1 plasmid pBGF3, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
cgcgccggcggccccggccgccgcg	Protospacer
 *. *************** *****

147. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
ggtcccggccgccccggccgccgcc	Protospacer
.******** ********* ****

148. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
agtcccggcggccgaggcccccgtt	Protospacer
*************  ********.

149. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
ggacccggcggcccccgcccccgcc	Protospacer
.* ************ ********

150. spacer 24.3|4773205|25|CP023865|CRT matches to NC_010879 (Burkholderia glumae strain BGR1 plasmid pBGF2, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
cgcgccggcggccccggccgccgcg	Protospacer
 *. *************** *****

151. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP041164 (Leisingera aquaemixtae strain R2C4 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
cgcgccggcggccccggcgcccgcg	Protospacer
 *. ************** ******

152. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP054602 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
gatgccggcggccccggccgccgcg	Protospacer
..* *************** *****

153. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
cgttccggcggccccggaccccgca	Protospacer
 **.************* ******.

154. spacer 24.3|4773205|25|CP023865|CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
cctcccggcgcccacggcccccgcg	Protospacer
  ******** ** ***********

155. spacer 24.3|4773205|25|CP023865|CRT matches to MG009575 (Mycobacterium phage Kumao, complete genome) position: , mismatch: 4, identity: 0.84 

agtcccggcggccccggcccccgcg	CRISPR spacer
gatcccggcgaccccggcccctgcg	Protospacer
..********.**********.***

156. spacer 32.1|6368728|25|CP023865|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.84 

aaagcggggcacagccgcccggccc	CRISPR spacer
ggagcggggcgccgccgcccggccc	Protospacer
..********.* ************

157. spacer 32.1|6368728|25|CP023865|CRISPRCasFinder matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

aaagcggggcacagccgcccggccc	CRISPR spacer
aaagcggggcatagccgccgggcgg	Protospacer
***********.******* ***

158. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 4, identity: 0.875 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gcgttcgactgctcggggctgatccagtgggc	Protospacer
************** ******** ******..

159. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016291 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.875 

ggcaccaccgtcgacctgtccgg--gatcgggct	CRISPR spacer
ggcaccaacgacgacctgtccggcagatcggg--	Protospacer
******* ** ************  *******

160. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP040642 (Agrobacterium sp. T29 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.862 

cgcgccgacgccgacgatgtccga-tcaca	CRISPR spacer
cgcgccgaggccgacgatgttcggctcac-	Protospacer
******** ***********.**. ****

161. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcccggcccggcagggcggcacagg	CRISPR spacer
ggcccggcccgcgagggcggcacggt	Protospacer
***********  **********.*

162. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcccggcccggcagggcggcacagg	CRISPR spacer
aggccggcgcggcagggcgggacagg	Protospacer
.* ***** *********** *****

163. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 5, identity: 0.844 

-tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
caccgc-gtcgggccgcgcggtgtgcggggcgt	Protospacer
  **** *.******** **************.

164. spacer 10.1|1867860|26|CP023865|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 5, identity: 0.808 

tggcggggagcggtgctcgatggctc	CRISPR spacer
cggcggggagcggcgcttgatggcaa	Protospacer
.************.***.******

165. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

166. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

167. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

168. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

169. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

170. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

171. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

172. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

173. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

174. spacer 11.3|2327260|25|CP023865|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

175. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

176. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

177. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

178. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

179. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

180. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

181. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

182. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

183. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

184. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

185. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

186. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

187. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

188. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

189. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

190. spacer 11.3|2327260|25|CP023865|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

191. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

192. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

193. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

194. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

195. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

196. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

197. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

198. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

199. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

200. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

201. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

202. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

203. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

204. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

205. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

206. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

207. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

208. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

209. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

210. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

211. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

212. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

213. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

214. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

215. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

216. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

217. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

218. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

219. spacer 11.3|2327260|25|CP023865|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

220. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

221. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

222. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

223. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

224. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

225. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

226. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

227. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

228. spacer 11.3|2327260|25|CP023865|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gcggcgggcccggcatcgtgcagac	CRISPR spacer
gcgccgggcccggcatcgtgcgccg	Protospacer
*** *****************.

229. spacer 11.6|2327389|25|CP023865|CRT matches to NZ_CP050100 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence) position: , mismatch: 5, identity: 0.8 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
acgcggcgtcgggcgccgaggctct	Protospacer
 ***************** ***  .

230. spacer 11.6|2327389|25|CP023865|CRT matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 5, identity: 0.8 

ccgcggcgtcgggcgccgtggcggc	CRISPR spacer
tgggggcgtcgggcgccgtggcgtt	Protospacer
. * ******************* .

231. spacer 19.1|3704257|27|CP023865|CRISPRCasFinder matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 5, identity: 0.815 

tcgtgccgcgcgcggttacgcccaccc	CRISPR spacer
gcttgccgcccgcggttgcgcccacca	Protospacer
 * ****** *******.********

232. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.815 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
cgtcctggcggccccgcccctcggccg	Protospacer
 ****.*****************  *

233. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 5, identity: 0.815 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
cgtcctggcggccccgcccctcggccg	Protospacer
 ****.*****************  *

234. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 5, identity: 0.815 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
cgggccggcggccgcgcccgtcgcacc	Protospacer
 *  ********* ***** *******

235. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
ggagccgccggccccgccccgcgcacc	Protospacer
.*  *** ************ ******

236. spacer 24.1|4773077|27|CP023865|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.815 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
aggcccggccgccccgcccctcgtcgc	Protospacer
** ****** *************.  *

237. spacer 24.3|4773205|25|CP023865|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
ggcaccggcggccccggcccccgtc	Protospacer
.*. *******************.

238. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
gaagccggcggctccggcccccgcg	Protospacer
..  ********.************

239. spacer 24.3|4773205|25|CP023865|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
ggcaccggcggccccggcccccgtc	Protospacer
.*. *******************.

240. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
gtacccgggggccccggcccccgcc	Protospacer
.  ***** ***************

241. spacer 24.3|4773205|25|CP023865|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
gaccccggcggccccggcacccgcc	Protospacer
...*************** *****

242. spacer 24.3|4773205|25|CP023865|CRT matches to AB981620 (Couchioplanes caeruleus subsp. azureus plasmid pCAZ1 DNA, complete sequence, strain: NBRC 13993) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
ccacccggcggccccggccccggcc	Protospacer
   ****************** **

243. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
gtacccgggggccccggcccccgcc	Protospacer
.  ***** ***************

244. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
ccggccggcggccccggccccctcg	Protospacer
    ****************** **

245. spacer 24.3|4773205|25|CP023865|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
gtacccgggggccccggcccccgcc	Protospacer
.  ***** ***************

246. spacer 24.3|4773205|25|CP023865|CRT matches to MF766044 (Streptomyces phage Amethyst, complete genome) position: , mismatch: 5, identity: 0.8 

agtcccggcggccccggcccccgcg	CRISPR spacer
caagccggcgaccccggcccccgcg	Protospacer
 .  ******.**************

247. spacer 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP009295 (Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence) position: , mismatch: 5, identity: 0.844 

gcgt-tccggacggtcggggacctggccgacgc	CRISPR spacer
-cgcatgcggacggtcgcggagctggccgacgc	Protospacer
 **. * ********** *** ***********

248. spacer 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 5, identity: 0.844 

-gcgttccggacggtcggggacctggccgacgc	CRISPR spacer
tgcgatcc-gacggtggcggacctggccgacgt	Protospacer
 *** *** ****** * **************.

249. spacer 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.848 

-tctcgaccaccgcggcggccgccgcttggcgcc	CRISPR spacer
atcgcga-cgccgcggcggccgccgctttccgcc	Protospacer
 ** *** *.******************  ****

250. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.844 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
tcgagcagcaccagcggcgccggcgcggcgag	Protospacer
 **. *******************  ******

251. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcgccgccggcccgtggat	Protospacer
**************** ******** *  **

252. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to MK433272 (Gordonia phage IDyn, complete genome) position: , mismatch: 5, identity: 0.844 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
gccgccgcggcgttcaccggcggcctgcacgt	Protospacer
  * *** ************** *********

253. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to MK376954 (Gordonia phage WhoseManz, complete genome) position: , mismatch: 5, identity: 0.844 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
gccgccgcggcgttcaccggcggcctgcacgt	Protospacer
  * *** ************** *********

254. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to MH669007 (Gordonia phage Marietta, complete genome) position: , mismatch: 5, identity: 0.844 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
gccgccgcggcgttcaccggcggcctgcacgt	Protospacer
  * *** ************** *********

255. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to MN428063 (Gordonia phage NadineRae, complete genome) position: , mismatch: 5, identity: 0.844 

taccccgg-ggcgttcaccggcgccctgcacgt	CRISPR spacer
-gccgcggcggtgttcaccggcggcctgcacgt	Protospacer
 .** *** **.*********** *********

256. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021042 (Phaeobacter gallaeciensis strain P129 plasmid pP129_b, complete sequence) position: , mismatch: 5, identity: 0.844 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcatcgtcggcgcgggtgg	Protospacer
 **********************.** *  **

257. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010652 (Phaeobacter inhibens strain P54 plasmid pP54_b, complete sequence) position: , mismatch: 5, identity: 0.844 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcatcgtcggcgcgggtgg	Protospacer
 **********************.** *  **

258. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010699 (Phaeobacter inhibens strain P24 plasmid pP24_c, complete sequence) position: , mismatch: 5, identity: 0.844 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcatcgtcggcgcgggtgg	Protospacer
 **********************.** *  **

259. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR027556 (Epibacterium mobile isolate EPIB1 plasmid 4, complete sequence) position: , mismatch: 5, identity: 0.844 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcatcgtcggcgcgggtgg	Protospacer
 **********************.** *  **

260. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004395 (Celeribacter indicus strain P73 plasmid pP73B, complete sequence) position: , mismatch: 5, identity: 0.844 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcatcgtcggcgcgggtgg	Protospacer
 **********************.** *  **

261. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.844 

-ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
tccctgc-ccgtcaccgcgcccgcggcgccggc	Protospacer
 **  ** *********** .************

262. spacer 34.49|6461565|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

-tgcgggtcaccggcgagactttgaaactcgtc	CRISPR spacer
attcgtgt-accggctggactttgaaactcgtc	Protospacer
 * ** ** ****** .****************

263. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.844 

-ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
tccctgc-ccgtcaccgcgcccgcggcgccggc	Protospacer
 **  ** *********** .************

264. spacer 34.65|6461570|32|CP023865|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

-tgcgggtcaccggcgagactttgaaactcgtc	CRISPR spacer
attcgtgt-accggctggactttgaaactcgtc	Protospacer
 * ** ** ****** .****************

265. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
agataggcccggcaggccggcacagg	Protospacer
.* . *********** *********

266. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
agataggcccggcaggccggcacagg	Protospacer
.* . *********** *********

267. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP015089 (Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
cgcggtgcccggcagggcggcacagc	Protospacer
 **   *******************

268. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
catccggcccggcaaggcggcagagg	Protospacer
 ..***********.******* ***

269. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
agataggcccggcaggccggcacagg	Protospacer
.* . *********** *********

270. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
agataggcccggcaggccggcacagg	Protospacer
.* . *********** *********

271. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
acgccggcccgacagggcggcgcagg	Protospacer
.  ********.*********.****

272. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
cacccggtccggcagggcggcgcaga	Protospacer
 .*****.*************.***.

273. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP023039 (Komagataeibacter saccharivorans strain CV1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
cttccagcccggcagtgcggcacagg	Protospacer
  .**.********* **********

274. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to CP054934 (Nocardiopsis flavescens strain NA01583 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
ccgccggccccgcagggcgggacagg	Protospacer
   ******* ********* *****

275. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
agataggcccggcaggccggcacagg	Protospacer
.* . *********** *********

276. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
agataggcccggcaggccggcacagg	Protospacer
.* . *********** *********

277. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
agataggcccggcaggccggcacagg	Protospacer
.* . *********** *********

278. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcccggcccggcagggcggcacagg	CRISPR spacer
agcccggcccggcagttcggcacacc	Protospacer
.**************  *******

279. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP050118 (Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence) position: , mismatch: 6, identity: 0.8 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
ctcgccgccccggaaccggaggcgccgctc	Protospacer
*. ********* **** **********.

280. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP050122 (Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence) position: , mismatch: 6, identity: 0.8 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
ctcgccgccccggaaccggaggcgccgctc	Protospacer
*. ********* **** **********.

281. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NC_000958 (Deinococcus radiodurans R1 plasmid MP1, complete sequence) position: , mismatch: 6, identity: 0.8 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
ctcgccgccccggaaccggaggcgccgctc	Protospacer
*. ********* **** **********.

282. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP031502 (Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence) position: , mismatch: 6, identity: 0.8 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
ctcgccgccccggaaccggaggcgccgctc	Protospacer
*. ********* **** **********.

283. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
ctggccgccccgcaacgcgaggcagtggcg	Protospacer
*.************** ******. .* **

284. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

285. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

286. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccacag	Protospacer
********.******** ******  .

287. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

288. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

289. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccacag	Protospacer
********.******** ******  .

290. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

291. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

292. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

293. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

294. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

295. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

296. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

297. spacer 3.5|596603|28|CP023865|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccacag	Protospacer
********.******** ******  .

298. spacer 3.5|596603|28|CP023865|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccacag	Protospacer
********.******** ******  .

299. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

300. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

301. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgctggaggcgcgcggcccgcag	Protospacer
********.******** ******  .

302. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggcc--ccggt	CRISPR spacer
tctgccgccggacgcgcccggccaactg--	Protospacer
. ********** **********  *.*

303. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cagcccgccccaggcgcccggccccggc	Protospacer
*.  *****  ****************.

304. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.786 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
ggtgccggcggcggcgcccggcccggac	Protospacer
 ****** *** ************ *..

305. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.812 

tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
ggtgccgccggcccgctcggtgtgcggggctc	Protospacer
  .** ***** ****************** *

306. spacer 9.2|1545830|32|CP023865|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.812 

cgcgaggt-caggccgcgcgacgttcggtggag	CRISPR spacer
-gcgcgctccaggccgcgagacgctcggtggaa	Protospacer
 *** * * ********* ****.********.

307. spacer 9.2|1545830|32|CP023865|CRISPRCasFinder matches to MH536819 (Gordonia phage Fury, complete genome) position: , mismatch: 6, identity: 0.812 

--cgcgaggtcaggccgcgcgacgttcggtggag	CRISPR spacer
ggttcgagg--aggacgcgcgacgtgcggtggag	Protospacer
  . *****  *** ********** ********

308. spacer 9.2|1545830|32|CP023865|CRISPRCasFinder matches to MH576960 (Gordonia phage Pleakley, complete genome) position: , mismatch: 6, identity: 0.812 

--cgcgaggtcaggccgcgcgacgttcggtggag	CRISPR spacer
ggttcgagg--aggacgcgcgacgtgcggtggag	Protospacer
  . *****  *** ********** ********

309. spacer 19.1|3704257|27|CP023865|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.778 

tcgtgccgcgcgcggttacgcccaccc	CRISPR spacer
tcttgccgcgcgcggttacgacctgat	Protospacer
** ***************** **   .

310. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttcgggccgcagcgcgacgaccgtgt	Protospacer
************ .**********.  *

311. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

312. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

313. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

314. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

315. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

316. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cgcttcgggcctgggcgcgacgagccgca	Protospacer
*.********* *********** .** .

317. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

318. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

319. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

320. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

321. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

322. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

323. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgataccga	Protospacer
****** ******* ********. * *.

324. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

325. spacer 23.2|4761150|29|CP023865|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 6, identity: 0.793 

cacttcgggccggggcgcgacgactcggg	CRISPR spacer
cacttccggccgggtcgcgacgatgccga	Protospacer
****** ******* ********. * *.

326. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP035422 (Leisingera sp. NJS204 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

327. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP021406 (Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
tttcccggcggcccaggccctcgcaga	Protospacer
  ************ * ********

328. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP049038 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_1, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

329. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP010872 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6003, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
tttcccggcggcccaggccctcgcaga	Protospacer
  ************ * ********

330. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP040823 (Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
tttcccggcggcccaggccctcgcaga	Protospacer
  ************ * ********

331. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP040823 (Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
tttcccggcggcccaggccctcgcaga	Protospacer
  ************ * ********

332. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
atcacgcgcggccccgcccctcgcacg	Protospacer
* . *  *******************

333. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP010611 (Phaeobacter inhibens strain P92 plasmid pP92_a, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

334. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP019460 (Streptomyces autolyticus strain CGMCC0516 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gcccccggcggccccgcccctcctccc	Protospacer
. .******************* . **

335. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP019460 (Streptomyces autolyticus strain CGMCC0516 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gcccccggcggccccgcccctcctccc	Protospacer
. .******************* . **

336. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP038240 (Leisingera sp. NJS201 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

337. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP010716 (Phaeobacter piscinae strain P18 plasmid pP18_a, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

338. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP010658 (Phaeobacter piscinae strain P71 plasmid pP71_b, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

339. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP010601 (Phaeobacter inhibens strain P83 plasmid pP83_b, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

340. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP010770 (Phaeobacter piscinae strain P13 plasmid pP13_c, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

341. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP010707 (Phaeobacter inhibens strain P66 plasmid pP66_b, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

342. spacer 24.1|4773077|27|CP023865|CRT matches to NZ_CP010662 (Phaeobacter inhibens strain P74 plasmid pP74_a, complete sequence) position: , mismatch: 6, identity: 0.778 

agtcccggcggccccgcccctcgcacc	CRISPR spacer
gttcccggcggcccaggccctcgcaga	Protospacer
. ************ * ********

343. spacer 28.1|6064595|31|CP023865|CRISPRCasFinder matches to MH834623 (Arthrobacter phage Peas, complete genome) position: , mismatch: 6, identity: 0.806 

accgccgaaacaaccaccaacaccagcccac	CRISPR spacer
caagccgaatcaaccaccatcaccagcccag	Protospacer
   ****** ********* **********

344. spacer 28.1|6064595|31|CP023865|CRISPRCasFinder matches to NC_048094 (Arthrobacter phage Eileen, complete genome) position: , mismatch: 6, identity: 0.806 

accgccgaaacaaccaccaacaccagcccac	CRISPR spacer
caagccgaatcaaccaccatcaccagcccag	Protospacer
   ****** ********* **********

345. spacer 32.1|6368728|25|CP023865|CRISPRCasFinder matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 6, identity: 0.76 

aaagcggggcacagccgcccggccc	CRISPR spacer
ggcgcggggcacagccgcccggtga	Protospacer
.. *******************.

346. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 6, identity: 0.812 

gactggctcggcggcccgggtgc-cggcgcgga	CRISPR spacer
gacggcctcggcggcccgggtgcgcagttcgg-	Protospacer
*** * ***************** *.*. ***

347. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NZ_CP045723 (Pantoea eucalypti strain LMG 24197 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812 

atggagatcgtgccgtcgccgctgctg-cgcca	CRISPR spacer
gtggcgatcgtgccgttgccgctgccgtcgtc-	Protospacer
.*** ***********.********.* **.*

348. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NZ_CP016283 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence) position: , mismatch: 6, identity: 0.812 

atggagatcgtgccgtcgccgctgctgcgcca-	CRISPR spacer
accaagatcgtgccggcgccgctggtg-gccat	Protospacer
*. .*********** ******** ** ****

349. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP006993 (Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence) position: , mismatch: 6, identity: 0.812 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgagcacgccgccgagggtgagccagtaggt	Protospacer
**************** *.******* * *

350. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to KF626665 (Phage Sano, complete genome) position: , mismatch: 6, identity: 0.818 

gaccgcgatggccgacccggagctggcggcgca-	CRISPR spacer
cgctgcgatggccgacccggacgtggcgg-gcat	Protospacer
 .*.*****************  ****** ***

351. spacer 33.16|6447268|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_049432 (Ralstonia phage RsoM1USA, complete genome) position: , mismatch: 6, identity: 0.812 

atcggggc----ccggccgtggcgtgcccggtacgc	CRISPR spacer
----gggcggcgccggccgtggcgagcccggtgcgc	Protospacer
    ****    ************ *******.***

352. spacer 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.812 

tatgagggcctggaggcgtacgtccaggccca	CRISPR spacer
gacgggtgcctggaggcgttcgtcgaggccca	Protospacer
 *.*.* ************ **** *******

353. spacer 33.27|6447940|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

ctgcagcaactcccgcccggccgggcctggct---	CRISPR spacer
ctgcagcaacagccgcccggccg---ccggctcgc	Protospacer
**********  ***********   *.****

354. spacer 33.29|6448062|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 6, identity: 0.812 

caccgggt--gaacgcagcgagggtgtcgcccgg	CRISPR spacer
--gcgggttggaacgcagggagggtgtagcccga	Protospacer
   *****  ******** ******** *****.

355. spacer 33.29|6448062|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 6, identity: 0.812 

caccgggt--gaacgcagcgagggtgtcgcccgg	CRISPR spacer
--gcgggttggaacgcagggagggtgtagcccga	Protospacer
   *****  ******** ******** *****.

356. spacer 33.34|6448367|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 6, identity: 0.812 

gaccacttccagccggccagcttctccttcag	CRISPR spacer
gctctcctccagccggcccgtttctccttcag	Protospacer
* .* *.*********** *.***********

357. spacer 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.812 

gccgggcccgtcggccggcgcacgatgcgccg-	CRISPR spacer
gccgggccggacggccggcgcacggt-caccac	Protospacer
******** * *************.* *.**.

358. spacer 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 6, identity: 0.812 

gccgggcccgtcggccggcgcacgatgcgccg-	CRISPR spacer
tccgggcccgtcggcaggcgcagga-gtgcggg	Protospacer
 ************** ****** ** *.** *

359. spacer 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP013125 (Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence) position: , mismatch: 6, identity: 0.812 

--gccgggcccgtcggccggcgcacgatgcgccg	CRISPR spacer
catccggg--cgtcggccagcgctcgatgcgccc	Protospacer
   *****  ********.**** *********

360. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

361. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

362. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

363. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

364. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

365. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

366. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

367. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

368. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

369. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

370. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

371. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

372. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

373. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

374. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

375. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

376. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

377. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

378. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

379. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

380. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

381. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

382. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

383. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

384. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

385. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

386. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

387. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

388. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

389. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

390. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

391. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

392. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

393. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

394. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

395. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

396. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

397. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

398. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

399. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

400. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

401. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

402. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

403. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

404. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

405. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

406. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

407. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

408. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

409. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

410. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

411. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

412. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

413. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

414. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

415. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

416. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

417. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

418. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

419. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

420. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

421. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

422. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

423. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

424. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

425. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

426. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

427. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

428. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

429. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccggcccgaagat	Protospacer
***************.**.****** *. **

430. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 6, identity: 0.812 

gcggtcagcaccagcggcgccggccaggcgag-	CRISPR spacer
acggtcagctccagcgacgccgg-cagccgggc	Protospacer
.******** ******.****** *** **.*

431. spacer 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 6, identity: 0.812 

tggctcagcaggatgaacggctcgcagccaga--	CRISPR spacer
tcgctcagcaggctgaacggttcgc--ccaggcg	Protospacer
* ********** *******.****  ****.

432. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.812 

accacgctcaaggacgtgcccggcgcga-acat	CRISPR spacer
accgcgctcaaggacgtgcccgccgaggcgca-	Protospacer
***.****************** ** *. .**

433. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP005191 (Sphingobium sp. MI1205 plasmid pMI2, complete sequence) position: , mismatch: 6, identity: 0.812 

accac-gctcaaggacgtgcccggcgcgaacat	CRISPR spacer
-caactgctcaaggacgagccccgcgcgatctt	Protospacer
 * ** *********** **** ****** * *

434. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 6, identity: 0.812 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
tggcggtcgcggacttgcatcgcgatgcggcg	Protospacer
 * .********** **** ********** *

435. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 6, identity: 0.818 

--ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
ctggcca--agcgccgcgagcaaagcgatggtgac	Protospacer
  ** **  *************.****.***** *

436. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 6, identity: 0.818 

--ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
ctggcca--agcgccgcgagcaaagcgatggtgac	Protospacer
  ** **  *************.****.***** *

437. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

438. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

439. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

440. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

441. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

442. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

443. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

444. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

445. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

446. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

447. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

448. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

449. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

450. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

451. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

452. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gcgctgatcctcggcatcgacggtggcggaag	Protospacer
.****************** ***** .* *.*

453. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041157 (Leisingera aquaemixtae strain R2C4 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgatcctcggcattgtcggtgcgggcgg	Protospacer
*  **************.******** *  **

454. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015092 (Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcattgtcggcgcgggcgg	Protospacer
 ****************.*****.** *  **

455. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015233 (Epibacterium mobile F1926 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcattgtcggcgcgggcgg	Protospacer
 ****************.*****.** *  **

456. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgcttatcctcggcatcgtcggagccggtgg	Protospacer
 **** ***************** **.*  **

457. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031600 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_02, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcattgtcggcgcgggcgg	Protospacer
 ****************.*****.** *  **

458. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049815 (Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcattgtcggcgcgggcgg	Protospacer
 ****************.*****.** *  **

459. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010861 (Marinovum algicola DG 898 plasmid pMaD6, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcattgtcggcgcgggcgg	Protospacer
 ****************.*****.** *  **

460. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045375 (Sulfitobacter sp. THAF37 plasmid pTHAF37_c, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctaatcctcggcatcgtcggcgcgggcgg	Protospacer
 ****.*****************.** *  **

461. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045320 (Roseivivax sp. THAF197b plasmid pTHAF197b_b, complete sequence) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tcgctgatcctcggcattgtcggcgcgggcgg	Protospacer
 ****************.*****.** *  **

462. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggt-gctgcagg	CRISPR spacer
acgctgatcatcggcatcgttggcggttgccg-	Protospacer
********* **********.**. *.*** *

463. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 6, identity: 0.812 

acgctgatcctcggcatcgtcggt-gctgcagg	CRISPR spacer
acgctgatcatcggcatcgttggcggttgccg-	Protospacer
********* **********.**. *.*** *

464. spacer 34.37|6460833|30|CP023865|CRISPRCasFinder,CRT matches to AJ630128 (Bacteriophage S-PM2 complete genome) position: , mismatch: 6, identity: 0.8 

ctgttcgataaaccgaacagtcaggagatc	CRISPR spacer
cagaccgataaacagaacagtcagcagacc	Protospacer
* * .******** ********** ***.*

465. spacer 34.37|6460833|30|CP023865|CRISPRCasFinder,CRT matches to NC_006820 (Synechococcus phage S-PM2, complete genome) position: , mismatch: 6, identity: 0.8 

ctgttcgataaaccgaacagtcaggagatc	CRISPR spacer
cagaccgataaacagaacagtcagcagacc	Protospacer
* * .******** ********** ***.*

466. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
gcagcgcggcgccaggcccggacgcccgccgt	Protospacer
 *..* *****.*************** ****

467. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
gcagcgcggcgccaggcccggacgcccgccgt	Protospacer
 *..* *****.*************** ****

468. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
gcagcgcggcgccaggcccggacgcccgccgt	Protospacer
 *..* *****.*************** ****

469. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
cccagccggcgtccggcccggaagccccccat	Protospacer
.* * ******** ******** *******.*

470. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.812 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
acatcggcgccggggccggggtcgctgatggg	Protospacer
**.  * ********* ******* *******

471. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 6, identity: 0.812 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ccagcgaccacggcgagcagctcggcgatcat	Protospacer
 ** *.** *** *** ***************.

472. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 6, identity: 0.812 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ccagcgaccacggcgagcagctcggcgatcat	Protospacer
 ** *.** *** *** ***************.

473. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 6, identity: 0.812 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ccagcgaccacggcgagcagctcggcgatcat	Protospacer
 ** *.** *** *** ***************.

474. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 6, identity: 0.812 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ccagcgaccacggcgagcagctcggcgatcat	Protospacer
 ** *.** *** *** ***************.

475. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812 

ccgggca---ccgtcaccgcggtcgcggcgccggc	CRISPR spacer
---gacaaggccgtcacggcggtcgcggcgctggc	Protospacer
   *.**   ******* *************.***

476. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to MK977705 (Gordonia Phage Mollymur, complete genome) position: , mismatch: 6, identity: 0.812 

ccgggcaccgtcaccgcggtcgcggcgccggc--	CRISPR spacer
ccgggcactgtcaccgcggtcgag--gacggtca	Protospacer
********.************* *  * ***.

477. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_025041 (Sulfobacillus thermotolerans strain L15 plasmid pL15, complete sequence) position: , mismatch: 6, identity: 0.812 

---ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gggccggg---cgtcaccgtggtcacggcgccgga	Protospacer
   *****   ********.****.*********

478. spacer 34.53|6460838|30|CP023865|PILER-CR matches to AJ630128 (Bacteriophage S-PM2 complete genome) position: , mismatch: 6, identity: 0.8 

ctgttcgataaaccgaacagtcaggagatc	CRISPR spacer
cagaccgataaacagaacagtcagcagacc	Protospacer
* * .******** ********** ***.*

479. spacer 34.53|6460838|30|CP023865|PILER-CR matches to NC_006820 (Synechococcus phage S-PM2, complete genome) position: , mismatch: 6, identity: 0.8 

ctgttcgataaaccgaacagtcaggagatc	CRISPR spacer
cagaccgataaacagaacagtcagcagacc	Protospacer
* * .******** ********** ***.*

480. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
gcagcgcggcgccaggcccggacgcccgccgt	Protospacer
 *..* *****.*************** ****

481. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
gcagcgcggcgccaggcccggacgcccgccgt	Protospacer
 *..* *****.*************** ****

482. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
gcagcgcggcgccaggcccggacgcccgccgt	Protospacer
 *..* *****.*************** ****

483. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
cccagccggcgtccggcccggaagccccccat	Protospacer
.* * ******** ******** *******.*

484. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.812 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
acatcggcgccggggccggggtcgctgatggg	Protospacer
**.  * ********* ******* *******

485. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 6, identity: 0.812 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ccagcgaccacggcgagcagctcggcgatcat	Protospacer
 ** *.** *** *** ***************.

486. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 6, identity: 0.812 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ccagcgaccacggcgagcagctcggcgatcat	Protospacer
 ** *.** *** *** ***************.

487. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 6, identity: 0.812 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ccagcgaccacggcgagcagctcggcgatcat	Protospacer
 ** *.** *** *** ***************.

488. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 6, identity: 0.812 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ccagcgaccacggcgagcagctcggcgatcat	Protospacer
 ** *.** *** *** ***************.

489. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812 

ccgggca---ccgtcaccgcggtcgcggcgccggc	CRISPR spacer
---gacaaggccgtcacggcggtcgcggcgctggc	Protospacer
   *.**   ******* *************.***

490. spacer 34.64|6461509|32|CP023865|PILER-CR matches to MK977705 (Gordonia Phage Mollymur, complete genome) position: , mismatch: 6, identity: 0.812 

ccgggcaccgtcaccgcggtcgcggcgccggc--	CRISPR spacer
ccgggcactgtcaccgcggtcgag--gacggtca	Protospacer
********.************* *  * ***.

491. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_025041 (Sulfobacillus thermotolerans strain L15 plasmid pL15, complete sequence) position: , mismatch: 6, identity: 0.812 

---ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gggccggg---cgtcaccgtggtcacggcgccgga	Protospacer
   *****   ********.****.*********

492. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 6, identity: 0.793 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
aacgccgacgccggcgatggccgatcgcg	Protospacer
 .***********.***** ******.*.

493. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.793 

cgcgccgacgccgacgatgtc--cgatcaca	CRISPR spacer
tgcgccgaggccgacgatgtcctcgaccc--	Protospacer
.******* ************  ***.*

494. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.793 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
cgcgctgacgccgacgatctccgccgcca	Protospacer
*****.************ **** .  **

495. spacer 45.1|7897172|26|CP023865|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.769 

ggcccggcccggcagggcggcacagg	CRISPR spacer
ggcccggcgcggcagggcggcgatca	Protospacer
******** ************.   .

496. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

497. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

498. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

499. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

500. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

501. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

502. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

503. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

504. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

505. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

506. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

507. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

508. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

509. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gagattgccccgcagcccgaggcgccgcca	Protospacer
  *...********.**************.

510. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gtggtcttgccgcaacccgaggcgccgacg	Protospacer
 .**.* . ****************** **

511. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_CP045303 (Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
caaaccgccccgcaaccggcggcgccgcac	Protospacer
* ..************* * ********

512. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
ccggccgccccgcaatccgaggaacccgga	Protospacer
***************.****** .**   .

513. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NC_004688 (Mycobacterium phage Omega, complete genome) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gaggccgccccacaccccgaggcgcaccgg	Protospacer
  *********.** **********  * *

514. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to MF133445 (Mycobacterium phage Lucky2013, complete genome) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gaggccgccccacaccccgaggcgcaccgg	Protospacer
  *********.** **********  * *

515. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to MF072690 (Mycobacterium phage Porcelain, complete genome) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gaggccgccccacaccccgaggcgcaccgg	Protospacer
  *********.** **********  * *

516. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to AY129338 (Mycobacterium virus Omega, complete genome) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gaggccgccccacaccccgaggcgcaccgg	Protospacer
  *********.** **********  * *

517. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to JF937101 (Mycobacterium virus LittleE, complete genome) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gaggccgccccacaccccgaggcgcaccgg	Protospacer
  *********.** **********  * *

518. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to KM400683 (Mycobacterium phage Ariel, complete genome) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gaggccgccccacaccccgaggcgcaccgg	Protospacer
  *********.** **********  * *

519. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to MF668284 (Mycobacterium phage Squint, complete genome) position: , mismatch: 7, identity: 0.767 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gaggccgccccacaccccgaggcgcaccgg	Protospacer
  *********.** **********  * *

520. spacer 2.1|229332|33|CP023865|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.788 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccgggcgcggagaccgcggcggtggtgcgcgac	Protospacer
**** *********** ********.* * * .

521. spacer 2.4|229500|33|CP023865|CRT matches to NZ_CP017565 (Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence) position: , mismatch: 7, identity: 0.788 

ccggtcgcgggcgcggcgggaaccggggtggac	CRISPR spacer
acgatcgcgcgcgcggcgggaaccggggacttc	Protospacer
 **.***** ******************    *

522. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.75 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
gccgccgcccgaggcgcccgtccccgtg	Protospacer
  .****** ********** *****

523. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 7, identity: 0.75 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
tccgccaccggaggcgctcggccccgcc	Protospacer
. .***.**********.******** .

524. spacer 3.5|596603|28|CP023865|CRT matches to KX241618 (Xanthomonas phage Xoo-sp2, complete genome) position: , mismatch: 7, identity: 0.75 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
cgtgccgcgcgaggcgcccggcctgtac	Protospacer
********  *************.  ..

525. spacer 3.5|596603|28|CP023865|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75 

cgtgccgccggaggcgcccggccccggt	CRISPR spacer
gcagccgcccgaggcgcccggcgccgtg	Protospacer
   ****** ************ ***

526. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.781 

tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
taagcatccgggccgctcggggtgcggccggc	Protospacer
*  *** ************* ******   **

527. spacer 9.2|1545830|32|CP023865|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

cgcgaggtcaggccgcgcgacgttcggtggag	CRISPR spacer
agcgaggtcgggccgcgcgacggtctgcaaag	Protospacer
 ********.************ ** *...**

528. spacer 9.2|1545830|32|CP023865|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781 

cgcgaggtcaggccgcgcgacgttcggtggag	CRISPR spacer
agcgaggtcgggccgcgcgacggtctgcaaag	Protospacer
 ********.************ ** *...**

529. spacer 15.2|2878764|37|CP023865|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.811 

cgatgcggcg-ccggagggcgggccgggcggcgcaggc	CRISPR spacer
-gtgaaggcgaccggaaggcgggccgggccgcgcaggc	Protospacer
 *  . **** *****.************ ********

530. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggcgctgtcggcggccggggtgccggcgcggg	Protospacer
*.*    ********* **************.

531. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ccgtgcgtcggcggccccggtgccggcgcggc	Protospacer
   **  ********** *************

532. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ccgtgcgtcggcggccccggtgccggcgcggc	Protospacer
   **  ********** *************

533. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ccgtgcgtcggcggccccggtgccggcgcggc	Protospacer
   **  ********** *************

534. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ccgtgcgtcggcggccccggtgccggcgcggc	Protospacer
   **  ********** *************

535. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
gggcaggtcggcggccggggtgccggggcgga	Protospacer
*. ..* ********* ********* *****

536. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggtggccttggcggcccgggtgcgggcgcggc	Protospacer
*.. * **.************** *******

537. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccgg-cgcgga	CRISPR spacer
ccgtggcgcggcgggccgggtgccggccgccg-	Protospacer
   **** ****** *********** *** *

538. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccgg-cgcgga	CRISPR spacer
ccgtggcgcggcgggccgggtgccggccgccg-	Protospacer
   **** ****** *********** *** *

539. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP019465 (Streptomyces autolyticus strain CGMCC0516 plasmid unnamed8, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggc---tcggcggcccgggtgccggcgcgga	CRISPR spacer
---tggcctgtcggcggcccgggccccggcgcgcc	Protospacer
   ****   *************. ********

540. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781 

--gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ttccctgg--cggcggcacgggtggcggcgcggc	Protospacer
    ****  ******* ****** ********

541. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.781 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggccgggccggcggccctggttccggcgcggg	Protospacer
*.*.** .********* *** *********.

542. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.781 

atggagatcgtgccgtcgccgctgctgcgcca	CRISPR spacer
atttggcccgtgctgtcgccgctgcagcgcca	Protospacer
**  .* .*****.*********** ******

543. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

544. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

545. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

546. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

547. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

548. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

549. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

550. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

551. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

552. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

553. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

554. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

555. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

556. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

557. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

558. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

559. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

560. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

561. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

562. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

563. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

564. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

565. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

566. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

567. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

568. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

569. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

570. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

571. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

572. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

573. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

574. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

575. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

576. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

577. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

578. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

579. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

580. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

581. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

582. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

583. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

584. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

585. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

586. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

587. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

588. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

589. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

590. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

591. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

592. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

593. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

594. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

595. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

596. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

597. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

598. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

599. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

600. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

601. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

602. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

603. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

604. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

605. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

606. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

607. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

608. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

609. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

610. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

611. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

612. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

613. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

614. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

615. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cttcggcggcgcgccgttcggcacgctgatcg	Protospacer
**  .. * ************ **********

616. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ctactacatcgcgccgttcgggccggtgatcg	Protospacer
**.  * .************** ** ******

617. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN908694 (Microbacterium phage RubyRalph, complete genome) position: , mismatch: 7, identity: 0.781 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
gcgagcacggcgccgatgatgagcgaccactg	Protospacer
 ******** ************** **.  *.

618. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP036351 (Planctomycetes bacterium K2D plasmid pK2D_1, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
cggcgttcgcctgcgatgatgagccacttgtc	Protospacer
* * *. ****  ******************

619. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 7, identity: 0.781 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
gccggggcgtaccgagtgttcgccgacttcac	Protospacer
. * ******** ************ ****.

620. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
cagccggatggccgaaccggagctgacggcgcg	Protospacer
 * *  ********* *********.******.

621. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
aagccggatggccgaaccggagctgacggcgcg	Protospacer
.* *  ********* *********.******.

622. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
cagccggatggccgaaccggagctgacggcgcg	Protospacer
 * *  ********* *********.******.

623. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
aagccggatggccgaaccggagctgacggcgcg	Protospacer
.* *  ********* *********.******.

624. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
cagccggatggccgaaccggagctgacggcgcg	Protospacer
 * *  ********* *********.******.

625. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
aagccggatggccgaaccggagctgacggcgcg	Protospacer
.* *  ********* *********.******.

626. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
cagccggatggccgaaccggagctgacggcgcg	Protospacer
 * *  ********* *********.******.

627. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
cagccggatggccgaaccggagctgacggcgcg	Protospacer
 * *  ********* *********.******.

628. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
cagccggatggccgaaccggagctgacggcgcg	Protospacer
 * *  ********* *********.******.

629. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
cagccggatggccgaaccggagctgacggcgcg	Protospacer
 * *  ********* *********.******.

630. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
cagccggatggccgaaccggagctgacggcgcg	Protospacer
 * *  ********* *********.******.

631. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
cagccggatggccgaaccggagctgacggcgcg	Protospacer
 * *  ********* *********.******.

632. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP017565 (Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
gaccgccacggccgacccggagctcgagccccc	Protospacer
****** *.*************** * * * *

633. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
ggcggtgtcggccgacgcggagctggcggccca	Protospacer
*.* *.* .******* ************* **

634. spacer 33.15|6447207|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

aagtcctggtcatcgctgcgtctcgtcgcacg	CRISPR spacer
aggtcatggtcatcgctgcggctcgtttcata	Protospacer
*.*** ************** *****. **..

635. spacer 33.17|6447329|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgcgccgcaacgccccccggttcgcccgccc	CRISPR spacer
tgcggcggcagcgccccccggttcgcccgccg	Protospacer
.   ** ***.********************

636. spacer 33.17|6447329|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP032230 (Streptomyces seoulensis strain KCTC 9819 plasmid unnamed) position: , mismatch: 7, identity: 0.781 

ccgcgccgcaacgccccccggttcgcccgccc	CRISPR spacer
ctccgccgcaacgccgcccggttcgcggtcct	Protospacer
*. ************ **********   **.

637. spacer 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgttccggacggtcggggacctggccgacgc	CRISPR spacer
gaggagaagacggtcggggaactggccgacgc	Protospacer
* *    .************ ***********

638. spacer 33.21|6447573|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_031230 (Gordonia phage Yvonnetastic, complete genome) position: , mismatch: 7, identity: 0.781 

atgtgagcctcgaactcacccatcgcgtcctt	CRISPR spacer
atgtggggctcgaactcacccatgtccatctt	Protospacer
*****.* ***************  *  .***

639. spacer 33.23|6447695|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.781 

ggctgtcccaggagatccgcacccaggcaatg	CRISPR spacer
ggctgtcccagtagatccgctccaggcgaacg	Protospacer
*********** ******** ** .*  **.*

640. spacer 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 7, identity: 0.788 

tctcgaccaccgcggcggccgccgc-ttggcgcc	CRISPR spacer
cctcgaccaccgcggccgcggccgcacaggcgg-	Protospacer
.*************** ** ***** . ****

641. spacer 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.788 

--tctcgaccaccgcggcggccgccgcttggcgcc	CRISPR spacer
gaactca--caccgcggcggccggcgctgggcggc	Protospacer
   ***.  ************** **** **** *

642. spacer 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.788 

tctcgaccaccgcggcggccgccgc-ttggcgcc	CRISPR spacer
cctcgaccaccgcggccgcggccgcgcaggcgg-	Protospacer
.*************** ** ***** . ****

643. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 7, identity: 0.781 

gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
accgccgcgatcttgcgcgcgacgcccgggcc	Protospacer
..  ******* *************** **.*

644. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 7, identity: 0.781 

gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
gtgttctggatgtagcgcgcgccgccccggtt	Protospacer
***..*  ***** ******* *********.

645. spacer 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

--gaccactccgtgatccgctcggcgagcgtgcc	CRISPR spacer
gtgatga--gcgtgatgcgctcggtgagcgtgcc	Protospacer
  **. *   ****** *******.*********

646. spacer 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP029177 (Acidibrevibacterium fodinaquatile strain G45-3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

----gccgggcccgtcggccggcgcacgatgcgccg	CRISPR spacer
tcgagcagg----gtcggctggcgctcgatgcgccg	Protospacer
    ** **    ******.***** **********

647. spacer 33.44|6448977|33|CP023865|CRISPRCasFinder,PILER-CR matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 7, identity: 0.788 

cagccgggccttcagctcggtcgggacggtgaa	CRISPR spacer
cagccgggcattcagctcggccgggcccgcgcc	Protospacer
********* **********.**** * *.*

648. spacer 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781 

cgggccaccgtgacgcccagctgcgcgctgtc	CRISPR spacer
agggccaccgtcatgcccagctgcgccccgcg	Protospacer
 ********** *.************ *.*.

649. spacer 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_008538 (Arthrobacter sp. FB24 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781 

cgggccaccgtgacgcccagctgcgcgctgtc	CRISPR spacer
agggccaccgtcatgcccagctgcgccccgcg	Protospacer
 ********** *.************ *.*.

650. spacer 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_008539 (Arthrobacter sp. FB24 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781 

cgggccaccgtgacgcccagctgcgcgctgtc	CRISPR spacer
agggccaccgtcatgcccagctgcgccccgcg	Protospacer
 ********** *.************ *.*.

651. spacer 33.56|6446963|39|CP023865|CRT matches to MH171094 (Streptomyces phage Nabi, complete genome) position: , mismatch: 7, identity: 0.821 

agctgggcgtacagagtgttcgccgtcttcgggggacca	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgggttgctg	Protospacer
** ***********.******************  .*..

652. spacer 33.56|6446963|39|CP023865|CRT matches to MK433276 (Streptomyces phage Asten, complete genome) position: , mismatch: 7, identity: 0.821 

agctgggcgtacagagtgttcgccgtcttcgggggacca	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgggttgctg	Protospacer
** ***********.******************  .*..

653. spacer 33.56|6446963|39|CP023865|CRT matches to MN096373 (Streptomyces phage TuanPN, complete genome) position: , mismatch: 7, identity: 0.821 

agctgggcgtacagagtgttcgccgtcttcgggggacca	CRISPR spacer
aggtgggcgtacagcgtgttcgccgtcttcgggttgctc	Protospacer
** *********** ******************  .*.

654. spacer 33.56|6446963|39|CP023865|CRT matches to MN284899 (Streptomyces phage Whatever, complete genome) position: , mismatch: 7, identity: 0.821 

agctgggcgtacagagtgttcgccgtcttcgggggacca	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgggttgctg	Protospacer
** ***********.******************  .*..

655. spacer 33.56|6446963|39|CP023865|CRT matches to KX507343 (Streptomyces phage Lorelei, complete genome) position: , mismatch: 7, identity: 0.821 

agctgggcgtacagagtgttcgccgtcttcgggggacca	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgggttgctg	Protospacer
** ***********.******************  .*..

656. spacer 33.56|6446963|39|CP023865|CRT matches to MN096379 (Streptomyces phage Yasdnil, complete genome) position: , mismatch: 7, identity: 0.821 

agctgggcgtacagagtgttcgccgtcttcgggggacca	CRISPR spacer
aggtgggcgtacagcgtgttcgccgtcttcgggttgctc	Protospacer
** *********** ******************  .*.

657. spacer 33.56|6446963|39|CP023865|CRT matches to MH171093 (Streptomyces phage Rana, complete genome) position: , mismatch: 7, identity: 0.821 

agctgggcgtacagagtgttcgccgtcttcgggggacca	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgggttgctg	Protospacer
** ***********.******************  .*..

658. spacer 33.56|6446963|39|CP023865|CRT matches to MG757163 (Streptomyces phage OzzyJ, complete genome) position: , mismatch: 7, identity: 0.821 

agctgggcgtacagagtgttcgccgtcttcgggggacca	CRISPR spacer
aggtgggcgtacagggtgttcgccgtcttcgggttgctg	Protospacer
** ***********.******************  .*..

659. spacer 33.56|6446963|39|CP023865|CRT matches to MH171095 (Streptomyces phage Maneekul, complete genome) position: , mismatch: 7, identity: 0.821 

agctgggcgtacagagtgttcgccgtcttcgggggacca	CRISPR spacer
aggtgggcgtacagcgtgttcgccgtcttcgggttgctc	Protospacer
** *********** ******************  .*.

660. spacer 34.1|6458631|32|CP023865|CRISPRCasFinder,CRT matches to NC_048733 (Microbacterium phage Burro, complete genome) position: , mismatch: 7, identity: 0.781 

gggtagacccgcagatggtcacgatgaacaga	CRISPR spacer
ccgcagaccagcagatggccacgatgaacggg	Protospacer
  *.***** ********.**********.*.

661. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
acggtctgcaccagccgcgccggccaggacga	Protospacer
.***** ******** ************  ..

662. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.781 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
acggtctgcaccagccgcgccggccaggatga	Protospacer
.***** ******** ************  ..

663. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.781 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
agtaccagcaccagcgacgccgtccaggcgag	Protospacer
.  ..***********.***** *********

664. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021368 (Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence) position: , mismatch: 7, identity: 0.781 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcgttcagcacctgcggcgccggcacgccgta	Protospacer
*** ******** ***********  * ** .

665. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021364 (Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence) position: , mismatch: 7, identity: 0.781 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcgttcagcacctgcggcgccggcacgccgta	Protospacer
*** ******** ***********  * ** .

666. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcagcaccagcagcaccgggccgaagat	Protospacer
***************.**.**** * *. **

667. spacer 34.4|6458814|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

agggccaggcactccaccgcctcc-----ggtaccca	CRISPR spacer
agggccaggcactcggccgcctcccactgggt-----	Protospacer
************** .********     ***

668. spacer 34.4|6458814|32|CP023865|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781 

agggccaggcactccaccgcctcc-----ggtaccca	CRISPR spacer
agggccaggcactcggccgcctcccactgggt-----	Protospacer
************** .********     ***

669. spacer 34.4|6458814|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

agggccaggcactccaccgcctccggtaccca	CRISPR spacer
ggggcctggcactccaccgccacccgcatcaa	Protospacer
.***** ************** ** *.*.* *

670. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcggcggcggcatcgtcggcggcgtgctcgg	Protospacer
  *. *.***.**.******************

671. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcggcggcggcatcgtcggcggcgtgctcgg	Protospacer
  *. *.***.**.******************

672. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gtcgtgcgcgacgccgtcggcggcgtgcgcgg	Protospacer
  *.*  *****.*************** ***

673. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021796 (Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcggcggcggcatcgtcggcggcgtgctcgg	Protospacer
  *. *.***.**.******************

674. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
ggcatcagcggcatcgtcggcggcgtcggagg	Protospacer
 *********.**.************    **

675. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcggcggcggcatcgtcggcggcgtgctcgg	Protospacer
  *. *.***.**.******************

676. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MN234205 (Mycobacterium phage Veliki, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

677. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MT188704 (Mesorhizobium phage Cp1R7A-A1, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
ggcatcagcggcatcgtcggcggcgcggccgt	Protospacer
 *********.**.***********.* .**

678. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MN234198 (Mycobacterium phage Zavala, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

679. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to KX585253 (Mycobacterium phage HedwigODU, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

680. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MF140428 (Mycobacterium phage Slimphazie, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

681. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MG962371 (Mycobacterium phage LaterM, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

682. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to JN185608 (Mycobacterium virus JAWS, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

683. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MN234231 (Mycobacterium phage Rapunzel97, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

684. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MF373841 (Mycobacterium phage Hurricane, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccacggcgacaccgtcggcggcctgatcgc	Protospacer
 **  *.***************** ** ***

685. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NC_023747 (Mycobacterium phage BarrelRoll, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

686. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MG962364 (Mycobacterium phage Deby, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

687. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to KR080206 (Mycobacterium phage ShedlockHolmes, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccacggcgacaccgtcggcggcctgatcgc	Protospacer
 **  *.***************** ** ***

688. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to KM677211 (Mycobacterium phage Murucutumbu, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

689. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MF668267 (Mycobacterium phage Apocalypse, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

690. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MH051246 (Mycobacterium phage ActinUp, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

691. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MH513977 (Mycobacterium phage Mynx, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

692. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MN234197 (Mycobacterium phage Ramen, complete genome) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccccggcgacaccgtgggcggcgtgatcgc	Protospacer
 ** .*.********** ********* ***

693. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
ggcatccgcgacatcgtcggcggccgggccgg	Protospacer
 ***** ******.**********  * .***

694. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gcgcgcccg-gacaccgtcggcgacgagctcgg	Protospacer
 .**..* * *************.** ******

695. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
ggcatccgcgacatcgtcggcggccgggccgg	Protospacer
 ***** ******.**********  * .***

696. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
ggcatccgcgacatcgtcggcggccgggccgg	Protospacer
 ***** ******.**********  * .***

697. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
ggcatccgcgacatcgtcggcggccgggccgg	Protospacer
 ***** ******.**********  * .***

698. spacer 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP018727 (Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.2, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgtccgc---caggaagttgtgcggatcgtcggc	CRISPR spacer
---tccacacagaggaagttctgcgcatcgtcggc	Protospacer
   ***.*    ******** **** *********

699. spacer 34.12|6459304|32|CP023865|CRISPRCasFinder,CRT matches to NC_013283 (Cronobacter turicensis z3032 plasmid pCTU1, complete sequence) position: , mismatch: 7, identity: 0.781 

gcggcagccagtacgccgatgaacgacatgat	CRISPR spacer
gaggccgccagcacgccgatgaacggcgtaaa	Protospacer
* *** *****.*************.*.*.*

700. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to JQ067089 (Pseudomonas phage PaMx28, partial genome) position: , mismatch: 7, identity: 0.781 

accacgctcaaggacgtgcccggcgcgaacat	CRISPR spacer
gccacgctcaaggccgtggccggctcccccat	Protospacer
.************ **** ***** *   ***

701. spacer 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP049039 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_2, complete sequence) position: , mismatch: 7, identity: 0.781 

gacgcgccgagcatcgcggtcgggatgatgcg-	CRISPR spacer
atcgcgccgctcatcgcggtcgggat-acgcat	Protospacer
. *******  *************** *.**.

702. spacer 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.781 

gacgcgccgagcatcgcggtcgggatgatgcg	CRISPR spacer
ggcgcgcccatcatcgcggtcgggatcaccag	Protospacer
*.****** * *************** *.  *

703. spacer 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT matches to MF477236 (Nocardia phage NTR1, complete genome) position: , mismatch: 7, identity: 0.781 

gacgatgcggacgctggcgagtgggaggacga	CRISPR spacer
ttcgatgcggacgacggcgagtgggagcgcgc	Protospacer
  *********** .************ .**

704. spacer 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT matches to MN694194 (Marine virus AFVG_250M1056, complete genome) position: , mismatch: 7, identity: 0.781 

gacgatgcggacgctggcgagtgggaggacga	CRISPR spacer
agcgacaaggacgctggtgagtgggaagacga	Protospacer
..***.. *********.********.*****

705. spacer 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT matches to MN694435 (Marine virus AFVG_250M1055, complete genome) position: , mismatch: 7, identity: 0.781 

gacgatgcggacgctggcgagtgggaggacga	CRISPR spacer
agcgacaaggacgctggtgagtgggaagacga	Protospacer
..***.. *********.********.*****

706. spacer 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT matches to MN693636 (Marine virus AFVG_250M1057, complete genome) position: , mismatch: 7, identity: 0.781 

gacgatgcggacgctggcgagtgggaggacga	CRISPR spacer
agcgacaaggacgctggtgagtgggaagacga	Protospacer
..***.. *********.********.*****

707. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 7, identity: 0.781 

ggctggtcgcggacatgcagcgcgatgcggag----	CRISPR spacer
agctggtcgcggacatgctgcgcga----gaacatc	Protospacer
.***************** ******    **.

708. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 7, identity: 0.781 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
agatcgtcgcgcagatgcagcgcgatgcggcc	Protospacer
.* * ****** * ****************

709. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP026974 (Achromobacter insolitus strain FDAARGOS_88 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
agatggtcgccgccatgcagcgcgatgtgctg	Protospacer
.* ******* * **************.*  *

710. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NC_014642 (Achromobacter xylosoxidans A8 plasmid pA82, complete sequence) position: , mismatch: 7, identity: 0.781 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
agatggtcgccgccatgcagcgcgatgtgctg	Protospacer
.* ******* * **************.*  *

711. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 7, identity: 0.781 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
ggctggtcgcagtcatgcagcgccacggcgcg	Protospacer
**********.* ********** *.*  * *

712. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tgagcggcgacggccggatcgtcgcgggtggc	Protospacer
.*. *********** * ***********  *

713. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to AY320035 (Bacteriophage VWB, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tcgccggcgaccgcccgcacgtcgcggtgatc	Protospacer
. ********* ****** ********   **

714. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_005345 (Streptomyces phage VWB, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tcgccggcgaccgcccgcacgtcgcggtgatc	Protospacer
. ********* ****** ********   **

715. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgt---cgcgggtttc	CRISPR spacer
cggacggcgacgccccgctcgtcgacgcaggg---	Protospacer
*** ******** *********   ***.**

716. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MN234179 (Gordonia phage Pipp, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

717. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MN010762 (Gordonia phage MintFen, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

718. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MT553336 (Gordonia phage BlingBling, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

719. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_031265 (Gordonia phage Guacamole, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

720. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MF919521 (Gordonia phage Lysidious, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

721. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

722. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MN369740 (Gordonia phage Delian, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

723. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

724. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MN096365 (Gordonia phage Samba, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

725. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MH576969 (Gordonia phage Zarbodnamra, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

726. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MK864263 (Gordonia phage Melba, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

727. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

728. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MK878896 (Gordonia phage Begonia, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

729. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

730. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MT723942 (Gordonia phage Archis, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

731. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MK967389 (Gordonia phage JasperJr, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

732. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MK501730 (Gordonia phage Barco, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

733. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MH020241 (Gordonia phage Fenry, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

734. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

735. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to KU963251 (Gordonia phage UmaThurman, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

736. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to KX557274 (Gordonia phage CaptainKirk2, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

737. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

738. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MT723936 (Gordonia phage Hitter, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

739. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgatgtgttc	Protospacer
 ********.**********.***  *  ***

740. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_030921 (Gordonia phage Utz, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

741. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 7, identity: 0.781 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
aggccggcggcggcccgctcatcgacgtgttc	Protospacer
 ********.**********.***  *  ***

742. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to CP021131 (Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence) position: , mismatch: 7, identity: 0.781 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
gaggtcgagcagggtcgcccgccagggccgct	Protospacer
*.***************** ***** **

743. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gcgttcgactgctccgggctgatgctcgccgc	Protospacer
*************************     ..

744. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NC_021278 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
aacttcgactgctccgggctgacccagtgggc	Protospacer
.  *******************. ******..

745. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.781 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
cagttcgactgctccgggctggtgcaggcggc	Protospacer
  *******************.*****  *..

746. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to KR063280 (Gordonia phage GMA6, complete genome) position: , mismatch: 7, identity: 0.781 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gggttcgactgctctggtctgatgcagtacgg	Protospacer
* ************.** **********. .

747. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 7, identity: 0.781 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gggttcgactgctcgggtctgatgcagtacgc	Protospacer
* ************ ** **********. ..

748. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to MN586022 (Gordonia phage Chidiebere, complete genome) position: , mismatch: 7, identity: 0.781 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gggttcgactgctcgggcctgatgcagtacgc	Protospacer
* ************ ** **********. ..

749. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gccttcgactgctccggtctgatgctgcgctc	Protospacer
** ************** ******* *.*  .

750. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to DQ123818 (Actinomyces phage Av-1, complete genome) position: , mismatch: 7, identity: 0.781 

--gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
tgacgtc--attgctcagggctgatgcagcggat	Protospacer
  .***.  *.***** ************.****

751. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781 

taccccggggcgttcaccggcgccc-tgcacgt	CRISPR spacer
gtccccggcgccttcaccggcgcccgcgcccg-	Protospacer
  ****** ** ************* .** **

752. spacer 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

-tacgtcgcgggcgtggcgggctggtcgattga	CRISPR spacer
gtgca-gacgggcgtggcgggcttgtcgatcga	Protospacer
 *.*.  .*************** ******.**

753. spacer 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781 

-tacgtcgcgggcgtggcgggctggtcgattga	CRISPR spacer
gtgca-gacgggcgtggcgggcttgtcgatcga	Protospacer
 *.*.  .*************** ******.**

754. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.788 

--ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
ctggcc--cagcgccgcgagcagagcgatcgtgat	Protospacer
  ** *  *******************.* *** .

755. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 7, identity: 0.788 

ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
cgacagcagcgccgcgagcaaaggggctacgcc	Protospacer
 *******************.** **. ..***

756. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 7, identity: 0.788 

ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
cgacagcagcgccgcgagcaaaggggcaacgcc	Protospacer
 *******************.** **....***

757. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.788 

ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
gaacagcagcgccgcgagcaggacggacgagcg	Protospacer
*.*******************..***  * **

758. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788 

--ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
ctggcca--agcgccgcgagcaaagcgatggtgat	Protospacer
  ** **  *************.****.***** .

759. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcaccaccgtcgacctgtccgggatcgggct	CRISPR spacer
ggcagcaccatcgacctgtccgggctggcggc	Protospacer
**** ****.************** * * * .

760. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcaccaccgtcgacctgtccgggatcgggct-	CRISPR spacer
ggcgccaccgtcgtcctgtcc-ggacggcgcga	Protospacer
***.********* ******* ***. * **

761. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcaccaccgtcgacctgtccgggatcgggct-	CRISPR spacer
ggcgccaccgtcgtcctgtcc-ggacggcgcga	Protospacer
***.********* ******* ***. * **

762. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcaccaccgtcgacctgtccgggatcgggct-	CRISPR spacer
ggcgccaccgtcgtcctgtcc-ggacggcgcga	Protospacer
***.********* ******* ***. * **

763. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcaccaccgtcgacctgtccgggatcgggct-	CRISPR spacer
ggcgccaccgtcgtcctgtcc-ggacggcgcga	Protospacer
***.********* ******* ***. * **

764. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcaccaccgtcgacctgtccgggatcgggct-	CRISPR spacer
ggcgccaccgtcgtcctgtcc-ggacggcgcga	Protospacer
***.********* ******* ***. * **

765. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gagctgatcctcggcatcgacggtggcggaag	Protospacer
. ***************** ***** .* *.*

766. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045330 (Labrenzia sp. THAF191b plasmid pTHAF191b_b, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgattctcggcatcgtcggcgcgggcgg	Protospacer
*  *****.**************.** *  **

767. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045331 (Labrenzia sp. THAF191b plasmid pTHAF191b_c, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgattctcggcatcgtcggcgcgggcgg	Protospacer
*  *****.**************.** *  **

768. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045346 (Labrenzia sp. THAF187b plasmid pTHAF187b_b, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgattctcggcatcgtcggcgcgggcgg	Protospacer
*  *****.**************.** *  **

769. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045347 (Labrenzia sp. THAF187b plasmid pTHAF187b_c, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgattctcggcatcgtcggcgcgggcgg	Protospacer
*  *****.**************.** *  **

770. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045334 (Labrenzia sp. THAF191a plasmid pTHAF191a_a, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgattctcggcatcgtcggcgcgggcgg	Protospacer
*  *****.**************.** *  **

771. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045336 (Labrenzia sp. THAF191a plasmid pTHAF191a_c, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgattctcggcatcgtcggcgcgggcgg	Protospacer
*  *****.**************.** *  **

772. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045382 (Labrenzia sp. THAF35 plasmid pTHAF35_b, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgatcctcggcgtcgtcggcgcaggcgg	Protospacer
*  ************.*******.** *  **

773. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045383 (Labrenzia sp. THAF35 plasmid pTHAF35_c, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgatcctcggcgtcgtcggcgcaggcgg	Protospacer
*  ************.*******.** *  **

774. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019632 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgatcctcggcgtcgtcggcgcaggcgg	Protospacer
*  ************.*******.** *  **

775. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030100 (Roseovarius sp. AK1035 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tccctgatcctcggcatagtcggcgcgggcgg	Protospacer
 * ************** *****.** *  **

776. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020475 (Roseovarius mucosus strain SMR3 plasmid pSMR3-1, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
tccctgatcctcggcatagtcggcgcgggcgg	Protospacer
 * ************** *****.** *  **

777. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011928 (Labrenzia sp. CP4 plasmid pBCL1, complete sequence) position: , mismatch: 7, identity: 0.781 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
agcctgatcctcggcgtcgtcggcgcaggcgg	Protospacer
*  ************.*******.** *  **

778. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 7, identity: 0.781 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
tcggtgacgccggggcgggggtctctgatggt	Protospacer
 **. * ****************  ******

779. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 7, identity: 0.781 

acgaggtcgc--cggggcgggggtcggtgatggg	CRISPR spacer
--cagttcgcgacggcgcgggggtcggtgatgcc	Protospacer
   ** ****  *** ****************

780. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
gcgaggtcgtcggggcggggggcgtggcgggg	Protospacer
.********.*********** **  *  ***

781. spacer 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 7, identity: 0.781 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
ggcgggtccgccgggaagtcagggcagtcgtc	Protospacer
**   * ******** **** **********.

782. spacer 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 7, identity: 0.781 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
ggcgggtccgccgggtagtcggggcagtcgtc	Protospacer
**   * ********.**** **********.

783. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ctagcgaccacggcgagcagctcggcgatcat	Protospacer
 *. *.** *** *** ***************.

784. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP044551 (Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence) position: , mismatch: 7, identity: 0.781 

acccgt-gacaccgcgcgcagctcggcgatcac	CRISPR spacer
-ccggtctgcaccgcgcccagctcggcgctcag	Protospacer
 ** **  .******** ********** ***

785. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gagggcaccgtcaccgcgggcgcggcgaccat	Protospacer
  ***************** ******* * ..

786. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gagggcaccgtcaccgcgggcgcggcgaccat	Protospacer
  ***************** ******* * ..

787. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ctccccgccggcaccgcggtcgcggctccggc	Protospacer
*.   *.*** *************** *****

788. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc--	CRISPR spacer
cagggcactgtcaccgcgatcgcg--gccgatct	Protospacer
* ******.*********.*****  ****..

789. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to KP027201 (Mycobacterium phage Sbash, complete genome) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
acgggcatcgtcaccgcgctcgcgggcaccgc	Protospacer
 ******.********** ******   * **

790. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_004683 (Mycobacterium phage Che9c, complete genome) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
acgggcatcgtcaccgcgctcgcgggcaccgc	Protospacer
 ******.********** ******   * **

791. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to AY129333 (Mycobacterium virus Che9c, complete genome) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
acgggcatcgtcaccgcgctcgcgggcaccgc	Protospacer
 ******.********** ******   * **

792. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 7, identity: 0.781 

-ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
aatgggc-ccgtcgccgcggtcgcgacgccgct	Protospacer
  .**** *****.***********.***** .

793. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggca---ccgtcaccgcggtcgcggcgccggc	CRISPR spacer
---ggcaaggccgtcaccgcgagcgcggcgccgag	Protospacer
   ****   ***********. **********.

794. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc--	CRISPR spacer
gcgagcaccgtcaacgcggtcgcg--tccggtgg	Protospacer
 **.********* **********   ****.

795. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 7, identity: 0.781 

---ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agaccgtg---ggtcatcgcgatcgcggcgccggc	Protospacer
   *** *    ****.****.*************

796. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
cgaacggcaacgccatgtcggtgctggagtcc	Protospacer
 *  ***** **.**************** .*

797. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NC_015963 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS01, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
cgaacggcaacgccatgtcggtgctggagtcc	Protospacer
 *  ***** **.**************** .*

798. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaacttc	Protospacer
  ********** ******* *****.*  **

799. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

800. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

801. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

802. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

803. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

804. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

805. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

806. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

807. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

808. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

809. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

810. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

811. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

812. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

813. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

814. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

815. spacer 34.51|6461687|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

cactggtcgcgcaccctcaacggcgccggtcg	CRISPR spacer
cagcgggcgcgcaccctcatcggcgcctggtg	Protospacer
** .** ************ ******* * .*

816. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 7, identity: 0.781 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
tcggtgacgccggggcgggggtctctgatggt	Protospacer
 **. * ****************  ******

817. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 7, identity: 0.781 

acgaggtcgc--cggggcgggggtcggtgatggg	CRISPR spacer
--cagttcgcgacggcgcgggggtcggtgatgcc	Protospacer
   ** ****  *** ****************

818. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
gcgaggtcgtcggggcggggggcgtggcgggg	Protospacer
.********.*********** **  *  ***

819. spacer 34.59|6461202|32|CP023865|PILER-CR matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 7, identity: 0.781 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
ggcgggtccgccgggaagtcagggcagtcgtc	Protospacer
**   * ******** **** **********.

820. spacer 34.59|6461202|32|CP023865|PILER-CR matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 7, identity: 0.781 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
ggcgggtccgccgggtagtcggggcagtcgtc	Protospacer
**   * ********.**** **********.

821. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781 

acccgtga-caccgcgcgcagctcggcgatcac	CRISPR spacer
-ctagcgaccacggcgagcagctcggcgatcat	Protospacer
 *. *.** *** *** ***************.

822. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP044551 (Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence) position: , mismatch: 7, identity: 0.781 

acccgt-gacaccgcgcgcagctcggcgatcac	CRISPR spacer
-ccggtctgcaccgcgcccagctcggcgctcag	Protospacer
 ** **  .******** ********** ***

823. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gagggcaccgtcaccgcgggcgcggcgaccat	Protospacer
  ***************** ******* * ..

824. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gagggcaccgtcaccgcgggcgcggcgaccat	Protospacer
  ***************** ******* * ..

825. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ctccccgccggcaccgcggtcgcggctccggc	Protospacer
*.   *.*** *************** *****

826. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc--	CRISPR spacer
cagggcactgtcaccgcgatcgcg--gccgatct	Protospacer
* ******.*********.*****  ****..

827. spacer 34.64|6461509|32|CP023865|PILER-CR matches to KP027201 (Mycobacterium phage Sbash, complete genome) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
acgggcatcgtcaccgcgctcgcgggcaccgc	Protospacer
 ******.********** ******   * **

828. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_004683 (Mycobacterium phage Che9c, complete genome) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
acgggcatcgtcaccgcgctcgcgggcaccgc	Protospacer
 ******.********** ******   * **

829. spacer 34.64|6461509|32|CP023865|PILER-CR matches to AY129333 (Mycobacterium virus Che9c, complete genome) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
acgggcatcgtcaccgcgctcgcgggcaccgc	Protospacer
 ******.********** ******   * **

830. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 7, identity: 0.781 

-ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
aatgggc-ccgtcgccgcggtcgcgacgccgct	Protospacer
  .**** *****.***********.***** .

831. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggca---ccgtcaccgcggtcgcggcgccggc	CRISPR spacer
---ggcaaggccgtcaccgcgagcgcggcgccgag	Protospacer
   ****   ***********. **********.

832. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgggcaccgtcaccgcggtcgcggcgccggc--	CRISPR spacer
gcgagcaccgtcaacgcggtcgcg--tccggtgg	Protospacer
 **.********* **********   ****.

833. spacer 34.64|6461509|32|CP023865|PILER-CR matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 7, identity: 0.781 

---ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agaccgtg---ggtcatcgcgatcgcggcgccggc	Protospacer
   *** *    ****.****.*************

834. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
cgaacggcaacgccatgtcggtgctggagtcc	Protospacer
 *  ***** **.**************** .*

835. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NC_015963 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS01, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
cgaacggcaacgccatgtcggtgctggagtcc	Protospacer
 *  ***** **.**************** .*

836. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaacttc	Protospacer
  ********** ******* *****.*  **

837. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

838. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

839. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

840. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

841. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

842. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

843. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

844. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

845. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

846. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

847. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

848. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

849. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

850. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

851. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

852. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.781 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcctcggcatcggcatgtcgctgctgaatttc	Protospacer
  ********** ******* *****.*  **

853. spacer 34.67|6461692|32|CP023865|PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

cactggtcgcgcaccctcaacggcgccggtcg	CRISPR spacer
cagcgggcgcgcaccctcatcggcgcctggtg	Protospacer
** .** ************ ******* * .*

854. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
gccgtcgacgccgacgatgtccgaatatt	Protospacer
  **.******************* .*.

855. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccg-atcaca	CRISPR spacer
gccgccgacgccgacgaggtccgcgccgc-	Protospacer
  *************** ***** ..*.*

856. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
tgcgtcgacgccgacgaggtccgagcgat	Protospacer
.***.************ ****** *.

857. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccg-atcaca	CRISPR spacer
gccgccgacgccgacgaggtccgcgccgc-	Protospacer
  *************** ***** ..*.*

858. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP025961 (Rhodococcus qingshengii strain djl-6-2 plasmid pDJL2, complete sequence) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
tgcgtcgacgccgacgaggtccgagcgat	Protospacer
.***.************ ****** *.

859. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
ggtgacggcgccgacgatgtccgatcggc	Protospacer
 *.* **.******************.

860. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
cgcgccgacgccgacgacgaccgggcggt	Protospacer
*****************.* ***. *.

861. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NC_020562 (Sphingomonas sp. MM-1 plasmid pISP1, complete sequence) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
cgcgccgaagccgacgatgaccggcaagg	Protospacer
******** ********** ***.. * .

862. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
cgcggcgacgccgacgctgtccgggctgg	Protospacer
**** *********** ******. *  .

863. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.759 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
cgcgccgacgccgacgacgttcgcgccgg	Protospacer
*****************.**.**  *  .

864. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.733 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
ttcgccgccgcgcatcccgaggcgccgatc	Protospacer
.. ****** **** ************ .

865. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to MT889384 (Mycobacterium phage STLscum, complete genome) position: , mismatch: 8, identity: 0.733 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gccaccgccccgccacccggggcgccggaa	Protospacer
 * .********* *****.*******  .

866. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NC_023862 (Mycobacterium phage Alsfro, complete genome) position: , mismatch: 8, identity: 0.733 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gccaccgccccgccacccggggcgccggaa	Protospacer
 * .********* *****.*******  .

867. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to KT818595 (Mycobacterium phage Pepe, complete genome) position: , mismatch: 8, identity: 0.733 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gccaccgccccgccacccggggcgccggaa	Protospacer
 * .********* *****.*******  .

868. spacer 1.1|71752|30|CP023865|CRISPRCasFinder matches to NC_023748 (Mycobacterium phage SkiPole, complete genome) position: , mismatch: 8, identity: 0.733 

ccggccgccccgcaacccgaggcgccgccg	CRISPR spacer
gccaccgccccgccacccggggcgccggaa	Protospacer
 * .********* *****.*******  .

869. spacer 2.1|229332|33|CP023865|CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 8, identity: 0.758 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
acggagcgggagacgggggcggaggcgggagcg	Protospacer
 ***    ****** ******* *********

870. spacer 2.4|229500|33|CP023865|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.758 

ccggtcgcgggcgcggcgggaaccggggtggac	CRISPR spacer
gcggccgagggcgcggcgggaaccggccgggcg	Protospacer
 ***.** ******************   **

871. spacer 2.4|229500|33|CP023865|CRT matches to HM486077 (Tsukamurella phage TPA2, complete sequence) position: , mismatch: 8, identity: 0.758 

ccggtcgcgggcgcggcgggaaccggg---gtggac	CRISPR spacer
tccgtcgcgggcgcggcggcgaccgggcgcatg---	Protospacer
.* **************** .******   .**

872. spacer 2.4|229500|33|CP023865|CRT matches to NC_015210 (Tsukamurella phage TPA2, complete genome) position: , mismatch: 8, identity: 0.758 

ccggtcgcgggcgcggcgggaaccggg---gtggac	CRISPR spacer
tccgtcgcgggcgcggcggcgaccgggcgcatg---	Protospacer
.* **************** .******   .**

873. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
atcatggtcgtgccgctcggtgtgctgggcgc	Protospacer
 .*...*.** ************** ******

874. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
atcatggtcgtgccgctcggtgtgctgggcgc	Protospacer
 .*...*.** ************** ******

875. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
atcatggtcgtgccgctcggtgtgctgggcgc	Protospacer
 .*...*.** ************** ******

876. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
atcatggtcgtgccgctcggtgtgctgggcgc	Protospacer
 .*...*.** ************** ******

877. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
atcatggtcgtgccgctcggtgtgctgggcgc	Protospacer
 .*...*.** ************** ******

878. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
ttcgccgccgggccgctcggggtgcccgtcag	Protospacer
*.*** ************** ****  * *.

879. spacer 9.2|1545830|32|CP023865|CRISPRCasFinder matches to NC_014120 (Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence) position: , mismatch: 8, identity: 0.75 

cgcgaggtcaggccgcgcgacgttcggtggag	CRISPR spacer
agcgaggtcgggccgcgcgacggtctacaaag	Protospacer
 ********.************ ** ....**

880. spacer 25.1|4810356|33|CP023865|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.758 

agatcagcgacagcacgatgtaggcgatgccgg	CRISPR spacer
tgcgcagcgacagcccgatggaggcgatctcgt	Protospacer
 *  ********** ***** ******* .**

881. spacer 25.1|4810356|33|CP023865|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.758 

agatcagcgacagcacgatgtaggcgatgccgg	CRISPR spacer
tgcgcagcgacagcccgatggaggcgatctcgt	Protospacer
 *  ********** ***** ******* .**

882. spacer 28.1|6064595|31|CP023865|CRISPRCasFinder matches to MN693610 (Marine virus AFVG_250M347, complete genome) position: , mismatch: 8, identity: 0.742 

accgccgaaacaaccaccaacaccagcccac	CRISPR spacer
tgcgccaaaaaaaccaccaacaccagaagaa	Protospacer
  ****.*** ***************   *

883. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP015268 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.75 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
caccgatacggcggccccggtgccgccgcggc	Protospacer
 **.*.. ********* ******* *****

884. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.75 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
caccgatacggcggccccggtgccgccgcggc	Protospacer
 **.*.. ********* ******* *****

885. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 8, identity: 0.75 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
tcccgtcccggccgcccgggggccggcgcggc	Protospacer
  *.* *.**** ******* **********

886. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
gcacgccgtggcggcccgggcgccggcccgga	Protospacer
*  .* * .***********.****** ****

887. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.75 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
gcctggctcgggggaccgggtgccgcgtcgcc	Protospacer
* ********* ** **********   **

888. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
gaagaccacggcggcgcgggcgccggcgcggc	Protospacer
**  . * ******* ****.**********

889. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 8, identity: 0.75 

atggagatcgtgccgtcgccgctgctgcgcca	CRISPR spacer
tcggctatcgtcccgtcggcgctgctgcgctg	Protospacer
 .**  ***** ****** ***********..

890. spacer 33.5|6446597|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75 

ggtgacccgtaccacccggccgccgcgttgac--	CRISPR spacer
cgacacccgcaccacccggtcgccgcg--gatcg	Protospacer
 *  *****.*********.*******  **.

891. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gttcgtggtcgcggcgttcggggcgctgatcg	Protospacer
 *  . .****** ********.*********

892. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_016021 (Komagataeibacter medellinensis NBRC 3288 plasmid pGXY020, complete sequence) position: , mismatch: 8, identity: 0.75 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gatcct----cgtcgcgctgttcgtgacgctgatcc	Protospacer
    **     *******.***** **********

893. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 8, identity: 0.75 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gatcct----cgtcgcgctgttcgtgacgctgatcc	Protospacer
    **     *******.***** **********

894. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 8, identity: 0.75 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gatcct----cgtcgcgctgttcgtgacgctgatcc	Protospacer
    **     *******.***** **********

895. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 8, identity: 0.75 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gatcct----cgtcgcgctgttcgtgacgctgatcc	Protospacer
    **     *******.***** **********

896. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP021923 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-1) position: , mismatch: 8, identity: 0.75 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gatcct----cgtcgcgctgttcgtgacgctgatcc	Protospacer
    **     *******.***** **********

897. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP021512 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 plasmid pAP1342-3, complete sequence) position: , mismatch: 8, identity: 0.75 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gatcct----cgtcgcgctgttcgtgacgctgatcc	Protospacer
    **     *******.***** **********

898. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 8, identity: 0.75 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gatcct----cgtcgcgctgttcgtgacgctgatcc	Protospacer
    **     *******.***** **********

899. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_013211 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-020, complete sequence) position: , mismatch: 8, identity: 0.75 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gatcct----cgtcgcgctgttcgtgacgctgatcc	Protospacer
    **     *******.***** **********

900. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 8, identity: 0.75 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
gatcct----cgtcgcgctgttcgtgacgctgatcc	Protospacer
    **     *******.***** **********

901. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 8, identity: 0.75 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ctgcttagacgggccgttcgggacgctgagga	Protospacer
***   ** ** *****************  .

902. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
gtgagcgcgccgccgatgacgagccaccggcg	Protospacer
 .****.************.*******. *..

903. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgagcacgccgccgatgatgagc-----cacttgta	CRISPR spacer
ccgagcgcgccgccgatgatcagcagcggcgc-----	Protospacer
******.************* ***     *.*

904. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgagcacgcctccgatgaggagcgggtgttt	Protospacer
*********** ******* **** . *  *

905. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgagcacgccgccgatgatgagccac-ttgta	CRISPR spacer
ccgagcccgccgctgatgatgagttccgccgt-	Protospacer
****** ******.*********.. * ..**

906. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
cccagcccgccgccgatgatgagtacgtcgca	Protospacer
** *** ****************.   *.*.*

907. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to AP014194 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C71-MedDCM-OCT-S28-C33, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
acgagcaggccgccgatgctgagcatcgcgaa	Protospacer
 ****** ********** *****  * .* *

908. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MH338234 (Mycobacterium phage Crucio, complete genome) position: , mismatch: 8, identity: 0.758 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggcggctga	Protospacer
.   ..************************  *

909. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MH697591 (Mycobacterium phage QueenBeesly, complete genome) position: , mismatch: 8, identity: 0.758 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggcggctga	Protospacer
.   ..************************  *

910. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MT498060 (Mycobacterium Phage FiringLine, complete genome) position: , mismatch: 8, identity: 0.758 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggcggctga	Protospacer
.   ..************************  *

911. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to KM463009 (Mycobacterium phage Power, complete genome) position: , mismatch: 8, identity: 0.758 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggcggctga	Protospacer
.   ..************************  *

912. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MT498066 (Mycobacterium phage Georgie2, complete genome) position: , mismatch: 8, identity: 0.758 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggcggctga	Protospacer
.   ..************************  *

913. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MN234203 (Mycobacterium phage SemperFi, complete genome) position: , mismatch: 8, identity: 0.758 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggcggctga	Protospacer
.   ..************************  *

914. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MF919531 (Mycobacterium phage SnapTap, complete genome) position: , mismatch: 8, identity: 0.758 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggcggctga	Protospacer
.   ..************************  *

915. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NC_029043 (Mycobacterium phage SweetiePie, complete genome) position: , mismatch: 8, identity: 0.758 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggcggctga	Protospacer
.   ..************************  *

916. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 8, identity: 0.758 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
gatggacctggccgacgaggagctggcggcgcg	Protospacer
**. *   ********  **************.

917. spacer 33.13|6447086|31|CP023865|CRISPRCasFinder matches to DQ115813 (Cyanobacteria phage AS-1 contig_6 genomic sequence) position: , mismatch: 8, identity: 0.742 

gaccgcggcccggggttggcgtgtggcattg	CRISPR spacer
ctcggcggcccggggctggcgggtggcgctc	Protospacer
  * ***********.***** *****..*

918. spacer 33.16|6447268|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_010580 (Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence) position: , mismatch: 8, identity: 0.75 

atcggggcccggccgtggcgtgcccggtacgc	CRISPR spacer
ttcgggggccggccgtgccgtgcccccttgcc	Protospacer
 ****** ********* *******  *   *

919. spacer 33.17|6447329|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcgccgcaacgccccccggttcgcccgccc	CRISPR spacer
caccgccgcaacgccgcccagttcgcgcatca	Protospacer
*  ************ ***.****** *..*

920. spacer 33.18|6447390|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.75 

aggcgtgtcgttcgggtaagggtcgaacgtca	CRISPR spacer
cgtttcgtcgttcaggtaagggtcgaacgccg	Protospacer
 * . .*******.***************.*.

921. spacer 33.18|6447390|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.75 

aggcgtgtcgttcgggtaagggtcgaacgtca	CRISPR spacer
cgtttcgtcgttcaggtaagggtcgaacgccg	Protospacer
 * . .*******.***************.*.

922. spacer 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgttccggacggtcggggacctggccgacgc	CRISPR spacer
gtgcgcgagacggtcggggccctggccgccgg	Protospacer
*.*. * .*********** ******** **

923. spacer 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_048139 (Streptomyces phage Hiyaa, complete genome) position: , mismatch: 8, identity: 0.75 

gcgttccggacggtcggggacctggccgacgc	CRISPR spacer
gtgcgtctgacggtcgagaacctggccgacga	Protospacer
*.*. .* ********.*.************

924. spacer 33.21|6447573|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP040642 (Agrobacterium sp. T29 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtgagcctcgaactcacccatcgcgtcctt	CRISPR spacer
ttgtgagcctcgaactcggccatcttgttcac	Protospacer
 ****************. ***** .**.* .

925. spacer 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_LR134453 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence) position: , mismatch: 8, identity: 0.75 

tatgagggcctggaggcgtacgtccaggccca	CRISPR spacer
aacgaccccctggaggcgtacgcccatgcccg	Protospacer
 *.**   **************.*** ****.

926. spacer 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_047800 (Ralstonia virus phiAp1, complete genome) position: , mismatch: 8, identity: 0.75 

tatgagggcctggaggcgtacgtccaggccca	CRISPR spacer
tccaagggccttgaggcgtacgtgcagatgca	Protospacer
* ..******* *********** ***.. **

927. spacer 33.25|6447817|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP035418 (Leisingera sp. NJS204 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgacaacacggcttccaccggcccgcggaac	CRISPR spacer
ttgccaacacggtttccaccggctcgctcacc	Protospacer
 .* ********.**********.***  * *

928. spacer 33.25|6447817|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022543 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-3, complete sequence) position: , mismatch: 8, identity: 0.75 

-acgacaacacggcttccaccggcccgcggaac	CRISPR spacer
tgcggc-ctgcggctttcaccggctcgcggaac	Protospacer
 .**.*  ..******.*******.********

929. spacer 33.25|6447817|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgacaacacggcttccaccggcccgcggaac	CRISPR spacer
tcgacaacacgccttgcaccggccttcgcaca	Protospacer
 ********** *** ********. ** *

930. spacer 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 8, identity: 0.758 

tctcgaccaccgcggcggccgccgcttggcgcc	CRISPR spacer
tctcgaccgcggcggcggccgccggcgggaccg	Protospacer
********.* ************* . **  *

931. spacer 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 8, identity: 0.758 

tctcgaccaccgcggcggccgccgcttggcgcc	CRISPR spacer
acgccaccaccgcgtcggccgccgcatgggcgc	Protospacer
 * * ********* ********** ***   *

932. spacer 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR matches to MN329675 (Microbacterium phage SansAfet, complete genome) position: , mismatch: 8, identity: 0.758 

tctcgaccaccgcggcggccgccgcttggcgcc----	CRISPR spacer
tcacgtccaccgcggcggccgcc----gaggccaccg	Protospacer
** ** *****************    *. ***

933. spacer 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR matches to MT818427 (Microbacterium phage AnnaLie, complete genome) position: , mismatch: 8, identity: 0.758 

tctcgaccaccgcggcggccgccgcttggcgcc----	CRISPR spacer
tcacgtccaccgcggcggccgcc----gaggccaccg	Protospacer
** ** *****************    *. ***

934. spacer 33.30|6448123|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgctcgtaccgcttcgctgccgcctcgaacgg	CRISPR spacer
ggttagatccgcttcgccgccgcctcgagcga	Protospacer
 *.* *  *********.**********.**.

935. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgcgagcttttt	CRISPR spacer
ggcaccgacgcccggctcggcgctagctggag	Protospacer
* * *** *************** ****

936. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK524525 (Mycobacterium phage Ringer, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

937. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG944220 (Mycobacterium phage Ruotula, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

938. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK494116 (Mycobacterium phage Dulcie, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

939. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN234212 (Mycobacterium phage Paphu, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

940. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH001458 (Mycobacterium phage Smeagol, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

941. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

942. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN369760 (Mycobacterium phage KyMonks1A, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgcttcagggca----	Protospacer
********.* ************    *.**

943. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN585991 (Mycobacterium phage Snazzy, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

944. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH479919 (Mycobacterium phage Moose, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

945. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG925342 (Mycobacterium phage Forsytheast, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

946. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK359354 (Mycobacterium phage PinkPlastic, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

947. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH371110 (Mycobacterium phage Magnar, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

948. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG872836 (Mycobacterium phage Fajezeel, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

949. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK112540 (Mycobacterium phage Froghopper, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

950. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN585985 (Mycobacterium phage Watermelon, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

951. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_042326 (Mycobacterium virus KSSJEB, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

952. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN586000 (Mycobacterium phage Sagefire, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

953. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH632117 (Mycobacterium phage Homines, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

954. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG925344 (Mycobacterium phage Ichabod, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

955. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH576974 (Mycobacterium phage Sibs6, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

956. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK359299 (Mycobacterium phage Petp2012, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

957. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK359331 (Mycobacterium phage Rajelicia, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

958. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK524531 (Mycobacterium phage Rutherferd, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

959. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH744414 (Mycobacterium phage Arcanine, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

960. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN585997 (Mycobacterium phage Traft412, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

961. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgcttcagggca----	Protospacer
********.* ************    *.**

962. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KX574454 (Mycobacterium phage PacerPaul, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

963. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to EU826470 (Mycobacterium phage Solon, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

964. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG920060 (Mycobacterium phage Bob3, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

965. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH338239 (Mycobacterium phage Mryolo, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

966. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK524506 (Mycobacterium phage Zeuska, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgcttcagggca----	Protospacer
********.* ************    *.**

967. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG872833 (Mycobacterium phage BeesKnees, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

968. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KY224001 (Mycobacterium phage Blue, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

969. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MF919508 (Mycobacterium phage ILeeKay, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgcttcagggca----	Protospacer
********.* ************    *.**

970. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK967387 (Mycobacterium phage Big3, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

971. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KR080201 (Mycobacterium phage Nerujay, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

972. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to JN020140 (Mycobacterium virus MrGordo, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

973. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to EU744251 (Mycobacterium phage Jasper, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

974. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG925351 (Mycobacterium phage MPlant7149, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

975. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK820638 (Mycobacterium phage HermioneGrange, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

976. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to AY500153 (Mycobacteriophage Bethlehem, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

977. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK967401 (Mycobacterium phage Carlyle, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

978. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH590595 (Mycobacterium phage NEHalo, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

979. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK305893 (Mycobacterium phage Beatrix, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

980. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to JN572689 (Mycobacterium phage Perseus, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

981. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH338238 (Mycobacterium phage Michley, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgcttcagggca----	Protospacer
********.* ************    *.**

982. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KJ690250 (Mycobacterium phage Pinto, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

983. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_023862 (Mycobacterium phage Alsfro, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

984. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KM597531 (Mycobacterium phage Abrogate, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

985. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_023723 (Mycobacterium phage Aeneas, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

986. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH000606 (Mycobacterium phage Fascinus, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

987. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN617845 (Mycobacterium phage BaconJack, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

988. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_028941 (Mycobacterium phage Turj99, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgcttcagggca----	Protospacer
********.* ************    *.**

989. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK359312 (Mycobacterium phage Fushigi, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

990. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KF493880 (Mycobacterium phage HanShotFirst, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

991. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN585970 (Mycobacterium phage Killigrew, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

992. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH450133 (Mycobacterium phage SwissCheese, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

993. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN428054 (Mycobacterium phage JackSparrow, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

994. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH651180 (Mycobacterium phage Maroc7, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

995. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_022329 (Mycobacterium phage PhrostyMug, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

996. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN813700 (Mycobacterium phage Atkinbua, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

997. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_024136 (Mycobacterium phage Seabiscuit, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

998. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KF560331 (Mycobacterium phage Graduation, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

999. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MT639644 (Mycobacterium phage MaryBeth, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1000. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MT639654 (Mycobacterium phage Jerm2, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1001. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to JF937108 (Mycobacterium phage Switzer, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1002. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to JN660814 (Mycobacterium phage Dreamboat, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1003. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG812486 (Mycobacterium phage Acme, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1004. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_031067 (Mycobacterium phage Makemake, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1005. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH669011 (Mycobacterium phage PherrisBueller, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1006. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to JF937103 (Mycobacterium virus Museum, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1007. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to JF937099 (Mycobacterium virus JC27, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1008. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK359300 (Mycobacterium phage AFIS, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1009. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH230876 (Mycobacterium phage ConceptII, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1010. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH450113 (Mycobacterium phage BigMau, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1011. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1012. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_042327 (Mycobacterium virus BBPiebs31, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1013. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KY213952 (Mycobacterium phage Petruchio, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1014. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG812495 (Mycobacterium phage Pippin, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1015. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KF279416 (Mycobacterium phage SargentShorty9, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1016. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to JQ698665 (Mycobacterium phage Nepal, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1017. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG812489 (Mycobacterium phage Greg, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1018. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MT310897 (Mycobacterium phage Manatee, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1019. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK310142 (Mycobacterium phage MetalQZJ, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1020. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1021. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH020244 (Mycobacterium phage Lopton, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1022. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to KT259047 (Mycobacterium phage Rufus, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1023. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_009878 (Mycobacterium phage Bethlehem, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1024. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH513971 (Mycobacterium phage Hope4ever, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1025. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH450130 (Mycobacterium phage Rohr, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1026. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK112530 (Mycobacterium phage BigPaolini, complete genome) position: , mismatch: 8, identity: 0.75 

gtccccgccgcccggctcggcgc----gagcttttt	CRISPR spacer
gtccccgctgaccggctcggcgctccagggca----	Protospacer
********.* ************    *.**

1027. spacer 33.32|6448245|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 8, identity: 0.75 

tacctcggaccgtgcggagccgacctcagcct	CRISPR spacer
gcctgcggaccggtcggagccgacctcatgct	Protospacer
  *. *******  **************  **

1028. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.75 

gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
acgcccgcgatgttgctcgcgatgcgcggagc	Protospacer
..************** *****.** * *. *

1029. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
gtgcccgcgttgttgagcgcgacgagttgccc	Protospacer
********* ***** ********  ..* .*

1030. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK737944 (Microbacterium phage Warren, complete genome) position: , mismatch: 8, identity: 0.75 

gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
gtgcccgcgatgttgtacgcgacgtactgccg	Protospacer
***************..*******. *.* .

1031. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gtgcccgcgatgttgcgcgcgacg--ccccggtc	CRISPR spacer
ctgcccgccatgttgcgcgcggcgttttccag--	Protospacer
 ******* ************.**  ..**.*

1032. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.75 

-gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
agcgttt-cgatgatgcgcgcgacgccctggac	Protospacer
 *.*... ***** **************.** *

1033. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 8, identity: 0.75 

gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
ccgaccgcgatggtgcgcgccacgcccagttt	Protospacer
 .* ******** ******* ****** * *.

1034. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 8, identity: 0.75 

-gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
agcgttt-cgatgatgcgcgcgacgccctggac	Protospacer
 *.*... ***** **************.** *

1035. spacer 33.34|6448367|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP039900 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877b, complete sequence) position: , mismatch: 8, identity: 0.75 

gaccacttccagccggccagcttctccttcag	CRISPR spacer
gtcgttgaccagcccgccagctgctccttcag	Protospacer
* *  .  ****** ******* *********

1036. spacer 33.34|6448367|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP039891 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499b, complete sequence) position: , mismatch: 8, identity: 0.75 

gaccacttccagccggccagcttctccttcag	CRISPR spacer
gtcgttgaccagcccgccagctgctccttcag	Protospacer
* *  .  ****** ******* *********

1037. spacer 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 8, identity: 0.75 

gaccactccgtgatccgctcggcgagcgtgcc	CRISPR spacer
acgagctgcgtgatccggtcggcgagcgtgac	Protospacer
.   .** ********* ************ *

1038. spacer 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75 

gaccactccgtgatccgctcggcgagcgtgcc	CRISPR spacer
gtcagctccgtgagccgctcggccagcggccg	Protospacer
* * .******** ********* ****  *

1039. spacer 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75 

ttgtccaggaactcccgtgccgcgtctgcgct	CRISPR spacer
ctgccgaggaactcccgtgccgcgtcgaggga	Protospacer
.**.* ******************** . *

1040. spacer 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75 

ttgtccaggaactcccgtgccgcgtctgcgct	CRISPR spacer
ctgccgaggaactcccgtgccgcgtcgaggga	Protospacer
.**.* ******************** . *

1041. spacer 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75 

ttgtccaggaactcccgtgccgcgtctgcgct	CRISPR spacer
ctgccgaggaactcccgtgccgcgtcgaggga	Protospacer
.**.* ******************** . *

1042. spacer 33.41|6448794|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgaagtccatgtcggcgtcctggtcaagaag	CRISPR spacer
ttaacgccaatggcggcgtcctgggcaagaag	Protospacer
...* *.* *** *********** *******

1043. spacer 33.41|6448794|32|CP023865|CRISPRCasFinder,PILER-CR matches to MG962360 (Microbacterium phage AlexAdler, complete genome) position: , mismatch: 8, identity: 0.75 

ccgaagtccatgtcggcgtcctggtcaagaag	CRISPR spacer
tcgaagcccatgtcggcgacctggctgcgcag	Protospacer
.*****.*********** *****... * **

1044. spacer 33.44|6448977|33|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_KY000048 (Agrobacterium rhizogenes strain CFBP2746 plasmid pTi_CFBP2746, complete sequence) position: , mismatch: 8, identity: 0.758 

cagccgggccttcagctcggtcgggacggtgaa	CRISPR spacer
ctcccgggccttcagatcggtcggaacgggttt	Protospacer
*  ************ ********.****

1045. spacer 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccaccgtgacgcccagctgcgcgctgtc	CRISPR spacer
aaggccacggtgacgcccagctccgcataggc	Protospacer
 .****** ************* ***.. * *

1046. spacer 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 8, identity: 0.75 

--cgggccaccgtgacgcccagctgcgcgctgtc	CRISPR spacer
agcaggt--ccgtgacgccgagctgcgcgatgca	Protospacer
  *.**.  ********** ********* **.

1047. spacer 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggccaccgtgacgcccagctgcgcgctgtc----	CRISPR spacer
agggccgccgtgtcgcccagct----gctgccgaag	Protospacer
 *****.***** *********    ****.*

1048. spacer 34.1|6458631|32|CP023865|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.75 

gggtagacccgcagatggtcacgatgaacaga	CRISPR spacer
aggccagcccgccgatgatcacgatgaacagg	Protospacer
.**. ..***** ****.*************.

1049. spacer 34.2|6458692|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032687 (Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence) position: , mismatch: 8, identity: 0.75 

tgatcgaggatgttgcggacgacgtgcagcgc	CRISPR spacer
cgatcgaggattttgctgacgacgtagcgtgg	Protospacer
.********** **** ********.  *.*

1050. spacer 34.2|6458692|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032692 (Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence) position: , mismatch: 8, identity: 0.75 

tgatcgaggatgttgcggacgacgtgcagcgc	CRISPR spacer
cgatcgaggattttgctgacgacgtagcgtgg	Protospacer
.********** **** ********.  *.*

1051. spacer 34.2|6458692|32|CP023865|CRISPRCasFinder,CRT matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 8, identity: 0.75 

tgatcgaggatgttgcggacgacgtgcagcgc	CRISPR spacer
cgatcgaggattttgctgacgacgtagcgtgg	Protospacer
.********** **** ********.  *.*

1052. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcaggaccagcggcaccggtggggtcgg	Protospacer
******** *********.****. .**. .*

1053. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gctccgagcaccggccgcgccggccaggcggc	Protospacer
**  . ******.** **************.

1054. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gctccgagcaccggccgcgccggccaggcggc	Protospacer
**  . ******.** **************.

1055. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.75 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gccttcaccaccaccggcgccggccagcgaac	Protospacer
**  *** ***** *************  .*

1056. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg	Protospacer
.. * *.**********.****** ***** *

1057. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg	Protospacer
.. * *.**********.****** ***** *

1058. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gcggtcaggaccagcggcaccggtggggtcgg	Protospacer
******** *********.****. .**. .*

1059. spacer 34.4|6458814|32|CP023865|CRISPRCasFinder,CRT matches to CP053919 (Serratia marcescens strain LY1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

agggccaggcactccaccgcctccggtaccca	CRISPR spacer
aaataccggcactccaccgcctccggtcccgg	Protospacer
*..  * ******************** ** .

1060. spacer 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP005961 (Pseudomonas mandelii JR-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gcagcaacggcacctacacgctggc----caccaag	CRISPR spacer
gcagcgacggcagctacacgctggtggaacgc----	Protospacer
*****.****** ***********.    *.*

1061. spacer 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 8, identity: 0.75 

gcagcaacggcacctacacgctggccaccaag	CRISPR spacer
gcaacgacggcacctacacgctgcgcgctgtg	Protospacer
***.*.*****************  *.*.. *

1062. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to LR606152 (Rhizobium sp. Q54 genome assembly, plasmid: 9) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
attggcggcggcatcgtcggcggcgtgctcgg	Protospacer
  .. *.***.**.******************

1063. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gacgtcaacgacagcgtcggcggcgtgctgtt	Protospacer
 .*.***.***** ***************

1064. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gctctcgacgacaccgacggcggcgtgctcgc	Protospacer
  . **..******** **************

1065. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1066. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1067. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1068. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1069. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1070. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1071. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1072. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1073. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1074. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1075. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1076. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1077. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1078. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1079. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1080. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1081. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1082. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1083. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1084. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1085. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1086. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1087. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1088. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1089. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1090. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1091. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1092. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1093. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1094. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1095. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1096. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1097. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1098. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1099. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1100. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1101. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1102. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1103. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1104. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1105. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1106. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1107. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1108. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1109. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1110. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1111. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
atcgccggcgacagcgtcggcggcctgctcgc	Protospacer
  *..*.****** ********** ******

1112. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gggggcttcgtctccgtcggcggcgtgctcgg	Protospacer
 * . *  ** * *******************

1113. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NC_026603 (Mycobacterium phage Keshu, complete genome) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agtcacggcgacaccgtcggcggcctgatcgc	Protospacer
 *.  *.***************** ** ***

1114. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NC_023498 (Mycobacterium phage Validus, complete genome) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
aacgtgggcgacaccgtgggcggcgtgatcgc	Protospacer
 .*.* .********** ********* ***

1115. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcag--cgacaccgtcggcggcgtgctcgg	CRISPR spacer
--gtccagttcgacaccggcagcggcgtgctcgc	Protospacer
    .***  ******** *.************

1116. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gccttcgccggcaccgtcggcggcctgctcgc	Protospacer
  * **. **.************* ******

1117. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccacggcgacaccgtgggcggcgtgatcac	Protospacer
 **  *.********** ********* **.

1118. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MH744418 (Streptomyces phage JustBecause, complete genome) position: , mismatch: 8, identity: 0.75 

--tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gccgcact--cgccaccgtcggcggagtgctcgt	Protospacer
  .***..  ** ************ *******

1119. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MF324915 (Mycobacterium phage Amgine, complete genome) position: , mismatch: 8, identity: 0.75 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agccacggcgacaccgtgggcggcgtgatcac	Protospacer
 **  *.********** ********* **.

1120. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MT310898 (Streptomyces phage Kela, complete genome) position: , mismatch: 8, identity: 0.75 

--tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gccgcact--cgccaccgtcggcggagtgctcgt	Protospacer
  .***..  ** ************ *******

1121. spacer 34.8|6459059|33|CP023865|CRISPRCasFinder,CRT matches to MN908686 (Microbacterium phage Zepp, complete genome) position: , mismatch: 8, identity: 0.758 

agcagaccgtgggcggccctggctcgggcgtac	CRISPR spacer
ggcgcgccgggggcggcgctggctcgggcgtgg	Protospacer
.**. .*** ******* *************.

1122. spacer 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgtccgccaggaagttgtgcggatcgtcggc	CRISPR spacer
atttccgacaggaagttctgcggatcgaagac	Protospacer
 . **** ********* *********  *.*

1123. spacer 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgtccgccaggaagttgtgcggatcgtcggc	CRISPR spacer
tcgacaatcaggaacttgagcggatcgtcgga	Protospacer
.** * ..****** *** ************

1124. spacer 34.12|6459304|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012265 (Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggcagccagtacgccgatgaacgacatgat	CRISPR spacer
gaggcagccagcacgccgataaacggggtaaa	Protospacer
* *********.********.****. .*.*

1125. spacer 34.12|6459304|32|CP023865|CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggcagccagtacgccgatgaacgacatgat	CRISPR spacer
ccggcggccagttcgccgatgaactccaccag	Protospacer
 ****.****** ***********  **. *

1126. spacer 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctcagcaggatgaacggctcgcagccaga	CRISPR spacer
tggcgcagcagggtgaacggctcggcccacgg	Protospacer
**** *******.***********   *  *.

1127. spacer 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctcagcaggatgaacggctcgcagccaga	CRISPR spacer
tggcgcagcagggtgaacggctcggcccacgg	Protospacer
**** *******.***********   *  *.

1128. spacer 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctcagcaggatgaacggctcgcagccaga	CRISPR spacer
tgcatcagcaggctgaacggcacgcagctgtt	Protospacer
**  ******** ******** ******..

1129. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021368 (Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence) position: , mismatch: 8, identity: 0.75 

accacgctcaaggacgtgcccggcgcgaacat	CRISPR spacer
aaaccctacaaggacgtgcccggcacgaccat	Protospacer
*   * . ****************.*** ***

1130. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021364 (Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence) position: , mismatch: 8, identity: 0.75 

accacgctcaaggacgtgcccggcgcgaacat	CRISPR spacer
aaaccctacaaggacgtgcccggcacgaccat	Protospacer
*   * . ****************.*** ***

1131. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

-accacgctcaaggacgtgcccggcgcgaacat	CRISPR spacer
cgtcgagc-gaaggacgtggccggcgcgaagat	Protospacer
 ..*. **  ********* ********** **

1132. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to NC_009939 (Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence) position: , mismatch: 8, identity: 0.75 

accacgctcaaggacgtgcccggcgcgaacat	CRISPR spacer
gcggcgggcaaggacgtgaccggcgcgagcac	Protospacer
.* .**  ********** *********.**.

1133. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75 

accacgctcaaggacgtgcccggcgcgaacat	CRISPR spacer
aacacgctcaaggacatggccggcgtggtgaa	Protospacer
* *************.** ******.*.  *

1134. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to MF140427 (Arthrobacter phage Shrooms, complete genome) position: , mismatch: 8, identity: 0.75 

accacgctcaaggacgtgcccggcgcgaacat-	CRISPR spacer
ctcacgctcacggacgtgcccgccg-gggcgtg	Protospacer
 .******** *********** ** *..*.*

1135. spacer 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT matches to NC_010518 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD05, complete sequence) position: , mismatch: 8, identity: 0.75 

gacgcgccgagcatcgcggtcgggatgatgcg	CRISPR spacer
tgcgcgccgatcatcgcggtagggatggagat	Protospacer
 .******** ********* ******. *

1136. spacer 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 8, identity: 0.75 

gacgcgccgagcatcgcggtcgggatgatgcg	CRISPR spacer
accgcgccgatcatcgcggtccggatgccggt	Protospacer
. ******** ********** ***** .*

1137. spacer 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP014707 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_3p, complete sequence) position: , mismatch: 8, identity: 0.75 

gacgcgccgagcatcgcggtcgggatgatgcg	CRISPR spacer
gcggcgccgagcaacgcggtggggatgcgggt	Protospacer
*  ********** ****** ******  *

1138. spacer 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT matches to MH617132 (Microviridae sp. isolate ctcg164, complete genome) position: , mismatch: 8, identity: 0.75 

ctgccctg------ttcgccggggttgatgttgaacct	CRISPR spacer
------tgcaggaattcgccagggttgttgttgaacct	Protospacer
      **      ******.****** **********

1139. spacer 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT matches to KX670786 (Arthrobacter phage Chubster, complete genome) position: , mismatch: 8, identity: 0.75 

ctgccctgttcgccggggttgatgttgaacct--	CRISPR spacer
ttgcattgttcgccggggttgatg--ggtcttat	Protospacer
.*** .******************  *. *.*

1140. spacer 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT matches to MN234234 (Arthrobacter phage Lymara, complete genome) position: , mismatch: 8, identity: 0.75 

ctgccctgttcgccggggttgatgttgaacct--	CRISPR spacer
ttgcattgttcgccggggttgatg--ggtcttat	Protospacer
.*** .******************  *. *.*

1141. spacer 34.22|6459915|32|CP023865|CRISPRCasFinder,CRT matches to NC_008242 (Chelativorans sp. BNC1 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

gacgatgcggacgctggcgagtgggaggacga	CRISPR spacer
accgatgcggacgccgccgagtgggaataagg	Protospacer
. ************.* *********. * *.

1142. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 8, identity: 0.75 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
agatcatcgcgcagatgcagcgcgatgcggcc	Protospacer
.* * .***** * ****************

1143. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
agcgcgtcgccgacatgctgcgcgatgccacg	Protospacer
.**  ***** ******* ********* . *

1144. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 8, identity: 0.75 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
gtttcaacgccgacctgcagcgcgatgcggcg	Protospacer
* .* . *** *** *************** *

1145. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
cggacggcgacggccggctcgtcgagcagccc	Protospacer
*** *********** ******** * . ..*

1146. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
cggccggcgacggtcggctcgtcggcgaggcc	Protospacer
*************.* ********  *.  .*

1147. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccggcgacggcccgctcgtcgcgggtttc---	CRISPR spacer
agggcggcgacggcccgcacgtcgc---cctccga	Protospacer
 ** ************** ******   ..**

1148. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to KU958700 (Streptomyces phage Chymera, complete genome) position: , mismatch: 8, identity: 0.75 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
ggaacggcgacggccccctcgtcgagggggcc	Protospacer
 *. ************ ******* ***  .*

1149. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NZ_LR134467 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
cgctcggcgtcggcgcgctcgtcgcggccggc	Protospacer
** .***** **** ************ .  *

1150. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
cggtcggcgacggtccgctcgtcctgcggcgc	Protospacer
***.*********.********* .* * . *

1151. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
cggtcggcgacggtccgctcgtcctgcggcgc	Protospacer
***.*********.********* .* * . *

1152. spacer 34.27|6460220|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

aaccgcacgaacccgagggcaaggaatccttc	CRISPR spacer
tggcgcaggaacccgaggtcaaggaaagctac	Protospacer
 . **** ********** *******  ** *

1153. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
gctcacgaacagggtcgccggccagcgcagcc	Protospacer
*    ***.********************

1154. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1155. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1156. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1157. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1158. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
gaagccgaccagggtcgccggccagagcggca	Protospacer
*..*.*** **************** **.  *

1159. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1160. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1161. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1162. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1163. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1164. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga---	CRISPR spacer
agggtcgagcagggtcgggggccaac---cgggtc	Protospacer
.****************  *****.*   **.

1165. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1166. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1167. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1168. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 8, identity: 0.75 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcgcgcagcagcggcgccggccagcgcaccg	Protospacer
** *.  ***** * *************** .

1169. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to MN204493 (Streptomyces phage Zuko, complete genome) position: , mismatch: 8, identity: 0.75 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
cggttcgactgctccgggctcatgctgtactc	Protospacer
  ****************** **** **.  .

1170. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP041606 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gccggccactgctccgggttgatgccgtggcg	Protospacer
**   * ***********.****** ****

1171. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009113 (Rhodococcus opacus strain 1CP plasmid pR1CP2, complete sequence) position: , mismatch: 8, identity: 0.75 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
taccccgggacgttcaccgacgccagaaccga	Protospacer
*********.*********.****  .  **

1172. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
gagcgcggcgcgttcaccggcgcgctgcagcg	Protospacer
 * * *** ************** *****

1173. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
ctgtccggggcgttggccggcgccctgctcct	Protospacer
.  .********** .************ * *

1174. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
ctgtccggggcgttggccggcgccctgctcct	Protospacer
.  .********** .************ * *

1175. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
ggcaccgggacgctcaccggcgccctgcggga	Protospacer
 .* *****.**.***************. *

1176. spacer 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.75 

tacgtcgcgggcgtggcgggctggtcgattga	CRISPR spacer
gcgggggcgggtgcggcgggctggtcgattgt	Protospacer
   *  *****.*.*****************

1177. spacer 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

tacgtcgcg------ggcgtggcgggctggtcgattga	CRISPR spacer
------gcgggggatggcgtggcgggctggtcgttgga	Protospacer
      ***      ****************** * **

1178. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_048021 (Gordonia phage Daredevil, complete genome) position: , mismatch: 8, identity: 0.758 

ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
gagggtcagcgccgcgagctgggcggtggtgcg	Protospacer
*.. . ************* *.**********

1179. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 8, identity: 0.758 

ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
cgccagcagcgcggcgagcagggcggtgttaat	Protospacer
 * ********* ********.****** *. .

1180. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758 

-ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
cgcgccg-agcgccgcgcgcagtgcggtggtgag	Protospacer
 * .* * ********* **** *********

1181. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758 

-ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
cgcgccg-agcgccgcgcgcagtgcggtggtgag	Protospacer
 * .* * ********* **** *********

1182. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758 

ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
cgacagcagcgccgcgaccagggcgaaggccac	Protospacer
 **************** ***.***. **.  *

1183. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75 

ggcaccaccgtcgacctgtccgggatcgggct	CRISPR spacer
ggcaccaccatcgacctctccggactggcggg	Protospacer
*********.******* *****. * * *

1184. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75 

ggcaccaccgtcgacctgtccgggatcgggct	CRISPR spacer
ggcaccaccatcgacctctccggactggcggg	Protospacer
*********.******* *****. * * *

1185. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

ggcaccaccgtcgacctgtccgggatcgggct	CRISPR spacer
gccgaaccggtcgacctgaccgggaccgggct	Protospacer
* *.   * ********* ******.******

1186. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

ggcaccaccgtcgacctgtccgggatcgggct	CRISPR spacer
gccgaaccggtcgacctgaccgggaccgggct	Protospacer
* *.   * ********* ******.******

1187. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

----ggcaccaccgtcgacctgtccgggatcgggct	CRISPR spacer
tcctggc----tggtcgacctctccgggatcgagct	Protospacer
    ***    . ******** **********.***

1188. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
atcctcatcctcggtatcgtcggtgccccaat	Protospacer
*. ** ********.***********. **.

1189. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.75 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
atcctcatcctcggtatcgtcggtgccccaat	Protospacer
*. ** ********.***********. **.

1190. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to MG945435 (UNVERIFIED: Microviridae sp. isolate 5111-1801, complete genome) position: , mismatch: 8, identity: 0.75 

acgctg-atcctcggcatcgtcggtgctgcagg	CRISPR spacer
-cgtgatatcctcggcatcatcggtgatgctgc	Protospacer
 **. . ************.****** *** *

1191. spacer 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032625 (Gryllotalpicola sp. 2DFW10M-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
ggcgtccagtcggtcaccgggttctggtcgga	Protospacer
*  *.*. *************** **** **

1192. spacer 34.39|6460953|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 8, identity: 0.75 

cggtggtcgacggccttacggccggagtgaca	CRISPR spacer
cggtggtcgacggcgttacggccgcaagccgg	Protospacer
************** ********* *.    .

1193. spacer 34.39|6460953|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 8, identity: 0.75 

cggtggtcgacggccttacggccggagtgaca	CRISPR spacer
cggtggtcgacggcgttacggccgcaagccgg	Protospacer
************** ********* *.    .

1194. spacer 34.39|6460953|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75 

cggtggtcgacggccttacggccg--gagtgaca	CRISPR spacer
aggtggtcgacggcctggcggccgtcgaccgg--	Protospacer
 *************** .******  ** .*.

1195. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021406 (Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ccgacccggcgtcagcgccggacgaattgcgt	Protospacer
.**************  *******  .. ***

1196. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
acgaggtcgccggggcaggcgtcgccgccgac	Protospacer
****************.** **** .* .*.

1197. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
tcgaggtcgccggcgagggggtcgcctacgcg	Protospacer
 ************ * ******** . *.* *

1198. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75 

acgaggt----cgccggggcgggggtcggtgatggg	CRISPR spacer
----ggtctcccgccggggcggggttcggtggtgtc	Protospacer
    ***    ************* ******.**

1199. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to KY130461 (Mycobacterium phage Taptic, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1200. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to MH001446 (Mycobacterium phage Megabear, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1201. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to MK967402 (Mycobacterium phage NihilNomen, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggccgccggcgcgggggtcgtatatgtc	Protospacer
 *****.****** **********   ***

1202. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to AP018462 (Mycobacterium phage D12 DNA, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1203. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to MK494131 (Mycobacterium phage GodPhather, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1204. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to MK494114 (Mycobacterium phage Argie, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1205. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to MK494132 (Mycobacterium phage Cepens, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1206. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to AP018463 (Mycobacterium phage PR DNA, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1207. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to MH001450 (Mycobacterium phage Jeon, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1208. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to MN183286 (Mycobacteriophage Yeet, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggccgccggcgcgggggtcgtatatgtc	Protospacer
 *****.****** **********   ***

1209. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggccgccggcgcgggggtcgtatatgtc	Protospacer
 *****.****** **********   ***

1210. spacer 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT matches to NC_023600 (Mycobacterium phage Jolie1, complete genome) position: , mismatch: 8, identity: 0.75 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
ggcggatccgccgggtagtcggggcagtcgtc	Protospacer
**   . ********.**** **********.

1211. spacer 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.75 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
aaggtggccgtcgggcagtccggccaggaggt	Protospacer
..* ******.************ ***  * *

1212. spacer 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.75 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
aaggtggccgtcgggcagtccggccaggaggt	Protospacer
..* ******.************ ***  * *

1213. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.758 

cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
gtcaaggacctgaagatcaccgatgcgcagggc	Protospacer
   * *. ** ************* ********

1214. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to NC_011165 (Pseudomonas phage LBL3, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1215. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MT119375 (Pseudomonas phage chumba, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1216. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MT119364 (Pseudomonas phage elmo, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1217. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to FM201281 (Pseudomonas phage LBL3 complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1218. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to KU198331 (Pseudomonas phage NP3, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1219. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to NC_007810 (Pseudomonas phage F8, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1220. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MT119374 (Pseudomonas phage antinowhere, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1221. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to GU815091 (Pseudomonas phage JG024, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagctg	Protospacer
  **.*  ***** **** *************

1222. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MT119372 (Pseudomonas phage cory, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1223. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MT119370 (Pseudomonas phage steven, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1224. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MT108726 (Pseudomonas phage Epa6, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1225. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to KF981875 (Pseudomonas phage SPM-1, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1226. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to NC_050151 (Pseudomonas phage crassa, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1227. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MT119378 (Pseudomonas phage datas, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1228. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to JQ067083 (UNVERIFIED: Pseudomonas phage PaMx13, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1229. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to DQ163917 (Bacteriophage F8, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1230. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to NC_048745 (Pseudomonas phage vB_PaeM_SCUT-S1, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1231. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to NC_026600 (Pseudomonas phage vB_PaeM_C1-14_Ab28, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1232. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MN508620 (UNVERIFIED: Pseudomonas phage E2005-24-39, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1233. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MN871454 (UNVERIFIED: Pseudomonas phage Pa-A, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1234. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MN564818 (Pseudomonas phage DRL-P1, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1235. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MT118303 (Pseudomonas phage Epa39, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1236. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to NC_028745 (Pseudomonas phage DL60, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1237. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to MK317959 (Pseudomonas phage EPa61, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1238. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to NC_048626 (Pseudomonas phage PA01 DNA, nearly complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1239. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to KR054028 (Pseudomonas phage DL52, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1240. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NC_014911 (Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence) position: , mismatch: 8, identity: 0.75 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
cccgccgacaccgcgcgcagctcgtcggtcgg	Protospacer
 **  .****************** **.**.

1241. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NC_006823 (Aromatoleum aromaticum EbN1 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
cccgccgacaccgcgcgcagctcgtcggtcgg	Protospacer
 **  .****************** **.**.

1242. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

acccgtga----caccgcgcgcagctcggcgatcac	CRISPR spacer
----gtggtgttcaccgcgcgcagatcgtcgatcag	Protospacer
    ***.    ************ *** ******

1243. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagc---aggacgcgaagaagcggatcggcta	CRISPR spacer
---cggctcgaggacgcgacgaagcggctcggcca	Protospacer
    .**   ********* ******* *****.*

1244. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to AM261282 (Uncultured bacterium IncP-1 plasmid pKJK5 complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1245. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP028340 (Thauera aromatica K172 plasmid pKJK172, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1246. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to KC964605 (Uncultured bacterium plasmid pMLUA1, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1247. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to KC964606 (Uncultured bacterium plasmid pMLUA3, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1248. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to KC964607 (Uncultured bacterium plasmid pMLUA4, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1249. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to JQ004406 (Uncultured bacterium plasmid pHH128, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1250. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to JQ004407 (Uncultured bacterium plasmid pHH3408, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1251. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to JQ004408 (Uncultured bacterium plasmid pHH3414, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1252. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to JQ004409 (Uncultured bacterium plasmid pKS77, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1253. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to NZ_MN366356 (Bacterium plasmid pALTS27, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1254. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to NZ_MN366360 (Bacterium plasmid pALTS32, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1255. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gaaggcaccgtcaccgcgggcgcggcgaccat	Protospacer
  .**************** ******* * ..

1256. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
aaaagcgccgtcaccgcggtcgccgcgctgcc	Protospacer
  ..**.**************** ****.* *

1257. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1258. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gagggcaccgtcaccgcgggtgcggcgaccat	Protospacer
  ***************** .****** * ..

1259. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1260. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1261. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1262. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1263. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1264. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1265. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1266. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1267. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1268. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1269. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ccggaccccgtcaccgcggtcgccagattggc	Protospacer
****.* **************** . ...***

1270. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gcgggcaccatcaccgtggtcgcggtgatgat	Protospacer
 ********.******.********.* .*..

1271. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
tcctgcaccgtcatcgcggccgcggcgttggt	Protospacer
.*  *********.*****.*******..**.

1272. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gagcgcaccgtcaccgcggtcgggtcgctgct	Protospacer
  * ****************** * ***.* .

1273. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gcgggcaccatcaccgtggtcgcggtgatgat	Protospacer
 ********.******.********.* .*..

1274. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gccggcgccgtcaccgcggtcgtggccaccgt	Protospacer
 * ***.***************.***  * *.

1275. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gcctacaccgtcaccgccctcgcggcgctcgc	Protospacer
 *  .************  *********. **

1276. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP011046 (Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI3, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgt--caccgcggtcgcggcgccggc	CRISPR spacer
--ggctaccacggccccgcggtcgcggcgccggg	Protospacer
  ** .***..  * ******************

1277. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agggcgaaggtcgccgccgtcgcggcgccggc	Protospacer
  **  *  ***.**** **************

1278. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021037 (Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI3, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgt--caccgcggtcgcggcgccggc	CRISPR spacer
--ggctaccacggccccgcggtcgcggcgccggg	Protospacer
  ** .***..  * ******************

1279. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ccggaccccgtcaccgcggtcgccagattggc	Protospacer
****.* **************** . ...***

1280. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 8, identity: 0.75 

ccgggcacc--gtcaccgcggtcgcggcgccggc	CRISPR spacer
--gaccgtcgtgtcgccgcggtcgcggccccggc	Protospacer
  *. *..*  ***.************* *****

1281. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tggccggcatcgtcatgtcgatgctggccacg	Protospacer
 * .****************.******  *.

1282. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 8, identity: 0.75 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tgttcggcatcatcaagtcggtgctgggcttt	Protospacer
 *.********.*** ***********.  *.

1283. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
cgggcgccatcgtcacgtcggtgctggacagg	Protospacer
 *  ** ********.************ *

1284. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75 

agctcggcatcgtcatgtcggtgctggagatc---	CRISPR spacer
cgctcggcatcgacatctcggtgc---agccctat	Protospacer
 *********** *** *******   ** .*

1285. spacer 34.54|6460897|32|CP023865|PILER-CR matches to NZ_CP032625 (Gryllotalpicola sp. 2DFW10M-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
ggcgtccagtcggtcaccgggttctggtcgga	Protospacer
*  *.*. *************** **** **

1286. spacer 34.55|6460958|32|CP023865|PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 8, identity: 0.75 

cggtggtcgacggccttacggccggagtgaca	CRISPR spacer
cggtggtcgacggcgttacggccgcaagccgg	Protospacer
************** ********* *.    .

1287. spacer 34.55|6460958|32|CP023865|PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 8, identity: 0.75 

cggtggtcgacggccttacggccggagtgaca	CRISPR spacer
cggtggtcgacggcgttacggccgcaagccgg	Protospacer
************** ********* *.    .

1288. spacer 34.55|6460958|32|CP023865|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75 

cggtggtcgacggccttacggccg--gagtgaca	CRISPR spacer
aggtggtcgacggcctggcggccgtcgaccgg--	Protospacer
 *************** .******  ** .*.

1289. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NZ_CP021406 (Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ccgacccggcgtcagcgccggacgaattgcgt	Protospacer
.**************  *******  .. ***

1290. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
acgaggtcgccggggcaggcgtcgccgccgac	Protospacer
****************.** **** .* .*.

1291. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
tcgaggtcgccggcgagggggtcgcctacgcg	Protospacer
 ************ * ******** . *.* *

1292. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75 

acgaggt----cgccggggcgggggtcggtgatggg	CRISPR spacer
----ggtctcccgccggggcggggttcggtggtgtc	Protospacer
    ***    ************* ******.**

1293. spacer 34.57|6461080|32|CP023865|PILER-CR matches to KY130461 (Mycobacterium phage Taptic, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1294. spacer 34.57|6461080|32|CP023865|PILER-CR matches to MH001446 (Mycobacterium phage Megabear, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1295. spacer 34.57|6461080|32|CP023865|PILER-CR matches to MK967402 (Mycobacterium phage NihilNomen, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggccgccggcgcgggggtcgtatatgtc	Protospacer
 *****.****** **********   ***

1296. spacer 34.57|6461080|32|CP023865|PILER-CR matches to AP018462 (Mycobacterium phage D12 DNA, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1297. spacer 34.57|6461080|32|CP023865|PILER-CR matches to MK494131 (Mycobacterium phage GodPhather, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1298. spacer 34.57|6461080|32|CP023865|PILER-CR matches to MK494114 (Mycobacterium phage Argie, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1299. spacer 34.57|6461080|32|CP023865|PILER-CR matches to MK494132 (Mycobacterium phage Cepens, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1300. spacer 34.57|6461080|32|CP023865|PILER-CR matches to AP018463 (Mycobacterium phage PR DNA, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1301. spacer 34.57|6461080|32|CP023865|PILER-CR matches to MH001450 (Mycobacterium phage Jeon, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggtcgccgaggcggaggtcgtgcaggtg	Protospacer
 ***********.*****.*****   * * *

1302. spacer 34.57|6461080|32|CP023865|PILER-CR matches to MN183286 (Mycobacteriophage Yeet, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggccgccggcgcgggggtcgtatatgtc	Protospacer
 *****.****** **********   ***

1303. spacer 34.57|6461080|32|CP023865|PILER-CR matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 8, identity: 0.75 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgaggccgccggcgcgggggtcgtatatgtc	Protospacer
 *****.****** **********   ***

1304. spacer 34.59|6461202|32|CP023865|PILER-CR matches to NC_023600 (Mycobacterium phage Jolie1, complete genome) position: , mismatch: 8, identity: 0.75 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
ggcggatccgccgggtagtcggggcagtcgtc	Protospacer
**   . ********.**** **********.

1305. spacer 34.59|6461202|32|CP023865|PILER-CR matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.75 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
aaggtggccgtcgggcagtccggccaggaggt	Protospacer
..* ******.************ ***  * *

1306. spacer 34.59|6461202|32|CP023865|PILER-CR matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.75 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
aaggtggccgtcgggcagtccggccaggaggt	Protospacer
..* ******.************ ***  * *

1307. spacer 34.60|6461263|33|CP023865|PILER-CR matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.758 

cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
gtcaaggacctgaagatcaccgatgcgcagggc	Protospacer
   * *. ** ************* ********

1308. spacer 34.60|6461263|33|CP023865|PILER-CR matches to NC_011165 (Pseudomonas phage LBL3, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1309. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MT119375 (Pseudomonas phage chumba, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1310. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MT119364 (Pseudomonas phage elmo, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1311. spacer 34.60|6461263|33|CP023865|PILER-CR matches to FM201281 (Pseudomonas phage LBL3 complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1312. spacer 34.60|6461263|33|CP023865|PILER-CR matches to KU198331 (Pseudomonas phage NP3, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1313. spacer 34.60|6461263|33|CP023865|PILER-CR matches to NC_007810 (Pseudomonas phage F8, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1314. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MT119374 (Pseudomonas phage antinowhere, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1315. spacer 34.60|6461263|33|CP023865|PILER-CR matches to GU815091 (Pseudomonas phage JG024, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagctg	Protospacer
  **.*  ***** **** *************

1316. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MT119372 (Pseudomonas phage cory, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1317. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MT119370 (Pseudomonas phage steven, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1318. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MT108726 (Pseudomonas phage Epa6, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1319. spacer 34.60|6461263|33|CP023865|PILER-CR matches to KF981875 (Pseudomonas phage SPM-1, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1320. spacer 34.60|6461263|33|CP023865|PILER-CR matches to NC_050151 (Pseudomonas phage crassa, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1321. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MT119378 (Pseudomonas phage datas, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1322. spacer 34.60|6461263|33|CP023865|PILER-CR matches to JQ067083 (UNVERIFIED: Pseudomonas phage PaMx13, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1323. spacer 34.60|6461263|33|CP023865|PILER-CR matches to DQ163917 (Bacteriophage F8, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1324. spacer 34.60|6461263|33|CP023865|PILER-CR matches to NC_048745 (Pseudomonas phage vB_PaeM_SCUT-S1, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1325. spacer 34.60|6461263|33|CP023865|PILER-CR matches to NC_026600 (Pseudomonas phage vB_PaeM_C1-14_Ab28, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1326. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MN508620 (UNVERIFIED: Pseudomonas phage E2005-24-39, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1327. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MN871454 (UNVERIFIED: Pseudomonas phage Pa-A, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1328. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MN564818 (Pseudomonas phage DRL-P1, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1329. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MT118303 (Pseudomonas phage Epa39, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1330. spacer 34.60|6461263|33|CP023865|PILER-CR matches to NC_028745 (Pseudomonas phage DL60, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1331. spacer 34.60|6461263|33|CP023865|PILER-CR matches to MK317959 (Pseudomonas phage EPa61, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1332. spacer 34.60|6461263|33|CP023865|PILER-CR matches to NC_048626 (Pseudomonas phage PA01 DNA, nearly complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1333. spacer 34.60|6461263|33|CP023865|PILER-CR matches to KR054028 (Pseudomonas phage DL52, complete genome) position: , mismatch: 8, identity: 0.758 

--cggatgatccggaagatcaccgatccgcagggc	CRISPR spacer
accgaa--atccgcaagaacaccgatccgcagttg	Protospacer
  **.*  ***** **** *************

1334. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NC_014911 (Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence) position: , mismatch: 8, identity: 0.75 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
cccgccgacaccgcgcgcagctcgtcggtcgg	Protospacer
 **  .****************** **.**.

1335. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NC_006823 (Aromatoleum aromaticum EbN1 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
cccgccgacaccgcgcgcagctcgtcggtcgg	Protospacer
 **  .****************** **.**.

1336. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

acccgtga----caccgcgcgcagctcggcgatcac	CRISPR spacer
----gtggtgttcaccgcgcgcagatcgtcgatcag	Protospacer
    ***.    ************ *** ******

1337. spacer 34.63|6461448|32|CP023865|PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagc---aggacgcgaagaagcggatcggcta	CRISPR spacer
---cggctcgaggacgcgacgaagcggctcggcca	Protospacer
    .**   ********* ******* *****.*

1338. spacer 34.63|6461448|32|CP023865|PILER-CR matches to AM261282 (Uncultured bacterium IncP-1 plasmid pKJK5 complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1339. spacer 34.63|6461448|32|CP023865|PILER-CR matches to NZ_CP028340 (Thauera aromatica K172 plasmid pKJK172, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1340. spacer 34.63|6461448|32|CP023865|PILER-CR matches to KC964605 (Uncultured bacterium plasmid pMLUA1, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1341. spacer 34.63|6461448|32|CP023865|PILER-CR matches to KC964606 (Uncultured bacterium plasmid pMLUA3, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1342. spacer 34.63|6461448|32|CP023865|PILER-CR matches to KC964607 (Uncultured bacterium plasmid pMLUA4, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1343. spacer 34.63|6461448|32|CP023865|PILER-CR matches to JQ004406 (Uncultured bacterium plasmid pHH128, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1344. spacer 34.63|6461448|32|CP023865|PILER-CR matches to JQ004407 (Uncultured bacterium plasmid pHH3408, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1345. spacer 34.63|6461448|32|CP023865|PILER-CR matches to JQ004408 (Uncultured bacterium plasmid pHH3414, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1346. spacer 34.63|6461448|32|CP023865|PILER-CR matches to JQ004409 (Uncultured bacterium plasmid pKS77, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1347. spacer 34.63|6461448|32|CP023865|PILER-CR matches to NZ_MN366356 (Bacterium plasmid pALTS27, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1348. spacer 34.63|6461448|32|CP023865|PILER-CR matches to NZ_MN366360 (Bacterium plasmid pALTS32, complete sequence) position: , mismatch: 8, identity: 0.75 

atcaagcaggacgcgaagaagc-ggatcggcta	CRISPR spacer
tacaagcaggaagcgaagaagcagaaccagcc-	Protospacer
  ********* ********** *.*.*.**.

1349. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gaaggcaccgtcaccgcgggcgcggcgaccat	Protospacer
  .**************** ******* * ..

1350. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
aaaagcgccgtcaccgcggtcgccgcgctgcc	Protospacer
  ..**.**************** ****.* *

1351. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1352. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gagggcaccgtcaccgcgggtgcggcgaccat	Protospacer
  ***************** .****** * ..

1353. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1354. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1355. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1356. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1357. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1358. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1359. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1360. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1361. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1362. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggccgtcaccgagatcgcggcgccggc	Protospacer
   *  .********* *.*************

1363. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ccggaccccgtcaccgcggtcgccagattggc	Protospacer
****.* **************** . ...***

1364. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gcgggcaccatcaccgtggtcgcggtgatgat	Protospacer
 ********.******.********.* .*..

1365. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
tcctgcaccgtcatcgcggccgcggcgttggt	Protospacer
.*  *********.*****.*******..**.

1366. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gagcgcaccgtcaccgcggtcgggtcgctgct	Protospacer
  * ****************** * ***.* .

1367. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gcgggcaccatcaccgtggtcgcggtgatgat	Protospacer
 ********.******.********.* .*..

1368. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gccggcgccgtcaccgcggtcgtggccaccgt	Protospacer
 * ***.***************.***  * *.

1369. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gcctacaccgtcaccgccctcgcggcgctcgc	Protospacer
 *  .************  *********. **

1370. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP011046 (Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI3, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgt--caccgcggtcgcggcgccggc	CRISPR spacer
--ggctaccacggccccgcggtcgcggcgccggg	Protospacer
  ** .***..  * ******************

1371. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agggcgaaggtcgccgccgtcgcggcgccggc	Protospacer
  **  *  ***.**** **************

1372. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP021037 (Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI3, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgt--caccgcggtcgcggcgccggc	CRISPR spacer
--ggctaccacggccccgcggtcgcggcgccggg	Protospacer
  ** .***..  * ******************

1373. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ccggaccccgtcaccgcggtcgccagattggc	Protospacer
****.* **************** . ...***

1374. spacer 34.64|6461509|32|CP023865|PILER-CR matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 8, identity: 0.75 

ccgggcacc--gtcaccgcggtcgcggcgccggc	CRISPR spacer
--gaccgtcgtgtcgccgcggtcgcggccccggc	Protospacer
  *. *..*  ***.************* *****

1375. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tggccggcatcgtcatgtcgatgctggccacg	Protospacer
 * .****************.******  *.

1376. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 8, identity: 0.75 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tgttcggcatcatcaagtcggtgctgggcttt	Protospacer
 *.********.*** ***********.  *.

1377. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
cgggcgccatcgtcacgtcggtgctggacagg	Protospacer
 *  ** ********.************ *

1378. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75 

agctcggcatcgtcatgtcggtgctggagatc---	CRISPR spacer
cgctcggcatcgacatctcggtgc---agccctat	Protospacer
 *********** *** *******   ** .*

1379. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.724 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
cgcgccgtcggcgacgatgtccgccttgg	Protospacer
******* ** ************ ..  .

1380. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 8, identity: 0.724 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
cgcgcccacgccgacgatgcccggatcgg	Protospacer
****** ************.***. .  .

1381. spacer 42.1|7408051|29|CP023865|CRISPRCasFinder matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 8, identity: 0.724 

cgcgccgacgccgacgatgtccgatcaca	CRISPR spacer
cgcgcccacgccgacgatgcccggatcgg	Protospacer
****** ************.***. .  .

1382. spacer 2.1|229332|33|CP023865|CRT matches to NC_010399 (Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
cgcctcgcggagacctgggcggtcgcggttcgt	Protospacer
*   *********** ******* ****    *

1383. spacer 2.1|229332|33|CP023865|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
gcatgcctggaggccggggcggcggcgggagcc	Protospacer
 *.  * .****.*********.*********.

1384. spacer 2.1|229332|33|CP023865|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
gcatgcctggaggccggggcggcggcgggagcc	Protospacer
 *.  * .****.*********.*********.

1385. spacer 2.1|229332|33|CP023865|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
gcatgcctggaggccggggcggcggcgggagcc	Protospacer
 *.  * .****.*********.*********.

1386. spacer 2.1|229332|33|CP023865|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
gcatgcctggaggccggggcggcggcgggagcc	Protospacer
 *.  * .****.*********.*********.

1387. spacer 2.1|229332|33|CP023865|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
gcatgcctggaggccggggcggcggcgggagcc	Protospacer
 *.  * .****.*********.*********.

1388. spacer 2.1|229332|33|CP023865|CRT matches to MN497953 (Mycobacterium phage GtownJaz, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1389. spacer 2.1|229332|33|CP023865|CRT matches to KX523125 (Mycobacterium phage BuzzBuzz, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1390. spacer 2.1|229332|33|CP023865|CRT matches to KC661272 (Mycobacterium phage Methuselah, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1391. spacer 2.1|229332|33|CP023865|CRT matches to MG925341 (Mycobacteriophage EpicPhail, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1392. spacer 2.1|229332|33|CP023865|CRT matches to KX808129 (Mycobacterium phage Sabinator, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1393. spacer 2.1|229332|33|CP023865|CRT matches to MK359341 (Mycobacterium phage GingkoMaracino, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1394. spacer 2.1|229332|33|CP023865|CRT matches to JF704114 (Mycobacterium phage Vix, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1395. spacer 2.1|229332|33|CP023865|CRT matches to MK279913 (Mycobacterium phage PotatoSplit, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1396. spacer 2.1|229332|33|CP023865|CRT matches to MG757161 (Mycobacterium phage LugYA, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1397. spacer 2.1|229332|33|CP023865|CRT matches to MF185729 (Mycobacterium phage KADY, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1398. spacer 2.1|229332|33|CP023865|CRT matches to MN096368 (Mycobacterium phage Soshari, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1399. spacer 2.1|229332|33|CP023865|CRT matches to MH536825 (Mycobacterium phage Ollie, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1400. spacer 2.1|229332|33|CP023865|CRT matches to MH020238 (Mycobacterium phage Lilith, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1401. spacer 2.1|229332|33|CP023865|CRT matches to MH077583 (Mycobacterium phage PGHhamlin, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1402. spacer 2.1|229332|33|CP023865|CRT matches to MT897907 (Mycobacterium phage Grif, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1403. spacer 2.1|229332|33|CP023865|CRT matches to NC_004682 (Mycobacterium virus Bxz2, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1404. spacer 2.1|229332|33|CP023865|CRT matches to MK433273 (Mycobacterium phage Daishi, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1405. spacer 2.1|229332|33|CP023865|CRT matches to MH155864 (Mycobacterium phage Beauxregard13, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1406. spacer 2.1|229332|33|CP023865|CRT matches to MH727554 (Mycobacterium phage MuchMore, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1407. spacer 2.1|229332|33|CP023865|CRT matches to MH338240 (Mycobacterium phage Sabia, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1408. spacer 2.1|229332|33|CP023865|CRT matches to MN813699 (Mycobacterium phage P28Green, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1409. spacer 2.1|229332|33|CP023865|CRT matches to KM233455 (Mycobacterium phage Farber, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1410. spacer 2.1|229332|33|CP023865|CRT matches to KX670788 (Mycobacterium phage Louie6, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1411. spacer 2.1|229332|33|CP023865|CRT matches to MN585984 (Mycobacterium phage AgronaGT15, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1412. spacer 2.1|229332|33|CP023865|CRT matches to HM755814 (Mycobacterium phage Wonder, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1413. spacer 2.1|229332|33|CP023865|CRT matches to KU578077 (Mycobacterium phage Marie, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1414. spacer 2.1|229332|33|CP023865|CRT matches to KT381277 (Mycobacterium phage Wooldri, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1415. spacer 2.1|229332|33|CP023865|CRT matches to MH513975 (Mycobacterium phage Misomonster, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1416. spacer 2.1|229332|33|CP023865|CRT matches to MK875800 (Mycobacterium phage MoneyMay, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1417. spacer 2.1|229332|33|CP023865|CRT matches to KX664448 (Mycobacterium phage Watson, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1418. spacer 2.1|229332|33|CP023865|CRT matches to KX507362 (Mycobacterium phage Aglet, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1419. spacer 2.1|229332|33|CP023865|CRT matches to MN586048 (Mycobacterium phage Fernando, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1420. spacer 2.1|229332|33|CP023865|CRT matches to KU985091 (Mycobacterium phage Hercules11, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1421. spacer 2.1|229332|33|CP023865|CRT matches to NC_042310 (Mycobacterium virus JHC117, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1422. spacer 2.1|229332|33|CP023865|CRT matches to MH576949 (Mycobacterium phage BreSam8, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1423. spacer 2.1|229332|33|CP023865|CRT matches to KP027202 (Mycobacterium phage Taurus, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1424. spacer 2.1|229332|33|CP023865|CRT matches to MH399776 (Mycobacterium phage Grum1, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1425. spacer 2.1|229332|33|CP023865|CRT matches to MN585969 (Mycobacterium phage Dieselweasel, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1426. spacer 2.1|229332|33|CP023865|CRT matches to KU255188 (Mycobacterium phage JenCasNa, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1427. spacer 2.1|229332|33|CP023865|CRT matches to KX458237 (Mycobacterium phage Penny1, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1428. spacer 2.1|229332|33|CP023865|CRT matches to KP017310 (Mycobacterium phage Phoxy, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1429. spacer 2.1|229332|33|CP023865|CRT matches to NC_021535 (Mycobacterium phage Jobu08, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1430. spacer 2.1|229332|33|CP023865|CRT matches to MH536813 (Mycobacterium phage AugsMagnumOpus, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1431. spacer 2.1|229332|33|CP023865|CRT matches to MF185733 (Mycobacterium phage StepMih, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1432. spacer 2.1|229332|33|CP023865|CRT matches to MF185732 (Mycobacterium phage Stagni, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1433. spacer 2.1|229332|33|CP023865|CRT matches to MK494096 (Mycobacterium phage Mainiac, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1434. spacer 2.1|229332|33|CP023865|CRT matches to KU984914 (Mycobacterium phage Malinsilva, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1435. spacer 2.1|229332|33|CP023865|CRT matches to JF704101 (Mycobacterium virus Microwolf, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1436. spacer 2.1|229332|33|CP023865|CRT matches to NC_028757 (Mycobacterium phage Tiffany, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1437. spacer 2.1|229332|33|CP023865|CRT matches to MN062718 (Mycobacterium phage SoilDragon, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1438. spacer 2.1|229332|33|CP023865|CRT matches to KT359365 (Mycobacterium phage DaHudson, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1439. spacer 2.1|229332|33|CP023865|CRT matches to MH651179 (Mycobacterium phage MadMarie, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1440. spacer 2.1|229332|33|CP023865|CRT matches to KP017311 (Mycobacterium phage Spike509, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1441. spacer 2.1|229332|33|CP023865|CRT matches to KF279418 (Mycobacterium phage Anubis, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1442. spacer 2.1|229332|33|CP023865|CRT matches to NC_028798 (Mycobacterium phage MarQuardt, complete genome) position: , mismatch: 9, identity: 0.727 

ccggtcgcggagaccggggcggtggcgggagct	CRISPR spacer
ccggtcgcggagacctggtcggtgtacttcgcc	Protospacer
*************** ** *****      **.

1443. spacer 2.2|229383|39|CP023865|CRT matches to NZ_CP019193 (Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 plasmid pATCC10717, complete sequence) position: , mismatch: 9, identity: 0.769 

ccggtggcgggagccgcggggaccggggcggtgccggtt	CRISPR spacer
cgtatccggggggccgcggtgaccggggcggtgccggta	Protospacer
*  .*   ***.******* ******************

1444. spacer 2.4|229500|33|CP023865|CRT matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 9, identity: 0.727 

ccggtcgcgggcgcggcgggaaccggggtggac	CRISPR spacer
gcggtcgcgggctcggcggggaccggcagcgtg	Protospacer
 *********** *******.***** .  *

1445. spacer 2.4|229500|33|CP023865|CRT matches to NZ_CP017944 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727 

ccggtcgcgggcgcggcgggaaccggggtggac	CRISPR spacer
cctcaggcgggcgcggcgagaaccgggttgaca	Protospacer
**    ************.******** **.

1446. spacer 2.4|229500|33|CP023865|CRT matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 9, identity: 0.727 

ccggtcgcgggcgcggcgggaaccggggtggac	CRISPR spacer
cgtccagcgggcgcggcgcgaagcggggtgaat	Protospacer
*   . ************ *** *******.*.

1447. spacer 9.1|1545764|32|CP023865|CRISPRCasFinder matches to MH727546 (Mycobacterium phage Eaglehorse, complete genome) position: , mismatch: 9, identity: 0.719 

tccgcagccgggccgctcggtgtgcggggcgc	CRISPR spacer
tggcgcgtcgggccgctcggtgcgctgggcgg	Protospacer
*     *.**************.** *****

1448. spacer 15.2|2878764|37|CP023865|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 9, identity: 0.757 

cgatgcggcgccggagggcgggccgggcggcgcaggc	CRISPR spacer
ggatctgtatgcggcgggcgggcggggcggcgcaggc	Protospacer
 *** .*    *** ******** *************

1449. spacer 25.1|4810356|33|CP023865|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727 

agatcagcgacagcacgatgtaggcgatgccgg	CRISPR spacer
gcttcagcgacagcatgatgaaggcgatgatca	Protospacer
.  ************.**** ******** . .

1450. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP027794 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
caggccctcggcggctcgggtgcccgcgcgac	Protospacer
 *    *********.******** *****.

1451. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
gctgtccccggcggcccgggtgccggtggggg	Protospacer
* .   *.******************.* **.

1452. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
gccgagctcggcggcgccggtgccggcgacag	Protospacer
* * .********** * **********  ..

1453. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggcatgctcggcggcctgggcgccggcggttc	Protospacer
*.*  ***********.***.*******

1454. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
aatgccgccggcggcccggatgccgtcgcgga	Protospacer
.*.    .***********.***** ******

1455. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_MF600313 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggtgccgacggcgactcgggtgccggcgcgga	Protospacer
*..     *****.*.****************

1456. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to KY971609 (Pseudomonas phage PspYZU01, complete genome) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggacagcttggcggccagggtgccggcgcctt	Protospacer
*. ..***.******* ************

1457. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_015377 (Burkholderia gladioli BSR3 plasmid bgla_2p, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
atcacgctcggcgcgccgggtgccggcgtgcc	Protospacer
. *  ********  *************.*

1458. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
atcacgctcggcgcgccgggtgccggcgtgcc	Protospacer
. *  ********  *************.*

1459. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_004041 (Rhizobium etli CFN 42 plasmid p42d, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1460. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
cagccggggggcggccggggtgccggcccgga	Protospacer
 * . *   ******* ********** ****

1461. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP021027 (Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1462. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1463. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1464. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1465. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1466. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1467. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1468. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP018385 (Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
atcacgctcggcgcgccgggtgccggcgtgcc	Protospacer
. *  ********  *************.*

1469. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1470. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1471. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1472. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaagatccggcggccagggtgccggggcggg	Protospacer
*.  *...******** ********* ****.

1473. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1474. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1475. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1476. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1477. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1478. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1479. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1480. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1481. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
atcacgctcggcgcgccgggtgccggcgtgcc	Protospacer
. *  ********  *************.*

1482. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1483. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1484. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1485. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1486. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggaatgctcggcggccagggtggcggcggaaa	Protospacer
*.   *********** ***** ***** ..*

1487. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
gtgcagctcggcgggcagggtgccggcggcgc	Protospacer
*  ..********* * ***********  *

1488. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to CP003955 (Rhodococcus opacus PD630 plasmid 6, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
gaggccatcggcggcccggacgccggcgcgct	Protospacer
**     ************..*********

1489. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggggcgggcgccggcgcgggtgccggcgcggg	Protospacer
*.   *  ** **** ***************.

1490. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to MT536174 (Stenotrophomonas phage vB_SmaS-AXL_3, complete genome) position: , mismatch: 9, identity: 0.719 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
gctcagctcggcggccagggtgtcggcgacgt	Protospacer
* ...*********** *****.*****  *

1491. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NZ_CP034366 (Pantoea sp. CCBC3-3-1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

atggagatcgtgccgtcgccgctgctgcgcca	CRISPR spacer
gccagtagcgtgacgtcgccgctgctgcacca	Protospacer
.. .. * **** ***************.***

1492. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NZ_CP048816 (Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed) position: , mismatch: 9, identity: 0.719 

atggagatcgtgccgtcgccgctgctgcgcca	CRISPR spacer
gccgggatcgtgccgtcggcgctgccgctcgg	Protospacer
.. *.************* ******.** * .

1493. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719 

atggagatcgtgccgtcgccgctgctgcgcca	CRISPR spacer
acagccggcgtgccggcgccgctgctccgcct	Protospacer
*..*  . ******* ********** ****

1494. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggagatcgtgccgtcgccgctgctgcgcca	CRISPR spacer
gtgctgatcgtgctgtcgccgcagctgcaggc	Protospacer
.**  ********.******** *****.

1495. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.719 

atggagatcgtgccgtcgccgctgctgcgcca	CRISPR spacer
acatgtttcgtgccgacgccgctgatgcgcga	Protospacer
*.. .  ******** ******** ***** *

1496. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ggcgggcgtcgcgccgttcgggaagcggatcg	Protospacer
   ... **************** ** *****

1497. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cccctcgatcgcgctgttcgggatgctgatcg	Protospacer
*.    ..******.********.********

1498. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cgcgatcgtcgcgctgttcgggacgctcatga	Protospacer
*  .*  *******.************ ** .

1499. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

----ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ggacttg----cccgcgccgttcgggccgatgatcg	Protospacer
    .**     .************* ** ******

1500. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP049734 (Rhizobium leguminosarum strain A1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ggcatattccgcgccgttcgggacgttgagcg	Protospacer
   * *  .****************.*** **

1501. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to CP049734 (Rhizobium leguminosarum strain A1 plasmid pRLa11, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ggcatattccgcgccgttcgggacgttgagcg	Protospacer
   * *  .****************.*** **

1502. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP054024 (Rhizobium sp. JKLM12A2 plasmid pPR12A203, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ggcatattccgcgccgttcgggacgttgagcg	Protospacer
   * *  .****************.*** **

1503. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP054030 (Rhizobium sp. JKLM19E plasmid pPR19E03) position: , mismatch: 9, identity: 0.719 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ggcatattccgcgccgttcgggacgttgagcg	Protospacer
   * *  .****************.*** **

1504. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP054035 (Rhizobium sp. JKLM13E plasmid pPR13E04, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ggcatattccgcgccgttcgggacgttgagcg	Protospacer
   * *  .****************.*** **

1505. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgagcacctcgccgatgatgagccgggctcc	Protospacer
******** .***************.  . .

1506. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgatcacgccgccgaggatgagcgagacaag	Protospacer
**** *********** ******* *  .. .

1507. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgatcacgccgccgaggatgagcgagacaag	Protospacer
**** *********** ******* *  .. .

1508. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgatcacgccgccgaggatgagcgagacaag	Protospacer
**** *********** ******* *  .. .

1509. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgatcacgccgccgaggatgagcgagacaag	Protospacer
**** *********** ******* *  .. .

1510. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
tagcgcacgccgccgttgataagccactgcct	Protospacer
. * *********** ****.*******  .

1511. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
acgagcaggccgacgatgatgagcagcgcgac	Protospacer
 ****** **** *********** .* .*

1512. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to LR606151 (Rhizobium sp. Q54 genome assembly, plasmid: 8) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta-----	CRISPR spacer
ccaagcgcgccgccgatgatgagtc-----caagagc	Protospacer
**.***.****************.*     .*

1513. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgatcacgccgccgatgaggagtgcgatggc	Protospacer
**** ************** ***.    **

1514. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_LR723678 (Arsenite-oxidising bacterium NT-25 plasmid 2) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta-----	CRISPR spacer
ccaagcgcgccgccgatgatgagtc-----caagagc	Protospacer
**.***.****************.*     .*

1515. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgtgcacgccgccgatgctgagtccatgact	Protospacer
*** ************** ****.*  * ..

1516. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP025432 (Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgat--------gagccacttgta	CRISPR spacer
ccgagcgcgccgccgatgatcagaccgagagc--------	Protospacer
******.*************        ****

1517. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP020812 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgatcacgccgccgatgaggagtgcgatggc	Protospacer
**** ************** ***.    **

1518. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta-----	CRISPR spacer
ccaagcgcgccgccgatgatgagtc-----caagagc	Protospacer
**.***.****************.*     .*

1519. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to AP014497 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C71-MedDCM-OCT-S32-C181, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces) position: , mismatch: 9, identity: 0.719 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
acgagcaggccgccgatgctgagcatcgcaaa	Protospacer
 ****** ********** *****  * .. *

1520. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_027296 (Rhizobium phage RHEph06, complete genome) position: , mismatch: 9, identity: 0.719 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
caacgggcgtactgagtattcgccgtcgccgc	Protospacer
 . .******** ****.********* .**

1521. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to JX483877 (Rhizobium phage RHEph05, complete genome) position: , mismatch: 9, identity: 0.719 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
caacgggcgtactgagtattcgccgtcgccgc	Protospacer
 . .******** ****.********* .**

1522. spacer 33.11|6446963|32|CP023865|CRISPRCasFinder,PILER-CR matches to JX483876 (Rhizobium phage RHEph04, complete genome) position: , mismatch: 9, identity: 0.719 

agctgggcgtacagagtgttcgccgtcttcgg	CRISPR spacer
caacgggcgtactgagtattcgccgtcgccgc	Protospacer
 . .******** ****.********* .**

1523. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MT498041 (Mycobacterium phage KingCyrus, complete genome) position: , mismatch: 9, identity: 0.727 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggctgccga	Protospacer
.   ..********************* **  *

1524. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to KU985095 (Mycobacterium phage ChipMunk, complete genome) position: , mismatch: 9, identity: 0.727 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggctgccga	Protospacer
.   ..********************* **  *

1525. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to KU985093 (Mycobacterium phage EvilGenius, complete genome) position: , mismatch: 9, identity: 0.727 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgacccggagctggctgccga	Protospacer
.   ..********************* **  *

1526. spacer 33.13|6447086|31|CP023865|CRISPRCasFinder matches to LR745207 (uncultured phage genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.71 

gaccgcggcccggggttggcgtgtggcattg	CRISPR spacer
attgcccacccggggtcggcgtgaggcattg	Protospacer
. .  * .********.****** *******

1527. spacer 33.14|6447146|32|CP023865|CRISPRCasFinder matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 9, identity: 0.719 

ttttcgcgatctcggcggtgctagcccacctg	CRISPR spacer
gcgtcgcgatctcggtggtgctggccgtcgtc	Protospacer
 . ************.******.***  * *

1528. spacer 33.14|6447146|32|CP023865|CRISPRCasFinder matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

ttttcgcgatctcggcggtgctagcccacctg	CRISPR spacer
gcgtcgcgatctcggtggtgctggccgtcgtc	Protospacer
 . ************.******.***  * *

1529. spacer 33.14|6447146|32|CP023865|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ttttcgcgatctcggcggtgctagcccacctg	CRISPR spacer
gcgtcgcgatctcggtggtgctggccgtcgtc	Protospacer
 . ************.******.***  * *

1530. spacer 33.14|6447146|32|CP023865|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.719 

ttttcgcgatctcggcggtgctagcccacctg	CRISPR spacer
gcgtcgcgatctcggtggtgctggccgtcgtc	Protospacer
 . ************.******.***  * *

1531. spacer 33.16|6447268|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 9, identity: 0.719 

atcggggcccggccgtggcgtgcccggtacgc	CRISPR spacer
tgctcggcccggccgcggcgtgcctggtggcc	Protospacer
  *  **********.********.***.  *

1532. spacer 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgttccggacggtcggggacctggccgacgc	CRISPR spacer
gcgttccggacgatcggcgacctactgttcgt	Protospacer
************.**** *****. .   **.

1533. spacer 33.21|6447573|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP030842 (Acidisarcina polymorpha strain SBC82 plasmid pACPOL2, complete sequence) position: , mismatch: 9, identity: 0.719 

atgtgagcctcgaactcacccatcgcgtcctt	CRISPR spacer
aggtcagcctcgaactctcccatcggcccgaa	Protospacer
* ** ************ *******  .*

1534. spacer 33.21|6447573|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719 

atgtgagcctcgaactcacccatcgcgtcctt	CRISPR spacer
cagttcatctcgaactgaccgatcgcgtcctc	Protospacer
  **  ..******** *** **********.

1535. spacer 33.22|6447634|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP034471 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_2, complete sequence) position: , mismatch: 9, identity: 0.719 

tcggaccgtcgggggctttctgatcggtcatc	CRISPR spacer
gctgaccgacggcggctttctgatcgtctacg	Protospacer
 * ***** *** ************* ..*.

1536. spacer 33.22|6447634|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP034476 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_2, complete sequence) position: , mismatch: 9, identity: 0.719 

tcggaccgtcgggggctttctgatcggtcatc	CRISPR spacer
gctgaccgacggcggctttctgatcgtctacg	Protospacer
 * ***** *** ************* ..*.

1537. spacer 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR matches to KT381879 (Caulobacter phage Percy, complete genome) position: , mismatch: 9, identity: 0.719 

tatgagggcctggaggcgtacgtccaggccca	CRISPR spacer
ttcacggccctggaggtgtacgtccaggctat	Protospacer
* .. ** ********.************.

1538. spacer 33.27|6447940|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgcagcaactcccgcccggccg----ggcctggct	CRISPR spacer
ctgcagcagctcccgcacggccgttgagacgc----	Protospacer
********.******* ******    *.* .

1539. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtccccgccgcccggctcggcgcgagcttttt	CRISPR spacer
ctcccggccgcgcggctcggcgcgatgatgcg	Protospacer
 **** ***** *************   * .

1540. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 9, identity: 0.719 

gtccccgccgcccggctcggcgcgagcttttt	CRISPR spacer
ttcccggccgcccggctcgccgcgaccgacga	Protospacer
 **** ************* ***** *  .

1541. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 9, identity: 0.719 

gtccccgccgcccggctcggcgcgagcttttt	CRISPR spacer
gtcgccgccgcccggcgcggcgcgcctcccat	Protospacer
*** ************ *******  .... *

1542. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
aaacccgcgatcttgcgcgcgaagcccgcgaa	Protospacer
. .******** ********** ****  *

1543. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP022370 (Bosea sp. AS-1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
tcgcccgcgatgttgccggcgacgcgcgcgcg	Protospacer
 .**************  ******* *  *.

1544. spacer 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719 

ttgtccaggaactcccgtgccgcgtctgcgct	CRISPR spacer
cggaacaggaaatcccgcgccgcgtctggccc	Protospacer
. *  ****** *****.**********  *.

1545. spacer 33.38|6448611|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719 

ttgtccaggaactcccgtgccgcgtctgcgct	CRISPR spacer
cggaacaggaaatcccgcgccgcgtctggccc	Protospacer
. *  ****** *****.**********  *.

1546. spacer 33.39|6448672|32|CP023865|CRISPRCasFinder,PILER-CR matches to MT639646 (Microbacterium phage Rasputia, complete genome) position: , mismatch: 9, identity: 0.719 

cacggccccgagttgcagacgtacggcgtctt	CRISPR spacer
tgcggcctcgagctgcagacgtacgaggacgg	Protospacer
..*****.****.************. * *

1547. spacer 33.40|6448733|32|CP023865|CRISPRCasFinder,PILER-CR matches to MT639646 (Microbacterium phage Rasputia, complete genome) position: , mismatch: 9, identity: 0.719 

cacggccccgagttgcagacgtacggcgtctt	CRISPR spacer
tgcggcctcgagctgcagacgtacgaggacgg	Protospacer
..*****.****.************. * *

1548. spacer 33.41|6448794|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_007960 (Nitrobacter hamburgensis X14 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgaagtccatgtcggcgtcctggtcaagaag	CRISPR spacer
gtggtgcacaggtcggcgtcctgatcaagaac	Protospacer
 .*. *. ** ************.*******

1549. spacer 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 9, identity: 0.719 

gccgggcccgtcggccggcgcacgatgcgccg	CRISPR spacer
gcgctcgccgtcggacggcgcgcgatgcgcta	Protospacer
**     ******* ******.********..

1550. spacer 33.43|6448916|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 9, identity: 0.719 

gccgggccc---gtcggccggcgcacgatgcgccg	CRISPR spacer
---caactcgtggtcggccagcgcacgctgcgccg	Protospacer
    ..*.*   *******.******* *******

1551. spacer 33.44|6448977|33|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 9, identity: 0.727 

cagccgggccttcagctcggtcgggacggtgaa	CRISPR spacer
gccccggttcttcagctcggtcgggacccggag	Protospacer
   **** .******************   **.

1552. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NC_014035 (Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
ccggtcagcaccagcggcaccggcagatccca	Protospacer
 *****************.***** .. *  .

1553. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
gacagcagcgccagcgccgccggccaggaatg	Protospacer
*  . ****.****** *********** . *

1554. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
aggctcagcaccagcgtggccggccagataaa	Protospacer
. * ************  *********...*.

1555. spacer 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcagcaacggcacctacacgctggccaccaag	CRISPR spacer
gcggcaacggcaccgacacgctgatcggcggc	Protospacer
**.*********** ********..*. *..

1556. spacer 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP011046 (Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI3, complete sequence) position: , mismatch: 9, identity: 0.719 

gcagcaacggcacctacacgctggccaccaag	CRISPR spacer
ccaacaacgccacctacacgctggtaaaccgc	Protospacer
 **.***** **************. * * .

1557. spacer 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021037 (Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI3, complete sequence) position: , mismatch: 9, identity: 0.719 

gcagcaacggcacctacacgctggccaccaag	CRISPR spacer
ccaacaacgccacctacacgctggtaaaccgc	Protospacer
 **.***** **************. * * .

1558. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gacgcccaagacgccgtcggcggcctgctcgg	Protospacer
 .*..* . ***.*********** *******

1559. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
cagatcagcgacaccgccggaggcgtgcggat	Protospacer
.. *************.*** *******  .

1560. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gacgtcagcgtcaccttcggcggcgtgacggc	Protospacer
 .*.****** **** *********** . *

1561. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_LR134470 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 28, complete sequence) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
ccggtgagcgtcaccgtcggcgacgtgctggt	Protospacer
.  .* **** ***********.****** *

1562. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gagatcagcgacaccttcggtggcgtctacga	Protospacer
 . ************ ****.***** . **.

1563. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
ctccgcgtcgacaccgtcggcggccagctcgt	Protospacer
. *  *. ****************  *****

1564. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
cggccgggcgtcaccatcggcggcgtgctccg	Protospacer
.*  . .*** ****.************** *

1565. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
tatctcagcggcaccggcggcggcgtggcctt	Protospacer
*.. ******.***** ********** .*

1566. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
tcccagggcgtcaccgtcggcggcgagctccc	Protospacer
* *   .*** ************** ****

1567. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MT024869 (Arthrobacter phage Lego, complete genome) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
tcccagggcgtcaccgtcggcggcgagctccc	Protospacer
* *   .*** ************** ****

1568. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
tcccagggcgtcaccgtcggcggcgagctccc	Protospacer
* *   .*** ************** ****

1569. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NC_031004 (Gordonia phage Nyceirae, complete genome) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
agcatcagcgacgccgccggcggccggagtag	Protospacer
 ***********.***.*******  *  ..*

1570. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 9, identity: 0.719 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gtcatcagcgacaccgcccgcggcgatctgac	Protospacer
  **************.* ******  ** .

1571. spacer 34.10|6459182|32|CP023865|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 9, identity: 0.719 

cacgcccttgggcgccggatcagctacaagta	CRISPR spacer
tggaccctggggcgccggctcagctacaacct	Protospacer
.. .**** ********* ********** .

1572. spacer 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 9, identity: 0.719 

tggctcagcaggatgaacggctcgcagccaga	CRISPR spacer
cagcatctcaggctgaacgactcgcagccagc	Protospacer
..** .  **** ******.***********

1573. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

accacgctcaaggacgtgcccggcgcgaacat	CRISPR spacer
gaaaagctcaaggacgtgcgcggcgtgatcca	Protospacer
.  * ************** *****.** *

1574. spacer 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gacgcgccgagcatcgcggtcgggatgatgcg	CRISPR spacer
gaggcgccgaacatcgcggtcggcgccgaccg	Protospacer
** *******.************ .. .  **

1575. spacer 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719 

gacgcgccgagcatcgcggtcgggatgatgcg	CRISPR spacer
ttcgcgcccggcatcgcggtcgggacccttgg	Protospacer
  ****** .***************.  *  *

1576. spacer 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgccctgttcgccggggttgatgttgaacct	CRISPR spacer
ttgccctgttcgccgggctttatgccgcgcgg	Protospacer
.**************** ** ***..* .*

1577. spacer 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT matches to NZ_LT900339 (Gluconobacter oxydans 621H isolate WT-DSMZ plasmid 2) position: , mismatch: 9, identity: 0.719 

ctgccctgttcgccggggttgatgttgaacct	CRISPR spacer
ttgccctgttcgccgggctttatgccgcgcgg	Protospacer
.**************** ** ***..* .*

1578. spacer 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT matches to NC_006672 (Gluconobacter oxydans 621H plasmid pGOX1, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgccctgttcgccggggttgatgttgaacct	CRISPR spacer
ttgccctgttcgccgggctttatgccgcgcgg	Protospacer
.**************** ** ***..* .*

1579. spacer 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015167 (Acetobacter ascendens strain LMG 1590 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgccctgttcgccggggttgatgttgaacct	CRISPR spacer
ttgccctgttcgccgggctttatgccgcgcgg	Protospacer
.**************** ** ***..* .*

1580. spacer 34.21|6459854|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP043044 (Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgccctgttcgccggggttgatgttgaacct	CRISPR spacer
ttgccctgttcgccgggctttatgccgcgcgg	Protospacer
.**************** ** ***..* .*

1581. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 9, identity: 0.719 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
gatggtgcgtggacatgcagcccgatgcgggc	Protospacer
*.. *  **.*********** ********.

1582. spacer 34.23|6459976|32|CP023865|CRISPRCasFinder,CRT matches to KY676784 (Streptomyces phage ToastyFinz, complete genome) position: , mismatch: 9, identity: 0.719 

ggctggtcgcggacatgcagcgcgatgcggag	CRISPR spacer
tgctgttcgcggacatgccgcgcgtcgtcgtc	Protospacer
 **** ************ ***** .*. *

1583. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
ggagcggcgaatgcccgctcgtcgcggggccg	Protospacer
 *. ******  **************** ..

1584. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tgcccggcgccggcccgctcggcgcgtaccgc	Protospacer
.* ****** *********** **** ... *

1585. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NZ_KT070138 (Klebsiella pneumoniae strain KP01 plasmid pGES-GZ, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tggccggcggcggccagctcgtcggcggcgga	Protospacer
.********.***** ********  **.

1586. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tggatggcgacggcccggtcgtcgccggcgaa	Protospacer
.** .************ ******* **.

1587. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013513 (Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
cggtcggcgacggcccgcacgtcctccatgtt	Protospacer
***.************** **** .  .* *.

1588. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013603 (Rhizobium sp. N731 plasmid pRspN731b, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
cggtcggcgacggcccgcacgtcctccatgtt	Protospacer
***.************** **** .  .* *.

1589. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tgcttggcggcggcgcgctcgtcgcgggcggc	Protospacer
.* ..****.**** *************.  *

1590. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MH651167 (Gordonia phage Angelique, complete genome) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tcgtcggcgccggccggctcgtcgcggaccgc	Protospacer
. *.***** ***** ***********... *

1591. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_048780 (Corynebacterium phage StAB, complete genome) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tgcttggcggcggcgcgctcgtcgcgggcggc	Protospacer
.* ..****.**** *************.  *

1592. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to EF579802 (Microbacterium phage Min1, complete genome) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
ccgccggcgacggcacgctcgacgcacctccg	Protospacer
* ************ ****** ***.  *..

1593. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tgcttggcggcggcgcgctcgtcgcgggcggc	Protospacer
.* ..****.**** *************.  *

1594. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tgcttggcggcggcgcgctcgtcgcgggcggc	Protospacer
.* ..****.**** *************.  *

1595. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_048790 (Corynebacterium phage Lederberg, complete genome) position: , mismatch: 9, identity: 0.719 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
tgcttggcggcggcgcgctcgtcgcgggcggc	Protospacer
.* ..****.**** *************.  *

1596. spacer 34.26|6460159|32|CP023865|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcccgcgggcaagacgccagatgccggacgc	CRISPR spacer
agcgcgccggcaagacgccggatgccggtgtg	Protospacer
. * *** ***********.********

1597. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 9, identity: 0.719 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcacgcagcagcggcgccggccagcgcaccg	Protospacer
** ..  ***** * *************** .

1598. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
gcagcacggcaggatcaccggccagcgcacgg	Protospacer
* .*.  .*****.**.**************.

1599. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 9, identity: 0.719 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ggcacgcagcagcggcgccggccagcgcaccg	Protospacer
** ..  ***** * *************** .

1600. spacer 34.29|6460342|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP010386 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence) position: , mismatch: 9, identity: 0.719 

gtccgagccagcgctcccgctcggacctgccc	CRISPR spacer
gtgcgagccagcgctccagctcgcgcagtgtc	Protospacer
** ************** ***** .*    .*

1601. spacer 34.29|6460342|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP042485 (Klebsiella pneumoniae strain C51 plasmid pC51_004) position: , mismatch: 9, identity: 0.719 

gtccgagccagcgctcccgctcggacctgccc	CRISPR spacer
gtgcgagccagcgctccagctcgcgcagtgtc	Protospacer
** ************** ***** .*    .*

1602. spacer 34.29|6460342|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022425 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF2, complete sequence) position: , mismatch: 9, identity: 0.719 

gtccgagccagcgctcccgctcggacctgccc	CRISPR spacer
gtgcgagccagcgctccagctcgcgcagtgtc	Protospacer
** ************** ***** .*    .*

1603. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gggttcgactgctccgggctcatgctcgccgc	Protospacer
* ****************** ****     ..

1604. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gggttcgactgctccgggctcatgctcgccgc	Protospacer
* ****************** ****     ..

1605. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gggttcgactgctccgggctcatgctcgccgc	Protospacer
* ****************** ****     ..

1606. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gggttcgactgctccgggctcatgctcgccgc	Protospacer
* ****************** ****     ..

1607. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gggttcgactgctccgggctcatgctcgccgc	Protospacer
* ****************** ****     ..

1608. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
gggttcgactgctccgggctcatgctcgccgc	Protospacer
* ****************** ****     ..

1609. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 9, identity: 0.719 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
tcggacggggcgttcaccgtcaccctgctggg	Protospacer
*    ************** *.******  *

1610. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 9, identity: 0.719 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
ctggccggggcgatcaccggcgcactggccgg	Protospacer
.   ******** ********** ***  **

1611. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
cggaccacggcgttcaccgccgccgtgcacga	Protospacer
..  **. *********** **** ******

1612. spacer 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

tacgtcgcgg----gcgtggcgggctggtcgattga	CRISPR spacer
----tcgtgggcgcgcgtggcgtgctggtcgatgat	Protospacer
    ***.**    ******** ********** .

1613. spacer 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719 

tacgtcgcgg----gcgtggcgggctggtcgattga	CRISPR spacer
----tcgtgggcgcgcgtggcgtgctggtcgatgat	Protospacer
    ***.**    ******** ********** .

1614. spacer 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to MF324911 (Mycobacterium phage SirPhilip, complete genome) position: , mismatch: 9, identity: 0.719 

tacgtcgcgggcgtggcgggctggtcgattga	CRISPR spacer
tgcttcgcgggcttggcggcctggtcgtcgtc	Protospacer
*.* ******** ****** ******* .

1615. spacer 34.33|6460586|33|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

ggacagcagcgccgcgagcagagcggtggtgcc	CRISPR spacer
cgcctacagcgccgccagcagagcggcggtctg	Protospacer
 * * .********* **********.*** .

1616. spacer 34.34|6460648|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 9, identity: 0.719 

ggcaccaccgtcgacctgtccgggatcgggct	CRISPR spacer
cgggtcaccatcgacctgtccgggaccggcgc	Protospacer
 * ..****.***************.***  .

1617. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gtgctgttcctcggcagcgtcggtgacgacgc	Protospacer
..**** ********* ******** .*  *

1618. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.719 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gagctgatcctcggcatcgatggtggcggcag	Protospacer
. ***************** .**** .*  .*

1619. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
gggctgatcctggtcatcgtcggtggcgcgca	Protospacer
. ********* * *********** .**. .

1620. spacer 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccttgtcggtcaccgggttg--tggtaggt	CRISPR spacer
acggcctggtcggtcaccggattgatcagcaa--	Protospacer
.****** ************.***  ..*.*.

1621. spacer 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccttgtcggtcaccgggttg--tggtaggt	CRISPR spacer
acggcctggtcggtcaccggattgatcagcaa--	Protospacer
.****** ************.***  ..*.*.

1622. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
tcgacccgtcggcaggcccggacggcgtgatc	Protospacer
******** ** ************ * .   .

1623. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
cgcaggtcgccggggtggcggtcggtgaccac	Protospacer
   ************.** *********. .

1624. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_LN832561 (Paracoccus aminovorans isolate JCM7685 plasmid III, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
cccaggtcggcggggcgggggtcgatggcata	Protospacer
 * ****** **************.**... .

1625. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgacgtcgccggggcgggcgtcgtagagccc	Protospacer
 *** ************** ****  **

1626. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgacgtcgccggggcgggcgtcgtagagccc	Protospacer
 *** ************** ****  **

1627. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
aggaggtcaccggggccggggtcggacgcctg	Protospacer
* ******.******* ********  ..  *

1628. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ggcagcgcgcgtgggcgggggtcggtgatgac	Protospacer
.  **  ***  ******************.

1629. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ggcagcgcgcgtgggcgggggtcggtgatgac	Protospacer
.  **  ***  ******************.

1630. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
acgagatcgccggggcggcggtcttcctcgcg	Protospacer
*****.************ ****  .  .* *

1631. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
gcgcggtcgccgggtcgggggtcgagaatctc	Protospacer
.** ********** *********. .**

1632. spacer 34.44|6461258|33|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727 

cggatgatccggaagatcaccgat------ccgcagggc	CRISPR spacer
cggctgctccggaagatcaccgatgtatccctg------	Protospacer
*** ** *****************      *.*

1633. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1634. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1635. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcaa	Protospacer
 * * . .** ***************** **

1636. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1637. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1638. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1639. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1640. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcaa	Protospacer
 * * . .** ***************** **

1641. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1642. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1643. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1644. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1645. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719 

atcaagcaggacgcgaagaagcggatcggcta	CRISPR spacer
ctcgagccggacgcgaagaagcggggcgagat	Protospacer
 **.*** ****************. **.

1646. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719 

atcaagcaggacgcgaagaagcggatcggcta	CRISPR spacer
ctcgagccggacgcgaagaagcggggcgagat	Protospacer
 **.*** ****************. **.

1647. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggcgccgccgtcgccgcggtcgcggtgccgct	Protospacer
   * *.*****.************.**** .

1648. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcacc----gtcaccgcggtcgcggcgccggc	CRISPR spacer
----atgccgctggtcaccgcggtcagggcgccggc	Protospacer
    ...**    ************. *********

1649. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggcgccgccgtcgccgcggtcgcggtgccgct	Protospacer
   * *.*****.************.**** .

1650. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcacc----gtcaccgcggtcgcggcgccggc	CRISPR spacer
----atgccgctggtcaccgcggtcagggcgccggc	Protospacer
    ...**    ************. *********

1651. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggcaggaccgtcaccgcggccgcggcgtcgtg	Protospacer
   .* *************.*******.**

1652. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcacc----gtcaccgcggtcgcggcgccggc	CRISPR spacer
----atgccgctggtcaccgcggtcagggcgccggc	Protospacer
    ...**    ************. *********

1653. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gaaggcaccgtcaccgcgggctcggcgaccat	Protospacer
  .**************** * ***** * ..

1654. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gaaggcaccgtcaccgcgggctcggcgaccat	Protospacer
  .**************** * ***** * ..

1655. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP050118 (Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggaaccagcgtcaccgcggtcgcgccgctgcc	Protospacer
  .. ** **************** ***.* *

1656. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1657. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1658. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agagcgatggtcaccacggtcgccgcgccggc	Protospacer
  .*  *. ******.******* ********

1659. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP050122 (Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggaaccagcgtcaccgcggtcgcgccgctgcc	Protospacer
  .. ** **************** ***.* *

1660. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1661. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_000958 (Deinococcus radiodurans R1 plasmid MP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggaaccagcgtcaccgcggtcgcgccgctgcc	Protospacer
  .. ** **************** ***.* *

1662. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1663. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gccctgattgtcacggcggtcgcggcgtcggc	Protospacer
 *    *..***** ************.****

1664. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1665. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1666. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1667. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1668. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1669. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agagcgatggtcaccacggtcgccgcgccggc	Protospacer
  .*  *. ******.******* ********

1670. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gcgggcatcgtcacctcggtcgcgctgcacag	Protospacer
 ******.******* ******** .**  .

1671. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gccctgattgtcacggcggtcgcggcgtcggc	Protospacer
 *    *..***** ************.****

1672. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agagcgatggtcaccacggtcgccgcgccggc	Protospacer
  .*  *. ******.******* ********

1673. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP031502 (Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggaaccagcgtcaccgcggtcgcgccgctgcc	Protospacer
  .. ** **************** ***.* *

1674. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 9, identity: 0.719 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
ctaacggcaacgccatgtcggtgctggaagcc	Protospacer
    ***** **.***************...*

1675. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 9, identity: 0.719 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
gggtcggcatcgtcatgccagtgctgatcggc	Protospacer
.* **************.*.******.  . *

1676. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to KR827394 (Uncultured bacterium plasmid pKAZ5, complete sequence) position: , mismatch: 9, identity: 0.719 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcttcgccatcgtcctgtcggtgctgatgctg	Protospacer
  .*** ******* ***********. * *

1677. spacer 34.51|6461687|32|CP023865|CRISPRCasFinder,CRT matches to MN284895 (Mycobacterium phage Marshawn, complete genome) position: , mismatch: 9, identity: 0.719 

cactg-gtcgcgcaccctcaacggcgccggtcg	CRISPR spacer
-gcagcctcgcgcaccgtcagcggcgccggggt	Protospacer
 .* *  ********* ***.*********

1678. spacer 34.54|6460897|32|CP023865|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccttgtcggtcaccgggttg--tggtaggt	CRISPR spacer
acggcctggtcggtcaccggattgatcagcaa--	Protospacer
.****** ************.***  ..*.*.

1679. spacer 34.54|6460897|32|CP023865|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 9, identity: 0.719 

gcggccttgtcggtcaccgggttg--tggtaggt	CRISPR spacer
acggcctggtcggtcaccggattgatcagcaa--	Protospacer
.****** ************.***  ..*.*.

1680. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
tcgacccgtcggcaggcccggacggcgtgatc	Protospacer
******** ** ************ * .   .

1681. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
cgcaggtcgccggggtggcggtcggtgaccac	Protospacer
   ************.** *********. .

1682. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_LN832561 (Paracoccus aminovorans isolate JCM7685 plasmid III, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
cccaggtcggcggggcgggggtcgatggcata	Protospacer
 * ****** **************.**... .

1683. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgacgtcgccggggcgggcgtcgtagagccc	Protospacer
 *** ************** ****  **

1684. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ccgacgtcgccggggcgggcgtcgtagagccc	Protospacer
 *** ************** ****  **

1685. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
aggaggtcaccggggccggggtcggacgcctg	Protospacer
* ******.******* ********  ..  *

1686. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ggcagcgcgcgtgggcgggggtcggtgatgac	Protospacer
.  **  ***  ******************.

1687. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
ggcagcgcgcgtgggcgggggtcggtgatgac	Protospacer
.  **  ***  ******************.

1688. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
acgagatcgccggggcggcggtcttcctcgcg	Protospacer
*****.************ ****  .  .* *

1689. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
gcgcggtcgccgggtcgggggtcgagaatctc	Protospacer
.** ********** *********. .**

1690. spacer 34.60|6461263|33|CP023865|PILER-CR matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727 

cggatgatccggaagatcaccgat------ccgcagggc	CRISPR spacer
cggctgctccggaagatcaccgatgtatccctg------	Protospacer
*** ** *****************      *.*

1691. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1692. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1693. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcaa	Protospacer
 * * . .** ***************** **

1694. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1695. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1696. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1697. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1698. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcaa	Protospacer
 * * . .** ***************** **

1699. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1700. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1701. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1702. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgccctgcagcgcgcgcagctcggcgagcag	Protospacer
 * * . .** ***************** **

1703. spacer 34.63|6461448|32|CP023865|PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719 

atcaagcaggacgcgaagaagcggatcggcta	CRISPR spacer
ctcgagccggacgcgaagaagcggggcgagat	Protospacer
 **.*** ****************. **.

1704. spacer 34.63|6461448|32|CP023865|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719 

atcaagcaggacgcgaagaagcggatcggcta	CRISPR spacer
ctcgagccggacgcgaagaagcggggcgagat	Protospacer
 **.*** ****************. **.

1705. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggcgccgccgtcgccgcggtcgcggtgccgct	Protospacer
   * *.*****.************.**** .

1706. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcacc----gtcaccgcggtcgcggcgccggc	CRISPR spacer
----atgccgctggtcaccgcggtcagggcgccggc	Protospacer
    ...**    ************. *********

1707. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggcgccgccgtcgccgcggtcgcggtgccgct	Protospacer
   * *.*****.************.**** .

1708. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcacc----gtcaccgcggtcgcggcgccggc	CRISPR spacer
----atgccgctggtcaccgcggtcagggcgccggc	Protospacer
    ...**    ************. *********

1709. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggcaggaccgtcaccgcggccgcggcgtcgtg	Protospacer
   .* *************.*******.**

1710. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcacc----gtcaccgcggtcgcggcgccggc	CRISPR spacer
----atgccgctggtcaccgcggtcagggcgccggc	Protospacer
    ...**    ************. *********

1711. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gaaggcaccgtcaccgcgggctcggcgaccat	Protospacer
  .**************** * ***** * ..

1712. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gaaggcaccgtcaccgcgggctcggcgaccat	Protospacer
  .**************** * ***** * ..

1713. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP050118 (Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggaaccagcgtcaccgcggtcgcgccgctgcc	Protospacer
  .. ** **************** ***.* *

1714. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1715. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1716. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agagcgatggtcaccacggtcgccgcgccggc	Protospacer
  .*  *. ******.******* ********

1717. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP050122 (Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggaaccagcgtcaccgcggtcgcgccgctgcc	Protospacer
  .. ** **************** ***.* *

1718. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1719. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_000958 (Deinococcus radiodurans R1 plasmid MP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggaaccagcgtcaccgcggtcgcgccgctgcc	Protospacer
  .. ** **************** ***.* *

1720. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1721. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gccctgattgtcacggcggtcgcggcgtcggc	Protospacer
 *    *..***** ************.****

1722. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1723. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1724. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1725. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1726. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcgcggctgtcaccgagatcgcggcgccggc	Protospacer
   *  .*.******* *.*************

1727. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agagcgatggtcaccacggtcgccgcgccggc	Protospacer
  .*  *. ******.******* ********

1728. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gcgggcatcgtcacctcggtcgcgctgcacag	Protospacer
 ******.******* ******** .**  .

1729. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gccctgattgtcacggcggtcgcggcgtcggc	Protospacer
 *    *..***** ************.****

1730. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agagcgatggtcaccacggtcgccgcgccggc	Protospacer
  .*  *. ******.******* ********

1731. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP031502 (Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
ggaaccagcgtcaccgcggtcgcgccgctgcc	Protospacer
  .. ** **************** ***.* *

1732. spacer 34.66|6461631|32|CP023865|PILER-CR matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 9, identity: 0.719 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
ctaacggcaacgccatgtcggtgctggaagcc	Protospacer
    ***** **.***************...*

1733. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 9, identity: 0.719 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
gggtcggcatcgtcatgccagtgctgatcggc	Protospacer
.* **************.*.******.  . *

1734. spacer 34.66|6461631|32|CP023865|PILER-CR matches to KR827394 (Uncultured bacterium plasmid pKAZ5, complete sequence) position: , mismatch: 9, identity: 0.719 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
tcttcgccatcgtcctgtcggtgctgatgctg	Protospacer
  .*** ******* ***********. * *

1735. spacer 34.67|6461692|32|CP023865|PILER-CR matches to MN284895 (Mycobacterium phage Marshawn, complete genome) position: , mismatch: 9, identity: 0.719 

cactg-gtcgcgcaccctcaacggcgccggtcg	CRISPR spacer
-gcagcctcgcgcaccgtcagcggcgccggggt	Protospacer
 .* *  ********* ***.*********

1736. spacer 28.1|6064595|31|CP023865|CRISPRCasFinder matches to MK799832 (Synechococcus phage S-B05, complete genome) position: , mismatch: 10, identity: 0.677 

accgccgaaacaaccaccaacaccagcccac	CRISPR spacer
tgtgctgaaataaccaccaacaccagaagta	Protospacer
  .**.****.***************

1737. spacer 28.1|6064595|31|CP023865|CRISPRCasFinder matches to MN018232 (Synechococcus phage S-B43, complete genome) position: , mismatch: 10, identity: 0.677 

accgccgaaacaaccaccaacaccagcccac	CRISPR spacer
tgtgctgaaataaccaccaacaccagaagta	Protospacer
  .**.****.***************

1738. spacer 28.1|6064595|31|CP023865|CRISPRCasFinder matches to MH920637 (Synechoccus phage S-B43, partial genome) position: , mismatch: 10, identity: 0.677 

accgccgaaacaaccaccaacaccagcccac	CRISPR spacer
tgtgctgaaataaccaccaacaccagaagta	Protospacer
  .**.****.***************

1739. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.688 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggtcccctcggcggcccgggtggcggtgcctt	Protospacer
*...  **************** ***.**

1740. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.688 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
cgcgggctcgccggccggggtgccggccaccg	Protospacer
 .* ****** ***** **********    .

1741. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 10, identity: 0.688 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
cggccgcgcggcgacccgggtgccggcggcgc	Protospacer
 . . ** *****.**************  *

1742. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_AP014708 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence) position: , mismatch: 10, identity: 0.688 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ggagacgacggcgccctgggtgccggcgcggg	Protospacer
*.  .   ***** **.**************.

1743. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.688 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
ccagagcccggcggcacgggtgccggcggtgc	Protospacer
    .**.******* ************  *

1744. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 10, identity: 0.688 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
cttcagcccggcggcctgggtgccggcgatgc	Protospacer
  ...**.********.***********  *

1745. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 10, identity: 0.688 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
cgctggatcggcggcccggatgccgcgatcaa	Protospacer
 .**** ************.*****  .. .*

1746. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688 

gactggctcggcggcccgggtgccggcgcgga	CRISPR spacer
cgcgggctcgccggccggggtgccggccaccg	Protospacer
 .* ****** ***** **********    .

1747. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NC_010070 (Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence) position: , mismatch: 10, identity: 0.688 

atggagatcgtgccgtcgccgctgctgcgcca	CRISPR spacer
ttggagatcgtgccgtcgcaggtggtcttgtc	Protospacer
 ****************** * ** * .  .

1748. spacer 33.4|6446536|32|CP023865|CRISPRCasFinder matches to NC_010802 (Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence) position: , mismatch: 10, identity: 0.688 

atggagatcgtgccgtcgccgctgctgcgcca	CRISPR spacer
ttggagatcgtgccgtcgcaggtggtcttgtc	Protospacer
 ****************** * ** * .  .

1749. spacer 33.5|6446597|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688 

ggtgacccgtaccacccggccgccgcgttgac	CRISPR spacer
cctgacccggaccaccgggccgccggcctccg	Protospacer
  ******* ****** ********  .*

1750. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
ggcgggcgtcgcgccgttcgggaagcggatct	Protospacer
   ... **************** ** ****

1751. spacer 33.7|6446719|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ctgaaaagtcgcgccgttcgggacgctgatcg	CRISPR spacer
cgccggcgtcgcgccgttcgggaagcggatgt	Protospacer
*   .. **************** ** ***

1752. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgagcgcgccgccgaagatgagaaggggggc	Protospacer
******.********* ******  .   *

1753. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgagcgcgccgccgaagatgagaaggggggc	Protospacer
******.********* ******  .   *

1754. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
ccgagcgcgccgccgaagatgagaaggggggc	Protospacer
******.********* ******  .   *

1755. spacer 33.9|6446841|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_019220 (Burkholderia pseudomallei plasmid pPHB194, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgagcacgccgccgatgatgagccacttgta	CRISPR spacer
atggcttcgccgacgatgatgagccaattgat	Protospacer
 .*. . ***** ************* ***

1756. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
gctgctcgtggccggcccggagctggctgcgct	Protospacer
* .  . .******.************ ****

1757. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to NZ_CP037921 (Hymenobacter sp. 17J36-26 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
gctgctcgtggccggcccggagctggctgcgct	Protospacer
* .  . .******.************ ****

1758. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MF919500 (Mycobacterium phage Dalmatian, complete genome) position: , mismatch: 10, identity: 0.697 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggctgacccggagctggctgccga	Protospacer
.   ..******.************** **  *

1759. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 10, identity: 0.697 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggccgatcccgagctggcggctga	Protospacer
.   ..*********.** ***********  *

1760. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MN585983 (Mycobacterium phage Retro23, complete genome) position: , mismatch: 10, identity: 0.697 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggctgacccggagctggctgcaga	Protospacer
.   ..******.************** **. *

1761. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to MF919490 (Mycobacterium phage Anselm, complete genome) position: , mismatch: 10, identity: 0.697 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggctgacccggagctggctgccga	Protospacer
.   ..******.************** **  *

1762. spacer 33.12|6447024|33|CP023865|CRISPRCasFinder matches to KX576639 (Mycobacterium phage DudeLittle, complete genome) position: , mismatch: 10, identity: 0.697 

gaccgcgatggccgacccggagctggcggcgca	CRISPR spacer
atggatgatggctgacccggagctggctgcaga	Protospacer
.   ..******.************** **. *

1763. spacer 33.14|6447146|32|CP023865|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688 

ttttcgcgatctcggcggtgctagcccacctg	CRISPR spacer
cgcggacgatgtcggcggtgctggcccaccac	Protospacer
. .  .**** ***********.*******

1764. spacer 33.24|6447756|32|CP023865|CRISPRCasFinder,PILER-CR matches to KX507344 (Streptomyces phage Godpower, complete genome) position: , mismatch: 10, identity: 0.688 

tatgagggcctggaggcgtacgtccaggccca	CRISPR spacer
gatgaggagctggaggcgtacgtcgaactgtg	Protospacer
 ******. *************** *. . ..

1765. spacer 33.26|6447878|33|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP023993 (Streptomyces malaysiensis strain DSM 4137 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697 

tctcgaccaccgcggcggccgccgcttggcgcc	CRISPR spacer
cgctcaccaccgcggcggccgccgtatgggtcg	Protospacer
. .. *******************. ***  *

1766. spacer 33.29|6448062|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK511056 (Pseudomonas phage BR293, partial genome) position: , mismatch: 10, identity: 0.688 

caccgggtgaacgcagcgagggtgtcgcccgg	CRISPR spacer
cggaacttgaacgcggcgaaggtgtcgcccaa	Protospacer
*.  .  *******.****.**********..

1767. spacer 33.29|6448062|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK511055 (Pseudomonas phage BR204, partial genome) position: , mismatch: 10, identity: 0.688 

caccgggtgaacgcagcgagggtgtcgcccgg	CRISPR spacer
cggaacttgaacgcggcgaaggtgtcgcccaa	Protospacer
*.  .  *******.****.**********..

1768. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 10, identity: 0.688 

gtccccgccgcccggctcggcgcgagcttttt	CRISPR spacer
gtcgccgccgcccggcgcggcgcggtgccgca	Protospacer
*** ************ *******.  .. .

1769. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688 

gtccccgccgcccggctcggcgcgagcttttt	CRISPR spacer
ttccaggccgcccggctcggcgcgatggccgg	Protospacer
 ***  *******************   ..

1770. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP031468 (Paraburkholderia caffeinilytica strain CF1 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688 

gtccccgccgcccggctcggcgcgagcttttt	CRISPR spacer
ctcctcgtcgcccggctcggcgcgcagaacgt	Protospacer
 ***.**.**************** .   . *

1771. spacer 33.31|6448184|32|CP023865|CRISPRCasFinder,PILER-CR matches to MN369758 (Gordonia phage NHagos, complete genome) position: , mismatch: 10, identity: 0.688 

gtccccgccgcccggctcggcgcgagcttttt	CRISPR spacer
agcaccgccgcccggctcggggtgagccgggc	Protospacer
. * **************** *.****.   .

1772. spacer 33.33|6448306|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 10, identity: 0.688 

gtgcccgcgatgttgcgcgcgacgccccggtc	CRISPR spacer
ctgcccccgatgttgggcgcgacgacgtacat	Protospacer
 ***** ******** ******** * ..  .

1773. spacer 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR matches to MT553347 (Mycobacterium phage Awesomesauce, complete genome) position: , mismatch: 10, identity: 0.688 

gaccactccgtgatccgctcggcgagcgtgcc	CRISPR spacer
agcatctccgtgatccgctcgggaagcggctt	Protospacer
..*  ***************** .****  ..

1774. spacer 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK977707 (Mycobacterium phage LilSpotty, complete genome) position: , mismatch: 10, identity: 0.688 

gaccactccgtgatccgctcggcgagcgtgcc	CRISPR spacer
agcatctccgtgatccgctcgggaagcggctt	Protospacer
..*  ***************** .****  ..

1775. spacer 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH020243 (Mycobacterium phage TootsiePop, complete genome) position: , mismatch: 10, identity: 0.688 

gaccactccgtgatccgctcggcgagcgtgcc	CRISPR spacer
agcatctccgtgatccgctcgggaagcggctt	Protospacer
..*  ***************** .****  ..

1776. spacer 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR matches to MH020242 (Mycobacterium phage Misha28, complete genome) position: , mismatch: 10, identity: 0.688 

gaccactccgtgatccgctcggcgagcgtgcc	CRISPR spacer
agcatctccgtgatccgctcgggaagcggctt	Protospacer
..*  ***************** .****  ..

1777. spacer 33.35|6448428|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK494120 (Mycobacterium phage Piper2020, complete genome) position: , mismatch: 10, identity: 0.688 

gaccactccgtgatccgctcggcgagcgtgcc	CRISPR spacer
agcatctccgtgatccgctcgggaagcggctt	Protospacer
..*  ***************** .****  ..

1778. spacer 33.37|6448550|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 10, identity: 0.688 

agctccgcgccgaccaggtgcgagaagtcccg	CRISPR spacer
ggctcgccgccgaccaggtgcgaggcgatgat	Protospacer
.****  *****************. * .

1779. spacer 33.41|6448794|32|CP023865|CRISPRCasFinder,PILER-CR matches to MK962628 (Achromobacter phage vB_AxyP_19-32_Axy09, complete genome) position: , mismatch: 10, identity: 0.688 

ccgaagtccatgtcggcgtcctggtcaagaag	CRISPR spacer
accgcatccaggtcggcgtcctggtcgagttc	Protospacer
 * . .**** ***************.**

1780. spacer 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 10, identity: 0.688 

cgggccaccgtgacgcccagctgcgcgctgtc	CRISPR spacer
caagccaccttgaagcccagctgcgccgcacg	Protospacer
*..****** *** ************  ...

1781. spacer 33.65|6447512|39|CP023865|CRT matches to NZ_CP009295 (Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence) position: , mismatch: 10, identity: 0.744 

gcgt-tccggacggtcggggacctggccgacgcgggacca	CRISPR spacer
-cgcatgcggacggtcgcggagctggccgacgcggtcatc	Protospacer
 **. * ********** *** *************   .

1782. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 10, identity: 0.688 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
cgcgcgtgcaccagcgacgccggccgggcgct	Protospacer
   *.  *********.********.****

1783. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 10, identity: 0.688 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
ccggtcaccaccagcggcaccggcagatccca	Protospacer
 ****** **********.***** .. *  .

1784. spacer 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688 

gcagcaacggcacctacacgctggccaccaag	CRISPR spacer
agaaggtcggcaccaacacgctggcctccagc	Protospacer
. *. . ******* *********** ***.

1785. spacer 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688 

gcagcaacggcacctacacgctggccaccaag	CRISPR spacer
agaaggtcggcaccaacacgctggcctccagc	Protospacer
. *. . ******* *********** ***.

1786. spacer 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688 

gcagcaacggcacctacacgctggccaccaag	CRISPR spacer
agaaggtcggcaccaacacgctggcctccagc	Protospacer
. *. . ******* *********** ***.

1787. spacer 34.5|6458875|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688 

gcagcaacggcacctacacgctggccaccaag	CRISPR spacer
agaaggtcggcaccaacacgctggcctccagc	Protospacer
. *. . ******* *********** ***.

1788. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 10, identity: 0.688 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gtcggtgacgacaccgtcggcggcgcggtcga	Protospacer
  *. ...*****************.* ***.

1789. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 10, identity: 0.688 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
gcgggcagctacaccgccggcggcgtgcgggc	Protospacer
   . **** ******.***********  *

1790. spacer 34.8|6459059|33|CP023865|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697 

agcagaccgtgggcggccctggctcgggcgtac	CRISPR spacer
tggccgtggtgggcggcccaggcacgggcgtag	Protospacer
 *   .. *********** *** ********

1791. spacer 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgtccgccaggaagttgtgcggatcgtcggc	CRISPR spacer
agcaccgcaaggaagttgtccggatcgccatt	Protospacer
    **** ********** *******.*. .

1792. spacer 34.9|6459121|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgtccgccaggaagttgtgcggatcgtcggc	CRISPR spacer
aataccgccaggaagttgtccgggtcgccatt	Protospacer
    *************** ***.***.*. .

1793. spacer 34.13|6459365|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tggctcagcaggatgaacggctcgcagccaga	CRISPR spacer
ccggagggctggatgaacggctcgccgccatc	Protospacer
. *   .** *************** ****

1794. spacer 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 10, identity: 0.688 

gacgcgccgagcatcgcggtcgggatgatgcg	CRISPR spacer
atgatgcccggcatcgcggtcgggatgacgat	Protospacer
.  ..*** .******************.*

1795. spacer 34.19|6459732|32|CP023865|CRISPRCasFinder,CRT matches to NC_007491 (Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence) position: , mismatch: 10, identity: 0.688 

gacgcgccgagcatcgcggtcgggatgatgcg	CRISPR spacer
atgatgcccggcatcgcggtcgggatgacgat	Protospacer
.  ..*** .******************.*

1796. spacer 34.20|6459793|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 10, identity: 0.688 

tgagaaacggacggggccggcacgcccatgcc	CRISPR spacer
gcccaaacgggcggggccggtacgccccgctc	Protospacer
    ******.*********.******   .*

1797. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 10, identity: 0.688 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
agcccggcgaccgcccgctcggcgcgctcgca	Protospacer
 * ******** ********* ****  . .

1798. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 10, identity: 0.688 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
ttcttggcggcggcgcgctcgtcgcgggcgac	Protospacer
.  ..****.**** *************.  *

1799. spacer 34.25|6460098|32|CP023865|CRISPRCasFinder,CRT matches to NC_048789 (Corynebacterium phage Stiles, complete genome) position: , mismatch: 10, identity: 0.688 

cggccggcgacggcccgctcgtcgcgggtttc	CRISPR spacer
ttcttggcggcggcgcgctcgtcgcgggcgac	Protospacer
.  ..****.**** *************.  *

1800. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
agacatgagcagagtcgccagccagcgcagat	Protospacer
.*.  .******.******.********* .

1801. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
agacatgagcagagtcgccagccagcgcagat	Protospacer
.*.  .******.******.********* .

1802. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
gcatgattgcagggtcggcggcgagcgcacgc	Protospacer
* .     ********* **** ********

1803. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
ccgcataggccgggtcgccgcccagcgcacgc	Protospacer
  *  ...** ********* **********

1804. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 10, identity: 0.688 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
gcatgattgcagggtcggcggcgagcgcacgc	Protospacer
* .     ********* **** ********

1805. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.688 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
aacgatcgccaggatcgccggccggcgcacga	Protospacer
.. * . . ****.*********.********

1806. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 10, identity: 0.688 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
gcataatggcagggtcggcggcgagcgcacgc	Protospacer
* .    .********* **** ********

1807. spacer 34.28|6460281|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 10, identity: 0.688 

ggggtcgagcagggtcgccggccagcgcacga	CRISPR spacer
gcatgatggcagggtcggcggcgagcgcacgc	Protospacer
* .    .********* **** ********

1808. spacer 34.30|6460403|32|CP023865|CRISPRCasFinder,CRT matches to MT310898 (Streptomyces phage Kela, complete genome) position: , mismatch: 10, identity: 0.688 

gcgttcgactgctccgggctgatgcagtggat	CRISPR spacer
cgcttcgactgctccgggctggtccacttcgc	Protospacer
   ******************.* ** *  ..

1809. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
gagaagggcgcgttcaccggcgcgctgcagcg	Protospacer
 *    ** ************** *****

1810. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.688 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
acccccgcggcggtcaccggcgcccccgccac	Protospacer
  ***** **** ************.   *..

1811. spacer 34.31|6460464|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 10, identity: 0.688 

taccccggggcgttcaccggcgccctgcacgt	CRISPR spacer
gccgccggggcgctcacctgcgccctggtgaa	Protospacer
  * ********.***** ********   .

1812. spacer 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.688 

tacgtcgcgggcgtggcgggctggtcgattga	CRISPR spacer
gccgtcgcgggcggggccggctggtgggcacg	Protospacer
  *********** *** ******* *..  .

1813. spacer 34.32|6460525|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NC_042014 (Arthrobacter phage Piccoletto, complete genome) position: , mismatch: 10, identity: 0.688 

tacgtcgcgggcgtggcgggctggtcgattga	CRISPR spacer
agctcggcgggcgtggcgggctggctgatgcg	Protospacer
 .* . ******************..***  .

1814. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015092 (Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence) position: , mismatch: 10, identity: 0.688 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
atcgcgatcctcggcaccctcggtgctgtgat	Protospacer
*.  .***********.* *********...

1815. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049815 (Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
atcgcgatcctcggcaccctcggtgctgtgat	Protospacer
*.  .***********.* *********...

1816. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010861 (Marinovum algicola DG 898 plasmid pMaD6, complete sequence) position: , mismatch: 10, identity: 0.688 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
atcgcgatcctcggcaccctcggtgctgtgat	Protospacer
*.  .***********.* *********...

1817. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045320 (Roseivivax sp. THAF197b plasmid pTHAF197b_b, complete sequence) position: , mismatch: 10, identity: 0.688 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
atcgcgatcctcggcaccctcggtgctgtgat	Protospacer
*.  .***********.* *********...

1818. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030100 (Roseovarius sp. AK1035 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
atcgcgatcctcggcaccctcggtgctgtgat	Protospacer
*.  .***********.* *********...

1819. spacer 34.35|6460709|32|CP023865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020475 (Roseovarius mucosus strain SMR3 plasmid pSMR3-1, complete sequence) position: , mismatch: 10, identity: 0.688 

acgctgatcctcggcatcgtcggtgctgcagg	CRISPR spacer
atcgcgatcctcggcaccctcggtgctgtgat	Protospacer
*.  .***********.* *********...

1820. spacer 34.37|6460833|30|CP023865|CRISPRCasFinder,CRT matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667 

ctgttcgataaaccgaacagtcaggagatc	CRISPR spacer
aaaatcgataaaccgaacattcaggccgca	Protospacer
  . *************** *****  ..

1821. spacer 34.43|6461197|32|CP023865|CRISPRCasFinder,CRT matches to MN746332 (Rauchvirus SR18, complete genome) position: , mismatch: 10, identity: 0.688 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
cggttggccgccgggccgtgcgggagcggaat	Protospacer
 *************** ** **** .   . *

1822. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 10, identity: 0.688 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
gcttcggacaccgtgcgcagatcggcgatgcg	Protospacer
.*..  *******.****** ********

1823. spacer 34.46|6461382|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgtcgcgcacggcgcgcacctcggcgatcag	Protospacer
 * .   .*** ******* ***********

1824. spacer 34.47|6461443|32|CP023865|CRISPRCasFinder,CRT matches to MT104122 (Sporosarcina phage Lietuvens, complete genome) position: , mismatch: 10, identity: 0.688 

atcaagcaggacgcgaagaagcggatcggcta	CRISPR spacer
catgacgaggacgcaatgaagcggatcggcgc	Protospacer
  ..*  *******.* *************

1825. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1826. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1827. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1828. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1829. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1830. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP049749 (Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcaccaccgtcaccgcgatcgcgccgccttt	Protospacer
   . *************.***** ****  .

1831. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
tggttggccggcaccgcggtcccggcgccgct	Protospacer
. *   .*** ********** ******** .

1832. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP048421 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
gcgtaggcctcgtcatctcggtgctggaagat	Protospacer
.  * *** ******* ***********.. .

1833. spacer 34.50|6461626|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.688 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
gcttcggcatcgtcaattcggtgctgtgggcg	Protospacer
. .************  ********* .*..

1834. spacer 34.53|6460838|30|CP023865|PILER-CR matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667 

ctgttcgataaaccgaacagtcaggagatc	CRISPR spacer
aaaatcgataaaccgaacattcaggccgca	Protospacer
  . *************** *****  ..

1835. spacer 34.59|6461202|32|CP023865|PILER-CR matches to MN746332 (Rauchvirus SR18, complete genome) position: , mismatch: 10, identity: 0.688 

gggttggccgccgggcagtccgggcagtcgtt	CRISPR spacer
cggttggccgccgggccgtgcgggagcggaat	Protospacer
 *************** ** **** .   . *

1836. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 10, identity: 0.688 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
gcttcggacaccgtgcgcagatcggcgatgcg	Protospacer
.*..  *******.****** ********

1837. spacer 34.62|6461387|32|CP023865|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

acccgtgacaccgcgcgcagctcggcgatcac	CRISPR spacer
tcgtcgcgcacggcgcgcacctcggcgatcag	Protospacer
 * .   .*** ******* ***********

1838. spacer 34.63|6461448|32|CP023865|PILER-CR matches to MT104122 (Sporosarcina phage Lietuvens, complete genome) position: , mismatch: 10, identity: 0.688 

atcaagcaggacgcgaagaagcggatcggcta	CRISPR spacer
catgacgaggacgcaatgaagcggatcggcgc	Protospacer
  ..*  *******.* *************

1839. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1840. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1841. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1842. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1843. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
gtaggcaccgtctgcgcggtcgcggccagcgt	Protospacer
 ..*********  ************    *.

1844. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP049749 (Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agcaccaccgtcaccgcgatcgcgccgccttt	Protospacer
   . *************.***** ****  .

1845. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
tggttggccggcaccgcggtcccggcgccgct	Protospacer
. *   .*** ********** ******** .

1846. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP048421 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
gcgtaggcctcgtcatctcggtgctggaagat	Protospacer
.  * *** ******* ***********.. .

1847. spacer 34.66|6461631|32|CP023865|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.688 

agctcggcatcgtcatgtcggtgctggagatc	CRISPR spacer
gcttcggcatcgtcaattcggtgctgtgggcg	Protospacer
. .************  ********* .*..

1848. spacer 33.5|6446597|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 11, identity: 0.656 

ggtgacccgtaccacccggccgccgcgttgac	CRISPR spacer
atccccctgtgccacccggccgccgcgtcccg	Protospacer
. .  **.**.*****************.

1849. spacer 33.20|6447512|32|CP023865|CRISPRCasFinder,PILER-CR matches to KT887559 (Pseudomonas phage phi3, complete genome) position: , mismatch: 11, identity: 0.656 

gcgttccggacggtcggggacctggccgacgc	CRISPR spacer
cacagcctgacggtcgaggacctggccggata	Protospacer
     ** ********.***********.

1850. spacer 33.27|6447940|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 11, identity: 0.656 

ctgcagcaactcccgcccggccgggcctggct	CRISPR spacer
gtgcaggaactccagcccggccggcagcacgc	Protospacer
 ***** ****** **********   ..  .

1851. spacer 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 11, identity: 0.656 

cgggccaccgtgacgcccagctgcgcgctgtc	CRISPR spacer
atctccaccgtgccgccaagctgcgcggcaag	Protospacer
    ******** **** ********* ..

1852. spacer 33.45|6449039|32|CP023865|CRISPRCasFinder,PILER-CR matches to NC_047751 (Ralstonia phage phiITL-1, complete genome) position: , mismatch: 11, identity: 0.656 

cgggccaccgtgacgcccagctgcgcgctgtc	CRISPR spacer
tcccgcaccgtgatgcccagcagcgcgcccag	Protospacer
.    ********.******* ******.

1853. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 11, identity: 0.656 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
cgcttcggcaccaccggcgccggccagctcga	Protospacer
    **.****** ************* . ..

1854. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 11, identity: 0.656 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
cgcttcggcaccaccggcgccggccagctcga	Protospacer
    **.****** ************* . ..

1855. spacer 34.3|6458753|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656 

gcggtcagcaccagcggcgccggccaggcgag	CRISPR spacer
cgtttcggcaccaccggcgccggccagctcga	Protospacer
    **.****** ************* . ..

1856. spacer 34.6|6458936|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP044550 (Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence) position: , mismatch: 11, identity: 0.656 

tgcatcagcgacaccgtcggcggcgtgctcgg	CRISPR spacer
cttgcgcgcgacactgtcggtggcgtgctcac	Protospacer
. ...  *******.*****.*********.

1857. spacer 34.17|6459610|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 11, identity: 0.656 

ggagcgctgatcgcggtagcaacggaggcgta	CRISPR spacer
acctttgtgatcgcggtcgcaacggtggcgct	Protospacer
.   .  ********** ******* ****.

1858. spacer 34.18|6459671|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656 

accacgctcaaggacgtgcccggcgcgaacat	CRISPR spacer
ggtccgctcgacgacgtgcccggcgcgctgcg	Protospacer
. . *****.* ***************

1859. spacer 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT matches to MK962641 (Achromobacter phage vB_AxyP_19-32_Axy24, complete genome) position: , mismatch: 11, identity: 0.656 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
cgcaccttgttggtcaccgggatgtggcgacc	Protospacer
   .******.********** *****... .

1860. spacer 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT matches to MK962626 (Achromobacter phage vB_AxyP_19-32_Axy04, complete genome) position: , mismatch: 11, identity: 0.656 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
cgcaccttgttggtcaccgggatgtggcgacc	Protospacer
   .******.********** *****... .

1861. spacer 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT matches to MK962631 (Achromobacter phage vB_AxyP_19-32_Axy12, complete genome) position: , mismatch: 11, identity: 0.656 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
cgcaccttgttggtcaccgggatgtggcgacc	Protospacer
   .******.********** *****... .

1862. spacer 34.38|6460892|32|CP023865|CRISPRCasFinder,CRT matches to KT321317 (Achromobacter phage phiAxp-3, complete genome) position: , mismatch: 11, identity: 0.656 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
cgcaccttgttggtcaccgggatgtggcgacc	Protospacer
   .******.********** *****... .

1863. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1864. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1865. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1866. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1867. spacer 34.40|6461014|32|CP023865|CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1868. spacer 34.41|6461075|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
cactggtcgccgggaccggggtcggtggcacc	Protospacer
    **********.* **********...

1869. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to MN657143 (Planococcus sp. (in: Bacteria) strain ANT_H26 plasmid pA26H3, complete sequence) position: , mismatch: 11, identity: 0.656 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
atttacaccgtcacagaggtcgcggcgctacg	Protospacer
 .  .********* * ***********..

1870. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to NZ_CP013660 (Planococcus kocurii strain ATCC 43650 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
atttacaccgtcacagaggtcgcggcgctacg	Protospacer
 .  .********* * ***********..

1871. spacer 34.48|6461504|32|CP023865|CRISPRCasFinder,CRT matches to MN033734 (Leviviridae sp. isolate H1_Bulk_29_scaffold_203 RNA-dependent RNA polymerase (H1Bulk29203_000001) gene, partial cds; and hypothetical protein (H1Bulk29203_000002) and hypothetical protein (H1Bulk29203_000003) genes, complete cds) position: , mismatch: 11, identity: 0.656 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agaggcaccgtcaacgcggtcgcagcatatcg	Protospacer
  .********** *********.**..

1872. spacer 34.54|6460897|32|CP023865|PILER-CR matches to MK962641 (Achromobacter phage vB_AxyP_19-32_Axy24, complete genome) position: , mismatch: 11, identity: 0.656 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
cgcaccttgttggtcaccgggatgtggcgacc	Protospacer
   .******.********** *****... .

1873. spacer 34.54|6460897|32|CP023865|PILER-CR matches to MK962626 (Achromobacter phage vB_AxyP_19-32_Axy04, complete genome) position: , mismatch: 11, identity: 0.656 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
cgcaccttgttggtcaccgggatgtggcgacc	Protospacer
   .******.********** *****... .

1874. spacer 34.54|6460897|32|CP023865|PILER-CR matches to MK962631 (Achromobacter phage vB_AxyP_19-32_Axy12, complete genome) position: , mismatch: 11, identity: 0.656 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
cgcaccttgttggtcaccgggatgtggcgacc	Protospacer
   .******.********** *****... .

1875. spacer 34.54|6460897|32|CP023865|PILER-CR matches to KT321317 (Achromobacter phage phiAxp-3, complete genome) position: , mismatch: 11, identity: 0.656 

gcggccttgtcggtcaccgggttgtggtaggt	CRISPR spacer
cgcaccttgttggtcaccgggatgtggcgacc	Protospacer
   .******.********** *****... .

1876. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1877. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1878. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1879. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1880. spacer 34.56|6461019|32|CP023865|PILER-CR matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgacccggcgtcaggcccggacgccccccgt	CRISPR spacer
ctactatggcttcaggcccggacgaccccccc	Protospacer
... . .*** ************* ***** .

1881. spacer 34.57|6461080|32|CP023865|PILER-CR matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

acgaggtcgccggggcgggggtcggtgatggg	CRISPR spacer
cactggtcgccgggaccggggtcggtggcacc	Protospacer
    **********.* **********...

1882. spacer 34.64|6461509|32|CP023865|PILER-CR matches to MN657143 (Planococcus sp. (in: Bacteria) strain ANT_H26 plasmid pA26H3, complete sequence) position: , mismatch: 11, identity: 0.656 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
atttacaccgtcacagaggtcgcggcgctacg	Protospacer
 .  .********* * ***********..

1883. spacer 34.64|6461509|32|CP023865|PILER-CR matches to NZ_CP013660 (Planococcus kocurii strain ATCC 43650 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
atttacaccgtcacagaggtcgcggcgctacg	Protospacer
 .  .********* * ***********..

1884. spacer 34.64|6461509|32|CP023865|PILER-CR matches to MN033734 (Leviviridae sp. isolate H1_Bulk_29_scaffold_203 RNA-dependent RNA polymerase (H1Bulk29203_000001) gene, partial cds; and hypothetical protein (H1Bulk29203_000002) and hypothetical protein (H1Bulk29203_000003) genes, complete cds) position: , mismatch: 11, identity: 0.656 

ccgggcaccgtcaccgcggtcgcggcgccggc	CRISPR spacer
agaggcaccgtcaacgcggtcgcagcatatcg	Protospacer
  .********** *********.**..

1885. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1886. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1887. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1888. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1889. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1890. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1891. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1892. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1893. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1894. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1895. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1896. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

1897. spacer 33.2|6446406|32|CP023865|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 16, identity: 0.5 

gactggctcggcggcccgggtgccggcgcgga-	CRISPR spacer
-cacgcgccggcgcccgggcggccgatgttgcc	Protospacer
   .*  .***** ** **  ****..*. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage