1. spacer 1.8|1744371|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016366 (Phaeobacter porticola strain P97 plasmid pP97_b, complete sequence) position: , mismatch: 6, identity: 0.8
gggggcgtcatcgattgtggtggtgatttg CRISPR spacer
ggcgatgtcatcgcttctggtggtgatttc Protospacer
** *..******* ** ************
2. spacer 1.16|1744899|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014802 (Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351) position: , mismatch: 6, identity: 0.8
cgaacccggcagacctgctttcccgtattg CRISPR spacer
atatcccggcagaccggctttcccgcatag Protospacer
* *********** *********.** *
3. spacer 1.16|1744899|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to MN428058 (Mycobacterium phage Krili, complete genome) position: , mismatch: 6, identity: 0.8
cgaacccggcagacctgctttcccgtattg- CRISPR spacer
ggaacccgccagacctgcttgcccg-acggc Protospacer
******* *********** **** *. *
4. spacer 1.16|1744899|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to MT818418 (Mycobacterium phage Shida, complete genome) position: , mismatch: 6, identity: 0.8
cgaacccggcagacctgctttcccgtattg- CRISPR spacer
ggaacccgccagacctgcttgcccg-acggc Protospacer
******* *********** **** *. *
5. spacer 1.16|1744899|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to MH926062 (Mycobacterium phage Vorrps, complete genome) position: , mismatch: 6, identity: 0.8
cgaacccggcagacctgctttcccgtattg- CRISPR spacer
ggaacccgccagacctgcttgcccg-acggc Protospacer
******* *********** **** *. *
6. spacer 1.16|1744899|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 6, identity: 0.8
cgaacccggcagacctgctttcccgtattg- CRISPR spacer
ggaacccgccagacctgcttgcccg-acggc Protospacer
******* *********** **** *. *
7. spacer 1.16|1744899|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to MT818425 (Mycobacterium phage NiebruSaylor, complete genome) position: , mismatch: 6, identity: 0.8
cgaacccggcagacctgctttcccgtattg- CRISPR spacer
ggaacccgccagacctgcttgcccg-acggc Protospacer
******* *********** **** *. *
8. spacer 1.20|1745162|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050151 (Hafnia alvei strain A23BA plasmid pA23BA, complete sequence) position: , mismatch: 7, identity: 0.767
gtatccttaaactcttcaatggtcttcggg CRISPR spacer
tcatcctctaactcttcaatggtcttgagc Protospacer
.*****. ***************** .*
9. spacer 1.20|1745162|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
gtatccttaaactcttcaatggtcttcggg CRISPR spacer
gtggtgttaatctcttcaatggtctgcggt Protospacer
**. . **** ************** ***
10. spacer 1.20|1745162|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 7, identity: 0.767
gtatccttaaactcttcaatggtcttcggg CRISPR spacer
gtggtgttaatctcttcaatggtctgcggt Protospacer
**. . **** ************** ***
11. spacer 1.20|1745162|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036439 (Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gtatccttaaactcttcaatggtcttcggg CRISPR spacer
gtggtgttaatctcttcaatggtctgcggt Protospacer
**. . **** ************** ***
12. spacer 1.23|1745360|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KM406416 (Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence) position: , mismatch: 7, identity: 0.767
tatttgc-----cgaaacggtatctgacgcccgcc CRISPR spacer
-----gccgacgcgaaacggtatctgccgcccgac Protospacer
** ************** ****** *
13. spacer 1.24|1745426|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to MK685668 (Shigella phage VB_Ship_A7, complete genome) position: , mismatch: 7, identity: 0.767
aaggggttgtaggtcaactggtccacaatg CRISPR spacer
agtgggatgtaggtcaacgggtccacacca Protospacer
*. *** *********** ******** ..
14. spacer 1.6|1744240|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 8, identity: 0.733
ccggggaatccgggggtgccaagcctgttt CRISPR spacer
ccggggaatccgggagtgccagcccatgac Protospacer
**************.******. ** .
15. spacer 1.16|1744899|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaacccggcagacctgctttcccgtattg CRISPR spacer
tctacccggcagacgtgccttcccgtctcc Protospacer
. *********** ***.******* *.
16. spacer 1.12|1744635|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NC_002575 (Agrobacterium rhizogenes plasmid pRi1724 DNA, complete sequence) position: , mismatch: 9, identity: 0.7
tcgtgagagccgccgccgctaagttaagag CRISPR spacer
tcgtgagagccgcggccgccaagcaggcga Protospacer
************* *****.***. .. ..
17. spacer 1.12|1744635|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY000038 (Agrobacterium rhizogenes strain 1724 plasmid pRi_1724, complete sequence) position: , mismatch: 9, identity: 0.7
tcgtgagagccgccgccgctaagttaagag CRISPR spacer
tcgtgagagccgcggccgccaagcaggcga Protospacer
************* *****.***. .. ..
18. spacer 1.23|1745360|30|CP024736|CRISPRCasFinder,CRT,PILER-CR matches to NC_027348 (Delftia phage RG-2014, complete genome) position: , mismatch: 9, identity: 0.7
tatttgccgaaacggtatctgacgcccgcc CRISPR spacer
cccatgccgaagcggtagctgacgcccagg Protospacer
. . *******.***** *********.
19. spacer 2.1|2171334|34|CP024736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.735
tcaaggcgattgattgaccagttcggcaagtagt CRISPR spacer
gcttggcgaaagattgaccagttcggcaagctcg Protospacer
* ***** *******************.
20. spacer 2.7|2171723|34|CP024736|PILER-CR,CRISPRCasFinder,CRT matches to MH925093 (UNVERIFIED: Vibrio phage VspDsh_1, complete genome) position: , mismatch: 9, identity: 0.735
cgtttccgggttttcgattatgcgcactaggccc CRISPR spacer
cgtttcagggttttcgattaagcgtagctgagct Protospacer
****** ************* ***.* . *. *.
21. spacer 2.3|2171464|34|CP024736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034911 (Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
agccaaccgcttatgacgttctcgcttgcctgac CRISPR spacer
agccaacctcttatgacgttcacgtcgacgccgg Protospacer
******** ************ **.. .* . .
22. spacer 2.3|2171464|34|CP024736|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018236 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed8) position: , mismatch: 11, identity: 0.676
agccaaccgcttatgacgttctcgcttgcctgac CRISPR spacer
agccaacctcttatgacgttcacgtcgacaccgg Protospacer
******** ************ **.. .* . .