Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029923 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome 1 crisprs DEDDh,WYL,cas3,DinG,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 5 12 0
CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 1 crisprs csa3 0 2 2 0

Results visualization

1. CP029923
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029923_1 2902169-2902589 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 453979-454010 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 251896-251927 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 6517-6548 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 238872-238903 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 235351-235382 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 378779-378810 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 82539-82570 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 224279-224310 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 221127-221158 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 284046-284077 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 219145-219176 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 55495-55526 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 376216-376247 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 134871-134902 5 0.844
CP029923_1 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT 2902320-2902351 32 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 88841-88872 5 0.844
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 453978-454010 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 251896-251928 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 6516-6548 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 238872-238904 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 235350-235382 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 378778-378810 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 82539-82571 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 224279-224311 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 221127-221159 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 284046-284078 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 219145-219177 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 55495-55527 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 376216-376248 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 134871-134903 6 0.818
CP029923_1 1.9|2902321|33|CP029923|PILER-CR 2902321-2902353 33 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 88840-88872 6 0.818
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 KJ019071 Synechococcus phage ACG-2014g isolate Syn7803US105, complete genome 59609-59640 7 0.781
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694480 Marine virus AFVG_250M133, complete genome 20886-20917 7 0.781
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694671 Marine virus AFVG_250M145, complete genome 23163-23194 7 0.781
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694753 Marine virus AFVG_250M144, complete genome 25459-25490 7 0.781
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694231 Marine virus AFVG_250M143, complete genome 21163-21194 7 0.781
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN693981 Marine virus AFVG_250M146, complete genome 18773-18804 7 0.781
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 559039-559070 8 0.75
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 214654-214685 8 0.75
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 578776-578807 8 0.75
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 592092-592123 8 0.75
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694115 Marine virus AFVG_250M901, complete genome 49467-49498 8 0.75
CP029923_1 1.11|2902443|33|CP029923|PILER-CR 2902443-2902475 33 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 559038-559070 8 0.758
CP029923_1 1.11|2902443|33|CP029923|PILER-CR 2902443-2902475 33 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 214653-214685 8 0.758
CP029923_1 1.11|2902443|33|CP029923|PILER-CR 2902443-2902475 33 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 578775-578807 8 0.758
CP029923_1 1.11|2902443|33|CP029923|PILER-CR 2902443-2902475 33 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 592092-592124 8 0.758
CP029923_1 1.11|2902443|33|CP029923|PILER-CR 2902443-2902475 33 KJ019071 Synechococcus phage ACG-2014g isolate Syn7803US105, complete genome 59609-59641 8 0.758
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 NZ_CP046630 Streptococcus equinus strain CNU G6 plasmid p1_CNU_G6, complete sequence 66427-66458 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 NZ_CP046920 Streptococcus sp. CNU G2 plasmid p_CNU_G2, complete sequence 70206-70237 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694046 Marine virus AFVG_250M906, complete genome 22321-22352 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN693836 Marine virus AFVG_250M487, complete genome 10882-10913 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN693891 Marine virus AFVG_250M480, complete genome 21841-21872 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MK268344 Salmonella phage Munch, complete genome 122526-122557 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694071 Marine virus AFVG_250M483, complete genome 16976-17007 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694294 Marine virus AFVG_250M486, complete genome 8469-8500 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN693751 Marine virus AFVG_250M485, complete genome 13096-13127 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694002 Marine virus AFVG_250M481, complete genome 18787-18818 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694650 Marine virus AFVG_250M482, complete genome 20198-20229 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN693906 Marine virus AFVG_250M905, complete genome 17506-17537 9 0.719
CP029923_1 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT 2902442-2902473 32 MN694711 Marine virus AFVG_250M484, complete genome 24974-25005 9 0.719
CP029923_1 1.6|2902503|32|CP029923|CRISPRCasFinder,CRT 2902503-2902534 32 KR052482 Sinorhizobium phage phiN3, complete genome 197290-197321 9 0.719

1. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

2. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

3. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

4. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

5. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

6. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

7. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

8. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

9. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

10. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

11. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

12. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

13. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

14. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

15. spacer 1.3|2902320|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 5, identity: 0.844

ccacgatgtatgccgaccgtgatttttaccgc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagc	Protospacer
*********** **** **********   **

16. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

17. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

18. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

19. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

20. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

21. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

22. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

23. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

24. spacer 1.9|2902321|33|CP029923|PILER-CR matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

25. spacer 1.9|2902321|33|CP029923|PILER-CR matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

26. spacer 1.9|2902321|33|CP029923|PILER-CR matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

27. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

28. spacer 1.9|2902321|33|CP029923|PILER-CR matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

29. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

30. spacer 1.9|2902321|33|CP029923|PILER-CR matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 6, identity: 0.818

ccacgatgtatgccgaccgtgatttttaccgcc	CRISPR spacer
ccacgatgtatcccgagcgtgatttttcgagcg	Protospacer
*********** **** **********   ** 

31. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to KJ019071 (Synechococcus phage ACG-2014g isolate Syn7803US105, complete genome) position: , mismatch: 7, identity: 0.781

attaaaaaagattaatgttggttatagtttta	CRISPR spacer
aattacaatggttaatgttggttatagtttag	Protospacer
* * * ** *.******************* .

32. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694480 (Marine virus AFVG_250M133, complete genome) position: , mismatch: 7, identity: 0.781

attaaaaaa----gattaatgttggttatagtttta	CRISPR spacer
----gaaaatttcgattaatgttagttgtagtttta	Protospacer
    .****    **********.***.********

33. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694671 (Marine virus AFVG_250M145, complete genome) position: , mismatch: 7, identity: 0.781

attaaaaaa----gattaatgttggttatagtttta	CRISPR spacer
----gaaaatttcgattaatgttagttgtagtttta	Protospacer
    .****    **********.***.********

34. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694753 (Marine virus AFVG_250M144, complete genome) position: , mismatch: 7, identity: 0.781

attaaaaaa----gattaatgttggttatagtttta	CRISPR spacer
----gaaaatttcgattaatgttagttgtagtttta	Protospacer
    .****    **********.***.********

35. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694231 (Marine virus AFVG_250M143, complete genome) position: , mismatch: 7, identity: 0.781

attaaaaaa----gattaatgttggttatagtttta	CRISPR spacer
----gaaaatttcgattaatgttagttgtagtttta	Protospacer
    .****    **********.***.********

36. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN693981 (Marine virus AFVG_250M146, complete genome) position: , mismatch: 7, identity: 0.781

attaaaaaa----gattaatgttggttatagtttta	CRISPR spacer
----gaaaatttcgattaatgttagttgtagtttta	Protospacer
    .****    **********.***.********

37. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 8, identity: 0.75

attaaaaaagattaatgttggtta--tagtttta	CRISPR spacer
attaagaaagattaatgttgtttaatcaacgt--	Protospacer
*****.************** ***  .*.. *  

38. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 8, identity: 0.75

attaaaaaagattaatgttggtta--tagtttta	CRISPR spacer
attaagaaagattaatgttgtttaatcaacgt--	Protospacer
*****.************** ***  .*.. *  

39. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 8, identity: 0.75

attaaaaaagattaatgttggtta--tagtttta	CRISPR spacer
attaagaaagattaatgttgtttaatcaacgt--	Protospacer
*****.************** ***  .*.. *  

40. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 8, identity: 0.75

attaaaaaagattaatgttggtta--tagtttta	CRISPR spacer
attaagaaagattaatgttgtttaatcaacgt--	Protospacer
*****.************** ***  .*.. *  

41. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694115 (Marine virus AFVG_250M901, complete genome) position: , mismatch: 8, identity: 0.75

attaaaaaagattaatgttggttatagtttta	CRISPR spacer
attaaaaaatattaatcttggttcttccgtaa	Protospacer
********* ****** ****** *  . * *

42. spacer 1.11|2902443|33|CP029923|PILER-CR matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 8, identity: 0.758

attaaaaaagattaatgttggttatagttttac---	CRISPR spacer
attaagaaagattaatgttgttta---atcaacgta	Protospacer
*****.************** ***    *. **   

43. spacer 1.11|2902443|33|CP029923|PILER-CR matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 8, identity: 0.758

attaaaaaagattaatgttggttatagttttac---	CRISPR spacer
attaagaaagattaatgttgttta---atcaacgta	Protospacer
*****.************** ***    *. **   

44. spacer 1.11|2902443|33|CP029923|PILER-CR matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 8, identity: 0.758

attaaaaaagattaatgttggttatagttttac---	CRISPR spacer
attaagaaagattaatgttgttta---atcaacgta	Protospacer
*****.************** ***    *. **   

45. spacer 1.11|2902443|33|CP029923|PILER-CR matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 8, identity: 0.758

attaaaaaagattaatgttggttatagttttac---	CRISPR spacer
attaagaaagattaatgttgttta---atcaacgta	Protospacer
*****.************** ***    *. **   

46. spacer 1.11|2902443|33|CP029923|PILER-CR matches to KJ019071 (Synechococcus phage ACG-2014g isolate Syn7803US105, complete genome) position: , mismatch: 8, identity: 0.758

attaaaaaagattaatgttggttatagttttac	CRISPR spacer
aattacaatggttaatgttggttatagtttagg	Protospacer
* * * ** *.******************* . 

47. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP046630 (Streptococcus equinus strain CNU G6 plasmid p1_CNU_G6, complete sequence) position: , mismatch: 9, identity: 0.719

attaaaaaagattaatgttggttatagtttta	CRISPR spacer
aagaaaaatgattaatgttgtttataataact	Protospacer
*  ***** *********** *****.*  . 

48. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to NZ_CP046920 (Streptococcus sp. CNU G2 plasmid p_CNU_G2, complete sequence) position: , mismatch: 9, identity: 0.719

attaaaaaagattaatgttggttatagtttta	CRISPR spacer
aagaaaaatgattaatgttgtttataataact	Protospacer
*  ***** *********** *****.*  . 

49. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694046 (Marine virus AFVG_250M906, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

50. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN693836 (Marine virus AFVG_250M487, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

51. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN693891 (Marine virus AFVG_250M480, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

52. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MK268344 (Salmonella phage Munch, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaagattaatgttggttatagtttta	CRISPR spacer
ggcagcattgattaatgatggttttagtttta	Protospacer
. .*. *  ******** ***** ********

53. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694071 (Marine virus AFVG_250M483, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

54. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694294 (Marine virus AFVG_250M486, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

55. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN693751 (Marine virus AFVG_250M485, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

56. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694002 (Marine virus AFVG_250M481, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

57. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694650 (Marine virus AFVG_250M482, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

58. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN693906 (Marine virus AFVG_250M905, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

59. spacer 1.5|2902442|32|CP029923|CRISPRCasFinder,CRT matches to MN694711 (Marine virus AFVG_250M484, complete genome) position: , mismatch: 9, identity: 0.719

attaaaaaa-----gattaatgttggttatagtttta	CRISPR spacer
-----gaagttttcgattaatgttagttgtagtttta	Protospacer
     .**.     **********.***.********

60. spacer 1.6|2902503|32|CP029923|CRISPRCasFinder,CRT matches to KR052482 (Sinorhizobium phage phiN3, complete genome) position: , mismatch: 9, identity: 0.719

taaaacaccggttgcgcaacctccgcggggat	CRISPR spacer
aacaacaccggttgcgaaacctacgcaaaaaa	Protospacer
 * ************* ***** ***....* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 930261 : 937573 6 Dickeya_phage(16.67%) protease,integrase attL 931512:931526|attR 942691:942705
DBSCAN-SWA_2 1008486 : 1085798 93 Salmonella_phage(73.33%) transposase,protease,tail,integrase,terminase attL 990552:990571|attR 1061159:1061178
DBSCAN-SWA_3 1528616 : 1601742 80 Burkholderia_virus(43.24%) transposase,protease,head,tail,tRNA,plate NA
DBSCAN-SWA_4 1782779 : 1787191 6 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_5 1991044 : 1998278 7 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_6 2104579 : 2115086 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_7 2192315 : 2201486 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 2737035 : 2750427 11 Salmonella_phage(70.0%) tail NA
DBSCAN-SWA_9 3067727 : 3111430 44 Bacillus_virus(33.33%) tRNA,transposase,protease,bacteriocin NA
DBSCAN-SWA_10 3488749 : 3526807 46 Salmonella_phage(82.05%) transposase,capsid,portal,tail,integrase,terminase,plate attL 3483713:3483727|attR 3495879:3495893
DBSCAN-SWA_11 4442502 : 4516666 76 Salmonella_phage(82.98%) capsid,portal,tail,integrase,terminase,plate attL 4504003:4504019|attR 4516825:4516841
DBSCAN-SWA_12 4658918 : 4669177 13 Enterobacteria_phage(77.78%) capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP029924
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029924_1 111557-111714 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 81476-81526 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 182983-183033 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 180762-180812 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 96276-96326 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 235796-235846 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 42635-42685 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 152742-152792 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 142863-142913 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 133710-133760 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 117174-117224 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 192529-192579 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 11544-11594 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 MN232190 Escherichia coli plasmid pGD27-31, complete sequence 77135-77185 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 247816-247866 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 175824-175874 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 29608-29658 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 195030-195080 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 160405-160455 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 229056-229106 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 1240-1290 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 150895-150945 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 222888-222938 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 157698-157748 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 163625-163675 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 139403-139453 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 103197-103247 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NC_002305 Salmonella typhi plasmid R27, complete sequence 54047-54097 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 156262-156312 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 114948-114998 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 99282-99332 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 190141-190191 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 186842-186892 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 163174-163224 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 95412-95462 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 154888-154938 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 135342-135392 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 101555-101605 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 111577-111627 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 163625-163675 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 192086-192136 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 157699-157749 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 237889-237939 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 79517-79567 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 106159-106209 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 267735-267785 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 173816-173866 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 95376-95426 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 230101-230151 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 20571-20621 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 1141-1191 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 259337-259387 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 210872-210922 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 110178-110228 0 1.0
CP029924_1 1.1|111577|51|CP029924|PILER-CR 111577-111627 51 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 111658-111708 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 42568-42614 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 152675-152721 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 142796-142842 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 133643-133689 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 117107-117153 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 192462-192508 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 11477-11523 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 150828-150874 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 163558-163604 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 139336-139382 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 103130-103176 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NC_002305 Salmonella typhi plasmid R27, complete sequence 53980-54026 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 190074-190120 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 154821-154867 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 135275-135321 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 101488-101534 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 163558-163604 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 79450-79496 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 230034-230080 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 110111-110157 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 81547-81593 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 183054-183100 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 180833-180879 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 96347-96393 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 235867-235913 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 MN232190 Escherichia coli plasmid pGD27-31, complete sequence 77206-77252 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 247887-247933 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 175895-175941 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 29679-29725 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 195101-195147 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 160476-160522 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 229127-229173 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 1311-1357 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 222959-223005 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 157769-157815 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 156333-156379 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 115019-115065 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 99353-99399 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 186913-186959 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 163245-163291 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 95483-95529 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 111648-111694 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 192157-192203 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 157770-157816 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 237960-238006 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 106230-106276 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 267806-267852 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 173887-173933 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 95447-95493 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 20642-20688 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 1212-1258 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 259408-259454 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 210943-210989 0 1.0
CP029924_1 1.2|111648|47|CP029924|PILER-CR 111648-111694 47 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 111729-111775 0 1.0

1. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

2. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

3. spacer 1.1|111577|51|CP029924|PILER-CR matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

4. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

5. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

6. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

7. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

8. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

9. spacer 1.1|111577|51|CP029924|PILER-CR matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

10. spacer 1.1|111577|51|CP029924|PILER-CR matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

11. spacer 1.1|111577|51|CP029924|PILER-CR matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

12. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

13. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

14. spacer 1.1|111577|51|CP029924|PILER-CR matches to MN232190 (Escherichia coli plasmid pGD27-31, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

15. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

16. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

17. spacer 1.1|111577|51|CP029924|PILER-CR matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

18. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

19. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

20. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

21. spacer 1.1|111577|51|CP029924|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

22. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

23. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

24. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

25. spacer 1.1|111577|51|CP029924|PILER-CR matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

26. spacer 1.1|111577|51|CP029924|PILER-CR matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

27. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

28. spacer 1.1|111577|51|CP029924|PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

29. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

30. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

31. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

32. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

33. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

34. spacer 1.1|111577|51|CP029924|PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

35. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

36. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

37. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

38. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

39. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

40. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

41. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

42. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

43. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

44. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

45. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

46. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

47. spacer 1.1|111577|51|CP029924|PILER-CR matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

48. spacer 1.1|111577|51|CP029924|PILER-CR matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

49. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

50. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

51. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

52. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

53. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

54. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

55. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

56. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

57. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

58. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

59. spacer 1.1|111577|51|CP029924|PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

60. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

61. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

62. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

63. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

64. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

65. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

66. spacer 1.1|111577|51|CP029924|PILER-CR matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

67. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

68. spacer 1.1|111577|51|CP029924|PILER-CR matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

69. spacer 1.1|111577|51|CP029924|PILER-CR matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

70. spacer 1.1|111577|51|CP029924|PILER-CR matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

71. spacer 1.1|111577|51|CP029924|PILER-CR matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

72. spacer 1.1|111577|51|CP029924|PILER-CR matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

73. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

74. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

75. spacer 1.2|111648|47|CP029924|PILER-CR matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

76. spacer 1.2|111648|47|CP029924|PILER-CR matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

77. spacer 1.2|111648|47|CP029924|PILER-CR matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

78. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

79. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

80. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

81. spacer 1.2|111648|47|CP029924|PILER-CR matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

82. spacer 1.2|111648|47|CP029924|PILER-CR matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

83. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

84. spacer 1.2|111648|47|CP029924|PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

85. spacer 1.2|111648|47|CP029924|PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

86. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

87. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

88. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

89. spacer 1.2|111648|47|CP029924|PILER-CR matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

90. spacer 1.2|111648|47|CP029924|PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

91. spacer 1.2|111648|47|CP029924|PILER-CR matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

92. spacer 1.2|111648|47|CP029924|PILER-CR matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

93. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

94. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

95. spacer 1.2|111648|47|CP029924|PILER-CR matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

96. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

97. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

98. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

99. spacer 1.2|111648|47|CP029924|PILER-CR matches to MN232190 (Escherichia coli plasmid pGD27-31, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

100. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

101. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

102. spacer 1.2|111648|47|CP029924|PILER-CR matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

103. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

104. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

105. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

106. spacer 1.2|111648|47|CP029924|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

107. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

108. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

109. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

110. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

111. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

112. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

113. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

114. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

115. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

116. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

117. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

118. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

119. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

120. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

121. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

122. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

123. spacer 1.2|111648|47|CP029924|PILER-CR matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

124. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

125. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

126. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

127. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

128. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

129. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

130. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

131. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

132. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

133. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

134. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

135. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

136. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

137. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

138. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

139. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

140. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

141. spacer 1.2|111648|47|CP029924|PILER-CR matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

142. spacer 1.2|111648|47|CP029924|PILER-CR matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

143. spacer 1.2|111648|47|CP029924|PILER-CR matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

144. spacer 1.2|111648|47|CP029924|PILER-CR matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 87558 : 141076 56 Escherichia_phage(43.75%) transposase,holin NA
DBSCAN-SWA_2 166169 : 216361 59 Escherichia_phage(45.0%) transposase,integrase attL 166154:166213|attR 216318:217086
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage