Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026100 Caulobacter flavus strain RHGG3 chromosome, complete genome 1 crisprs csa3,DEDDh,WYL,DinG,cas3 0 1 4 0

Results visualization

1. CP026100
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026100_1 3038794-3038899 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP029235 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436e, complete sequence 29916-29937 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 15655-15676 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1336811-1336832 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 1405604-1405625 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 17743-17764 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 743314-743335 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 301728-301749 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 17777-17798 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 201275-201296 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1399650-1399671 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 129671-129692 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1098709-1098730 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1490958-1490979 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 470576-470597 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 17780-17801 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 640999-641020 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 609739-609760 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 345783-345804 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1267577-1267598 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 16410-16431 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 19562-19583 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1098706-1098727 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1335148-1335169 2 0.909
CP026100_2 2.2|3870134|22|CP026100|CRISPRCasFinder 3870134-3870155 22 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 421683-421704 3 0.864

1. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP029235 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436e, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
gtcgggacgctcggcgcgctca	Protospacer
 ******************** 

2. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

3. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

4. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

5. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

6. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

7. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

8. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

9. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

10. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

11. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

12. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

13. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

14. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

15. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

16. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

17. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

18. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

19. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

20. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

21. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

22. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

23. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.909

ttcgggacgctcggcgcgctcc	CRISPR spacer
ctcggcacgctcggcgcgctcc	Protospacer
.**** ****************

24. spacer 2.2|3870134|22|CP026100|CRISPRCasFinder matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 3, identity: 0.864

ttcgggacgctcggcgcgctcc	CRISPR spacer
gaagggacgctcggcgcgctcc	Protospacer
   *******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 388399 : 458463 55 Burkholderia_phage(20.0%) transposase,integrase,plate attL 375176:375193|attR 463554:463571
DBSCAN-SWA_2 1352743 : 1359881 6 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_3 2032527 : 2047711 21 Paracoccus_phage(22.22%) capsid,tail,head,portal,protease NA
DBSCAN-SWA_4 5098617 : 5122747 25 uncultured_Mediterranean_phage(75.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage