1. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to MG945336 (UNVERIFIED: Microviridae sp. isolate 2198-1801, complete genome) position: , mismatch: 5, identity: 0.833
tagaagatggtacaaataaaccattttcta CRISPR spacer
ttgaagatggtacaactaaactatttacca Protospacer
* ************* *****.**** *.*
2. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NZ_CP047227 (Moraxella osloensis strain YV1 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagacggtacaattaaaccattaatca Protospacer
******.******* ********* ..*
3. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 7, identity: 0.767
tagaagatggtacaaataaaccattttcta CRISPR spacer
cacaagatagtacaaataatccatttgttg Protospacer
.* *****.********** ****** .*.
4. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to MN693755 (Marine virus AFVG_250M121, complete genome) position: , mismatch: 7, identity: 0.767
tagaagatggtacaaataaaccattttcta CRISPR spacer
atggagatggtacaaataaaactttttatg Protospacer
*.**************** * **** *.
5. spacer 4.2|1776573|30|CP033426|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 7, identity: 0.767
aaatgcttttcacgatggaccggatttata CRISPR spacer
acgtgctgttcacgatggaccggatcgcga Protospacer
* .**** *****************. *
6. spacer 3.2|1735612|39|CP033426|CRISPRCasFinder matches to MN855989 (Bacteriophage sp. isolate 357, complete genome) position: , mismatch: 8, identity: 0.795
tgatcctactgttaacggtgatgactggtatccagttag CRISPR spacer
gattaatactgttaacggtgatgactggtatccgattaa Protospacer
. * ***************************..***.
7. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
8. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NZ_CP042875 (Bacillus cereus strain 09 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
9. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NZ_CP045608 (Bacillus cereus strain SB1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
10. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
11. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
12. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
13. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
14. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
15. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
16. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
17. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
18. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
19. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
cgcaagatagtacaaataatccatttgttg Protospacer
.. *****.********** ****** .*.
20. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019135 (Synechococcus phage ACG-2014a isolate Syn7803C101, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
21. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019114 (Synechococcus phage ACG-2014a isolate Syn7803US60, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
22. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019138 (Synechococcus phage ACG-2014a isolate Syn7803C107, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
23. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019122 (Synechococcus phage ACG-2014a isolate Syn7803US79, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
24. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019055 (Synechococcus phage ACG-2014a isolate Syn7803C86, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
25. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019038 (Synechococcus phage ACG-2014a isolate Syn7803C59, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
26. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019068 (Synechococcus phage ACG-2014a isolate Syn7803US102, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
27. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019137 (Synechococcus phage ACG-2014a isolate Syn7803C104, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
28. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019157 (Synechococcus phage ACG-2014a isolate Syn7803C31, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
29. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019087 (Synechococcus phage ACG-2014a isolate Syn7803US19, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
30. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019076 (Synechococcus phage ACG-2014a isolate Syn7803US112, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
31. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019065 (Synechococcus phage ACG-2014a isolate Syn7803C99, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
32. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019026 (Synechococcus phage ACG-2014a isolate Syn7803C42, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
33. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019081 (Synechococcus phage ACG-2014a isolate Syn7803US117, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
34. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019033 (Synechococcus phage ACG-2014a isolate Syn7803C53, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
35. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to NC_023584 (Synechococcus phage S-MbCM100, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
36. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019153 (Synechococcus phage ACG-2014a isolate Syn7803C26, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
37. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019158 (Synechococcus phage ACG-2014a isolate Syn7803C33, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
38. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019067 (Synechococcus phage ACG-2014a isolate Syn7803US101, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
39. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019039 (Synechococcus phage ACG-2014a isolate Syn7803C60, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
40. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019030 (Synechococcus phage ACG-2014a isolate Syn7803C47, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
41. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019163 (Synechococcus phage ACG-2014a isolate Syn7803C38, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
42. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019116 (Synechococcus phage ACG-2014a isolate Syn7803US62, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
43. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019088 (Synechococcus phage ACG-2014a isolate Syn7803US1, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
44. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to KJ019084 (Synechococcus phage ACG-2014a isolate Syn7803US123, complete genome) position: , mismatch: 8, identity: 0.733
tagaagatggtacaaataaaccattttcta CRISPR spacer
gagaagatggtcctaataaaccatatcgag Protospacer
********** * ********** *. .
45. spacer 4.2|1776573|30|CP033426|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733
aaatgcttttcacgatggaccggatttata CRISPR spacer
gcgtgctgtttacgatggaccggattgcca Protospacer
. .**** **.*************** .*
46. spacer 4.4|1776705|30|CP033426|CRISPRCasFinder,CRT matches to MT075871 (Klebsiella phage vB_KleS-HSE3, complete genome) position: , mismatch: 8, identity: 0.733
------ccgtgaaaacggcgtttacatgcgtaagac CRISPR spacer
cgcgttctg------cggcgtttacttgcgtaagac Protospacer
*.* ********** **********
47. spacer 4.4|1776705|30|CP033426|CRISPRCasFinder,CRT matches to MH363700 (Vibrio phage VP-1, complete genome) position: , mismatch: 8, identity: 0.733
ccgtgaaaacggcgtttacatgcgtaagac CRISPR spacer
tattcataacggcgattacatgcgtaaggt Protospacer
. * * ******* *************..
48. spacer 4.4|1776705|30|CP033426|CRISPRCasFinder,CRT matches to NC_048765 (Vibrio phage VAP7, complete genome) position: , mismatch: 8, identity: 0.733
ccgtgaaaacggcgtttacatgcgtaagac CRISPR spacer
tattcataacggcgattacatgcgtaaggt Protospacer
. * * ******* *************..
49. spacer 4.1|1776507|30|CP033426|CRISPRCasFinder,CRT matches to MT773554 (Myoviridae sp. isolate BML_2 genomic sequence) position: , mismatch: 9, identity: 0.7
tagaagatggtacaaataaaccattttcta CRISPR spacer
tttcttccggcacaaataaaccattttctt Protospacer
* .**.******************
50. spacer 4.2|1776573|30|CP033426|CRISPRCasFinder,CRT matches to NC_015250 (Acinetobacter phage 133, complete genome) position: , mismatch: 9, identity: 0.7
aaatgcttttcacgatggaccggatttata CRISPR spacer
tgtaacttttcacgaggaaccggatttaac Protospacer
. .********** *.**********
