1. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 3, identity: 0.88
attggcgtcgccttcgacctgctgg CRISPR spacer
catgtcgtcgccttcgacctgctgg Protospacer
** ********************
2. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 3, identity: 0.88
attggcgtcgccttcgacctgctgg CRISPR spacer
catgtcgtcgccttcgacctgctgg Protospacer
** ********************
3. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 3, identity: 0.88
attggcgtcgccttcgacctgctgg CRISPR spacer
catgtcgtcgccttcgacctgctgg Protospacer
** ********************
4. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
attggtgtcgccttcgacctgcaac Protospacer
*****.**************** .
5. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
cacggcgtcgccttcgagctgctgg Protospacer
.************** *******
6. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
attggtgtcgccttcgacctgcaac Protospacer
*****.**************** .
7. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
cacgtcgtcgccttcgacctgctgg Protospacer
.* ********************
8. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
agcggcgtcgccttcgacgtgctgc Protospacer
* .*************** *****
9. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
gattgcgtcgccttcgacctgcggg Protospacer
. * ****************** **
10. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
ggtgacgtcgccttcgagctgctgg Protospacer
. **.************ *******
11. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
cttggcgtggccttcgccctgctgt Protospacer
******* ******* *******
12. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP047896 (Sphingomonas sp. C33 plasmid pC33, complete sequence) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
cttggcatcgccttcgacttgctgc Protospacer
*****.***********.*****
13. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 4, identity: 0.84
attggcgtcgccttcgacctgctgg CRISPR spacer
attggcttcggcttcgacctgctca Protospacer
****** *** ************ .
14. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.8
attggcgtcgccttcgacctgctgg CRISPR spacer
tccttcgtcgccttcgacctgctgg Protospacer
.. ********************
15. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 5, identity: 0.8
attggcgtcgccttcgacctgctgg CRISPR spacer
tatttcgtcgccttcgacctgctgc Protospacer
* *******************
16. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 5, identity: 0.8
attggcgtcgccttcgacctgctgg CRISPR spacer
tatttcgtcgccttcgacctgctgc Protospacer
* *******************
17. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.8
attggcgtcgccttcgacctgctgg CRISPR spacer
gggcgcatcgccttcgacctgctgg Protospacer
. **.******************
18. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 5, identity: 0.8
attggcgtcgccttcgacctgctgg CRISPR spacer
tatttcgtcgccttcgacctgctgc Protospacer
* *******************
19. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.844
agttccgcgatggcccgcgccagttcctcgcc- CRISPR spacer
cattccgcgatggccagcgccagtacc-cgcca Protospacer
.************* ******** ** ****
20. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 6, identity: 0.76
attggcgtcgccttcgacctgctgg CRISPR spacer
gcctacgtcgccttcgacctgctga Protospacer
... .*******************.
21. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 6, identity: 0.76
attggcgtcgccttcgacctgctgg CRISPR spacer
cactacgtcgccttcgacctgctgt Protospacer
. .*******************
22. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NZ_CP046102 (Rhodococcus sp. AQ5-07 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.76
attggcgtcgccttcgacctgctgg CRISPR spacer
tgcatcgtcgccttcgacctgctga Protospacer
.. *******************.
23. spacer 2.1|978108|25|CP033730|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 6, identity: 0.76
attggcgtcgccttcgacctgctgg CRISPR spacer
cactacgtcgccttcgacctgctgt Protospacer
. .*******************
24. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.812
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
gtcctgctggatcacggcggtgacgtagccgg Protospacer
** **************** ******* .*.
25. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.812
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
gtcctgctggatcacggcggtgacgtagccgg Protospacer
** **************** ******* .*.
26. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP033195 (Xanthomonas oryzae pv. oryzae strain CIAT plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
ctgcttctggatcacggcgttgacgaagccct Protospacer
**** ******************* * .* *
27. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP033202 (Xanthomonas oryzae pv. oryzae strain BXO1 plasmid pBXO1-1, complete sequence) position: , mismatch: 6, identity: 0.812
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
ctgcttctggatcacggcgttgacgaagccct Protospacer
**** ******************* * .* *
28. spacer 6.8|2696497|32|CP033730|CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgacccagcggtccagctccgc-acagccgcc CRISPR spacer
ctgacccagccgtccagctccacaacaggccc- Protospacer
.********* **********.* **** * *
29. spacer 6.8|2696497|32|CP033730|CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgacccagcggtccagctccgc-acagccgcc CRISPR spacer
ctgacccagccgtccagctccacaacaggccc- Protospacer
.********* **********.* **** * *
30. spacer 6.10|2696617|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP027296 (Streptomyces sp. SGAir0924 plasmid unnamed_1, complete sequence) position: , mismatch: 7, identity: 0.781
--tgaacatctcccaccgccggcaagcgccagcc CRISPR spacer
catgaccg--tcacaccgccggcgagcgccagct Protospacer
*** *. ** **********.*********.
31. spacer 6.10|2696617|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.781
tgaacatc-tcccaccgccggcaagcgccagcc CRISPR spacer
-gagcgccgtcgcaccgccggcaagcgcctgcg Protospacer
**.*..* ** ***************** **
32. spacer 6.12|2696737|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 7, identity: 0.781
ttgacgctgccgtacccgcgccgtac--ttcggc CRISPR spacer
ttgacgatgcggtacccgcgccgcatgatttg-- Protospacer
****** *** ************.*. **.*
33. spacer 6.12|2696737|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
ttgacgctgccgtacccgcgccgtac--ttcggc CRISPR spacer
ttgacgatgcggtacccgcgccgcatgatttg-- Protospacer
****** *** ************.*. **.*
34. spacer 6.12|2696737|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ttgacgctgccgtacccgcgccgtac--ttcggc CRISPR spacer
ttgacgatgcggtacccgcgccgcatgatttg-- Protospacer
****** *** ************.*. **.*
35. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN329674 (Mycobacterium phage JoieB, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
36. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MK494123 (Mycobacterium phage Blackbeetle, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
37. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN428061 (Mycobacterium phage Corazon, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
38. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MG757167 (Mycobacterium phage Tesla, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
39. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MH727562 (Mycobacterium phage VasuNzinga, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
40. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MK305892 (Mycobacterium phage RedRaider77, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
41. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to KJ538721 (Mycobacterium phage MosMoris, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
42. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to JF704100 (Mycobacterium phage Marvin, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
43. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN428056 (Mycobacterium phage Pringar, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
44. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MK279842 (Mycobacterium phage Raela, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
45. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MH727553 (Mycobacterium phage LittleLaf, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
46. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MK061407 (Mycobacterium phage Beelzebub, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
47. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN329676 (Mycobacterium phage Poise, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
48. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to KX159477 (Mycobacterium phage Gattaca, complete genome) position: , mismatch: 7, identity: 0.781
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
gctgcatctcctcgcgcagcttcttcgcctcg Protospacer
* ******.**** ************ .**
49. spacer 6.18|2697097|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
gagcatgtaggcgagcagatcgacggcgtcgg-- CRISPR spacer
tcgcatgtcggcgggcagatcgacggc--cagcc Protospacer
****** ****.************* *.*
50. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.781
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
aggggggcgatggcccgcgccatatcctcgcg Protospacer
** **************** *******
51. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.781
agttccgcgatggcccgcgccagttcc-tcgcc CRISPR spacer
gcatccgccttggcccgcgccagttccatcgt- Protospacer
. ***** ***************** ***.
52. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
cgcgccgtgttggcccgcgccagttccttggc Protospacer
*. ***.* ******************.* *
53. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.781
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
cgcgccgtgctggcccgcgccagttccttggc Protospacer
*. ***.* ******************.* *
54. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 7, identity: 0.781
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
cgcgccgtgttggcccgcgccagttccttggc Protospacer
*. ***.* ******************.* *
55. spacer 6.21|2697277|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
ctcaccgcctgcgaaggctgcggca-agaccgc CRISPR spacer
gacaccgcctgcggagggtgcggcactgagcg- Protospacer
***********.*** ******* ** **
56. spacer 6.23|2697397|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 7, identity: 0.781
gcccgacgcgaggtaggcgctgac--ctgaccca CRISPR spacer
acccgacgcgatgttggcgctgacgaccaacc-- Protospacer
.********** ** ********* *..***
57. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.75
tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
cggctcagcaccgtccaggtgccgccggagtc Protospacer
. * *******.*****.**********.*
58. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
---tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
ggcccg---atcaccgcccagtcgacgccggagct Protospacer
.** * ********** ** *********.
59. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
gcgggaagcaccgccctggcggcgccggcgaa Protospacer
**..*********** **** ****** *
60. spacer 6.6|2696377|32|CP033730|CRISPRCasFinder,CRT matches to MG945433 (UNVERIFIED: Microviridae sp. isolate 4854-1711, complete genome) position: , mismatch: 8, identity: 0.75
tgtccgcgcaaccggcgcagaaggagcagagc CRISPR spacer
agacggagcaacaggagcagaaggagcagaag Protospacer
* * * ***** ** **************.
61. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 8, identity: 0.75
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
atcctgctggatgacggcggtgacgtaaccgg Protospacer
.* ********* ****** ******* .*.
62. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
gtgcggcaggatcacggcgttgagggtgccgt Protospacer
**** ** *************** * .*.*
63. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
tcaaaatctctgcgcccagcttcttcgcatta Protospacer
**. ****** ****************....
64. spacer 6.17|2697037|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP015742 (Shinella sp. HZN7 plasmid pShin-06, complete sequence) position: , mismatch: 8, identity: 0.75
tccgtcggtgtactgtttggggtgggcggcgc CRISPR spacer
tgtctcggtgtcctgtttggagtgggcctcgt Protospacer
* . ******* ********.****** **.
65. spacer 6.18|2697097|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gagcatgtaggcgagcagatcgacggcgtcgg CRISPR spacer
cggcttgtcggcgagcagatcgacggcagctt Protospacer
.** *** ******************. *
66. spacer 6.18|2697097|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 8, identity: 0.75
gagcatgtaggcgagcagatcgacggcgtcgg---- CRISPR spacer
gagcatgtagtcgagcaggtcgac----ccgaagct Protospacer
********** *******.***** .**.
67. spacer 6.18|2697097|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 8, identity: 0.75
gagcatgtaggcgagcagatcgacggcgtcgg CRISPR spacer
ggtcaggtaggcgagcggatcgacggcattta Protospacer
*. ** **********.**********.*. .
68. spacer 6.18|2697097|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 8, identity: 0.75
gagcatgtaggcgagcagatcgacggcgtcgg CRISPR spacer
gcacccatcggcgagaagatcgccggcgtcgg Protospacer
* .* ..* ****** ****** *********
69. spacer 6.18|2697097|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
gagcatgtaggcgagcagatcgacggcgtcgg CRISPR spacer
gtcccagcgggccagcagatcgtcggcgtcgg Protospacer
* * *..*** ********* *********
70. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 8, identity: 0.75
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
gcccgctcgatggcctgcgccagttcgtcgcc Protospacer
. .. * ********.********** *****
71. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
agccggacgatggcccgcgccaagtcctcgtc Protospacer
**.. .***************. ******.*
72. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
atggcgacgatggcgcgcgccaattcctcgcg Protospacer
* * .******* *******.********
73. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
atggcgacgatggcgcgcgccaattcctcgcg Protospacer
* * .******* *******.********
74. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 8, identity: 0.75
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
gcattctcgatggtccgcgccagttcgtcggc Protospacer
. *.* ******.************ *** *
75. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 8, identity: 0.75
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
agcgcttcgatggcccgatccagttcctcggt Protospacer
**. *. ********** *********** .
76. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to MK919474 (Microbacterium phage Lupine, complete genome) position: , mismatch: 8, identity: 0.75
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
atgtaggcgagggcctgcgccagttcctctct Protospacer
* * **** ****.************* *.
77. spacer 6.21|2697277|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to AY526908 (Bordetella phage BMP-1, complete genome) position: , mismatch: 8, identity: 0.75
ctcaccgcctgcgaaggctgcggcaagaccgc CRISPR spacer
gccgtcacctgcaaacgctgcggcaagaccgg Protospacer
.*..*.*****.** ***************
78. spacer 6.21|2697277|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NC_005357 (Bordetella phage BPP-1, complete genome) position: , mismatch: 8, identity: 0.75
ctcaccgcctgcgaaggctgcggcaagaccgc CRISPR spacer
gccgtcacctgcaaacgctgcggcaagaccgg Protospacer
.*..*.*****.** ***************
79. spacer 6.21|2697277|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to AY526909 (Bordetella phage BIP-1, complete genome) position: , mismatch: 8, identity: 0.75
ctcaccgcctgcgaaggctgcggcaagaccgc CRISPR spacer
gccgtcacctgcaaacgctgcggcaagaccgg Protospacer
.*..*.*****.** ***************
80. spacer 6.2|2696137|32|CP033730|CRISPRCasFinder,CRT matches to HM480106 (Synechococcus phage S-CBS1, complete genome) position: , mismatch: 9, identity: 0.719
gcagtcaccacttgcatcagctcacgatggga CRISPR spacer
tcatggggcacttccatcagctgacgatgggt Protospacer
** . ***** ******** ********
81. spacer 6.2|2696137|32|CP033730|CRISPRCasFinder,CRT matches to HQ634187 (Cyanophage KBS-S-2A genomic sequence) position: , mismatch: 9, identity: 0.719
gcagtcaccacttgcatcagctcacgatggga CRISPR spacer
tcatggggcacttccatcagctaacgatgggt Protospacer
** . ***** ******** ********
82. spacer 6.2|2696137|32|CP033730|CRISPRCasFinder,CRT matches to NC_017971 (Pseudomonas phage tf complete genome) position: , mismatch: 9, identity: 0.719
gcagtcaccacttgcatcagctcacgatggga CRISPR spacer
gagggcagcacttggatcagctcacgatcaac Protospacer
* .* ** ****** ************* ..
83. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
cccgccggcaccgtccaggcgcggccggagcg Protospacer
.* . .******.******** ********
84. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
cccgaaacgaccgcccaggcgccgccgagcca Protospacer
.* .*** ******************.. *
85. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 9, identity: 0.719
------tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
gactcgccg------accgcgcaggcgccgccggcgcc Protospacer
.** ***** ************* ***
86. spacer 6.6|2696377|32|CP033730|CRISPRCasFinder,CRT matches to MG945309 (UNVERIFIED: Microviridae sp. isolate 786-1711, complete genome) position: , mismatch: 9, identity: 0.719
tgtccgcgcaaccggcgcagaaggagcagagc CRISPR spacer
agagggagcaacaggagcagaaggagcagaag Protospacer
* * ***** ** **************.
87. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.719
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
ctgctgctgcatcacggcgtcgaccggcacgt Protospacer
******** **********.*** .. *.*
88. spacer 6.10|2696617|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 9, identity: 0.719
tgaacatctcccaccgccggcaagcgccagcc CRISPR spacer
gacggctctccctccgccgccaagcgccagcg Protospacer
. . ****** ****** ***********
89. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg---- CRISPR spacer
tcgccatctattcgccctgcttc----cactatgac Protospacer
********* ******* ***** *.*..
90. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg---- CRISPR spacer
tcgccatctattcgccctgcttc----cactatgac Protospacer
********* ******* ***** *.*..
91. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg---- CRISPR spacer
tcgccatctattcgccctgcttc----cactatgac Protospacer
********* ******* ***** *.*..
92. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg---- CRISPR spacer
tcgccatctattcgccctgcttc----cactatgac Protospacer
********* ******* ***** *.*..
93. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg---- CRISPR spacer
tcgccatctattcgccctgcttc----cactatgac Protospacer
********* ******* ***** *.*..
94. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccat----ctcttcgcccagcttcttcgcgccg CRISPR spacer
----cgtaggagacttcgcccaggttcttcgagccg Protospacer
*.* ********** ******* ****
95. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NC_009739 (Pseudomonas aeruginosa plasmid pMATVIM-7, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
tccattcgccttcgcccagcatcttcacgccg Protospacer
** . . .*********** *****.*****
96. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN813049 (Dickeya phage Ds9CZ, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
97. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to KM209320 (Dickeya phage phiDP23.1 clone pD23.contig.46_1 genomic sequence) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
98. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to KM209228 (Dickeya phage phiD3, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
99. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN788369 (Dickeya phage Ds3CZ, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
100. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to KY942057 (Dickeya phage XF4, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
101. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN813048 (Dickeya phage Ds5CZ, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
102. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN813051 (Dickeya phage Ds20CZ, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
103. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN813052 (Dickeya phage Ds23CZ, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
104. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MH807812 (Dickeya phage Kamild, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
105. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to KY942056 (Dickeya phage JA15, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
106. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MG266157 (Dickeya phage PP35, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
107. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to MN813050 (Dickeya phage Ds16CZ, complete genome) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
108. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to KM209261 (Dickeya phage phiDP10.3 clone pD10.contig.32_1 genomic sequence) position: , mismatch: 9, identity: 0.719
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
caggattctcttcggccagcttcttggcgacc Protospacer
. * ******** ********** *** *
109. spacer 6.18|2697097|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to AP019515 (Halomonas sulfidaeris ATCC BAA-803 plasmid pBAA-803-A DNA, complete genome) position: , mismatch: 9, identity: 0.719
gagcatgtaggcgagcagatcgacggcgtcgg CRISPR spacer
catgccgctggcgagcagagcgacggcatcgg Protospacer
* .*. ********** *******.****
110. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 9, identity: 0.719
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
ccttccgcgacggcccgcgtcagttccagatg Protospacer
********.********.******* ..
111. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042265 (Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
agtttcgcgatggcgcgcgccagacggttgtt Protospacer
****.********* ******** . *.*..
112. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
accacgacgatggcccgggacagttcctcgat Protospacer
* . * .********** * ********** .
113. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.719
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
tgggcatggatggcccgcgccagtacctggct Protospacer
* * **************** *** **.
114. spacer 6.21|2697277|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 9, identity: 0.719
ctcaccgcctgcgaaggctgcggcaagaccgc CRISPR spacer
accgtgacctgcgaccgctgcggcaagaccgg Protospacer
.*.. .******* ***************
115. spacer 6.23|2697397|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 9, identity: 0.719
gcccgacgcgaggtaggcgctgacctgaccca CRISPR spacer
acgcgacgcggggcaggcgctgacctacacgg Protospacer
.* *******.**.************. * .
116. spacer 6.23|2697397|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719
gcccgacgcgaggtaggcgctgacctgaccca CRISPR spacer
cagcgcggcgaggtaggcgcggatctgaccgg Protospacer
** ************* **.****** .
117. spacer 6.28|2697697|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to CP027480 (Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
acgatgcgggtaagctggccgacagtgttccc CRISPR spacer
tcgatgagggtaaggtggccgacaccggatcg Protospacer
***** ******* ********* .* .*
118. spacer 6.28|2697697|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 9, identity: 0.719
acgatgcgggtaagctggccgacagtgttccc CRISPR spacer
ccgatgcggctaagctggcctacaaggcccat Protospacer
******** ********** ***. *..* .
119. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
gtcctgggcaccgccccggcgccgacggagct Protospacer
. ..********* ******* ******.
120. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
gtcctgggcaccgccccggcgccgacggagct Protospacer
. ..********* ******* ******.
121. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 10, identity: 0.688
tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
gtcctgggcaccgccccggcgccgacggagct Protospacer
. ..********* ******* ******.
122. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP054601 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
ccgaaaagcaccgccaagccgccgtcctgcga Protospacer
.************** ** *****.* .
123. spacer 6.3|2696197|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgaaaagcaccgcccaggcgccgccggagcc CRISPR spacer
ctcatggctaccgcccaggcgcggccgcagcc Protospacer
.. * .. .************* **** ****
124. spacer 6.5|2696317|32|CP033730|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
agtgtgcgcggccccgcgtgcaaccgcacgca CRISPR spacer
tgtttgcgcggcccggcgtgcaacgcggcttc Protospacer
** ********** ********* .* .
125. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
cgcctgctggatcaccgcgttgatgtccccga Protospacer
************ *******.** ..*.
126. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 10, identity: 0.688
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
cacctgctggatcaccgcgttgatgtcgccga Protospacer
************ *******.** .*.
127. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
cgcctgctggatgacggcgttgatgtcgccga Protospacer
********* **********.** .*.
128. spacer 6.7|2696437|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
gtgctgctggatcacggcgttgacgtattcat CRISPR spacer
cgcctgctggatcaccgcgttgatgtcgccga Protospacer
************ *******.** .*.
129. spacer 6.8|2696497|32|CP033730|CRISPRCasFinder,CRT matches to MK494116 (Mycobacterium phage Dulcie, complete genome) position: , mismatch: 10, identity: 0.688
ttgacccagcggtccagctccgcacagccgcc CRISPR spacer
ttgacccagaggtccaggtccgcgctttgatt Protospacer
********* ******* *****.* . ...
130. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP019439 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cggccatgtcctcgcccagcttcttcttcatc Protospacer
. ***** **.*************** . .
131. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cccggatctcttcgccgagcttctccgccggc Protospacer
.* *********** *******.***
132. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cccggatctcttcgccgagcttctccgccggc Protospacer
.* *********** *******.***
133. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cccggatctcttcgccgagcttctccgccggc Protospacer
.* *********** *******.***
134. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cccgaatctcttcgccgagcttctccgccggc Protospacer
.* *********** *******.***
135. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cccgaatctcttcgccgagcttctccgccggc Protospacer
.* *********** *******.***
136. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cccgaatctcttcgccgagcttctccgccggc Protospacer
.* *********** *******.***
137. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cccgaatctcttcgccgagcttctccgccggc Protospacer
.* *********** *******.***
138. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cccgaatctcttcgccgagcttctccgccggc Protospacer
.* *********** *******.***
139. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to KC954774 (Cronobacter phage CR8, complete genome) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cagccatttcttcgtccagcttcttgttgata Protospacer
. *****.******.********** .* ..
140. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NC_028672 (Cronobacter phage PBES 02, complete genome) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cagccatttcttcgtccagcttcttgttgata Protospacer
. *****.******.********** .* ..
141. spacer 6.15|2696917|32|CP033730|CRISPRCasFinder,CRT matches to NC_017974 (Cronobacter phage CR3, complete genome) position: , mismatch: 10, identity: 0.688
tcgccatctcttcgcccagcttcttcgcgccg CRISPR spacer
cagccatttcttcgtccagcttcttgttgata Protospacer
. *****.******.********** .* ..
142. spacer 6.18|2697097|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 10, identity: 0.688
gagcatgtaggcgagcagatcgacggcgtcgg CRISPR spacer
attgctgttggcgagcggatcgacggcgttac Protospacer
. *** *******.************..
143. spacer 6.18|2697097|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 10, identity: 0.688
gagcatgtaggcgagcagatcgacggcgtcgg CRISPR spacer
cggatccgaggcgaccagatcgacggtgtcga Protospacer
.* . ****** ***********.****.
144. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NC_021909 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence) position: , mismatch: 10, identity: 0.688
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
ttcgcggcgatggccagcgccagatcctccgg Protospacer
. * ********* ******* *****
145. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 10, identity: 0.688
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
tccgcggcgatggccagcgccagatcctccag Protospacer
. * ********* ******* *****
146. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021817 (Sinorhizobium meliloti strain M270 plasmid accessoryC, complete sequence) position: , mismatch: 10, identity: 0.688
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
tccgcggcgatggccagcgccagatcctccag Protospacer
. * ********* ******* *****
147. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009572 (Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence) position: , mismatch: 10, identity: 0.688
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
gccgtttcgatggtccgcgccagttcttcggc Protospacer
. . .. ******.************.*** *
148. spacer 6.21|2697277|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
ctcaccgcctgcgaaggctgcggcaagaccgc CRISPR spacer
actgtcgcttgcgaaggctgcgacaagattgt Protospacer
....***.*************.*****..*.
149. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015419 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
gacaggtcgagggcccgcgccagatcctcgaa Protospacer
... *** ************ ******
150. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015422 (Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence) position: , mismatch: 11, identity: 0.656
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
gacaggtcgagggcccgcgccagatcctcgaa Protospacer
... *** ************ ******
151. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014802 (Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351) position: , mismatch: 11, identity: 0.656
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
gacaggtcgagggcccgcgccagatcctcgaa Protospacer
... *** ************ ******
152. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 11, identity: 0.656
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
tcggtcgcgatcgcccgcgccatttccttcga Protospacer
.****** ********** *****.
153. spacer 6.20|2697217|32|CP033730|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 11, identity: 0.656
agttccgcgatggcccgcgccagttcctcgcc CRISPR spacer
gacaggtcgagggcccgcgccagatcctcgaa Protospacer
... *** ************ ******
