1. spacer 2.1|1698156|26|CP033898|CRISPRCasFinder matches to MG652450 (Ralstonia phage RsoP1IDN, complete genome) position: , mismatch: 5, identity: 0.808
agcaagccccgcctaccccggccgca CRISPR spacer
tgcaagccccgcccaccccggccagc Protospacer
************.*********.
2. spacer 2.1|1698156|26|CP033898|CRISPRCasFinder matches to NC_011667 (Thauera sp. MZ1T plasmid pTha01, complete sequence) position: , mismatch: 5, identity: 0.808
agcaagccccgcctaccccggccgca CRISPR spacer
cccacgcccggcctaccccggccgcc Protospacer
** **** ***************
3. spacer 1.68|628753|32|CP033898|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 6, identity: 0.812
caacgagatcaacgaggacatcaccaacgccc- CRISPR spacer
taacgagatcaaccaggacatcacc-atgcaaa Protospacer
.************ *********** *.**
4. spacer 1.68|628753|32|CP033898|CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 6, identity: 0.812
-caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
gcagc-cgatcaacgacgacatcaccagcgccg Protospacer
**.* ********* **********.****
5. spacer 1.2|628754|33|CP033898|PILER-CR matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 7, identity: 0.788
ccaacgagatcaacgaggacatcaccaacgccc- CRISPR spacer
ataacgagatcaaccaggacatcacc-atgcaaa Protospacer
.************ *********** *.**
6. spacer 1.37|630914|33|CP033898|PILER-CR matches to MN729597 (Pseudomonas phage CHF19, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
7. spacer 1.37|630914|33|CP033898|PILER-CR matches to AF493143 (Pseudomonas phage gh-1, complete sequence) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
8. spacer 1.37|630914|33|CP033898|PILER-CR matches to MN729598 (Pseudomonas phage CHF21, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
9. spacer 1.37|630914|33|CP033898|PILER-CR matches to MN729595 (Pseudomonas phage CHF1, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
10. spacer 1.37|630914|33|CP033898|PILER-CR matches to KJ507099 (Pseudomonas phage phiPSA2, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
11. spacer 1.37|630914|33|CP033898|PILER-CR matches to MN729596 (Pseudomonas phage CHF7, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
12. spacer 1.37|630914|33|CP033898|PILER-CR matches to MN729600 (Pseudomonas phage CHF17, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
13. spacer 1.37|630914|33|CP033898|PILER-CR matches to NC_047826 (Pseudomonas virus WRT, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
14. spacer 1.37|630914|33|CP033898|PILER-CR matches to MG250485 (Pseudomonas virus Pf1 ERZ-2017, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
15. spacer 1.37|630914|33|CP033898|PILER-CR matches to NC_004665 (Pseudomonas phage gh-1, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
16. spacer 1.37|630914|33|CP033898|PILER-CR matches to NC_047827 (Pseudomonas virus KNP, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
17. spacer 1.37|630914|33|CP033898|PILER-CR matches to NC_047747 (Pseudomonas phage phiPsa17, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
18. spacer 1.37|630914|33|CP033898|PILER-CR matches to MN729599 (Pseudomonas phage CHF33, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
19. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
20. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
21. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
22. spacer 1.39|631038|33|CP033898|PILER-CR matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
23. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
24. spacer 1.39|631038|33|CP033898|PILER-CR matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
25. spacer 1.39|631038|33|CP033898|PILER-CR matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
26. spacer 1.39|631038|33|CP033898|PILER-CR matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
27. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
28. spacer 1.39|631038|33|CP033898|PILER-CR matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
29. spacer 1.39|631038|33|CP033898|PILER-CR matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
30. spacer 1.39|631038|33|CP033898|PILER-CR matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
31. spacer 1.39|631038|33|CP033898|PILER-CR matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
32. spacer 1.39|631038|33|CP033898|PILER-CR matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
33. spacer 1.39|631038|33|CP033898|PILER-CR matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
34. spacer 1.39|631038|33|CP033898|PILER-CR matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
35. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
36. spacer 1.39|631038|33|CP033898|PILER-CR matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
37. spacer 1.39|631038|33|CP033898|PILER-CR matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
38. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
39. spacer 1.39|631038|33|CP033898|PILER-CR matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
40. spacer 1.39|631038|33|CP033898|PILER-CR matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
41. spacer 1.39|631038|33|CP033898|PILER-CR matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
42. spacer 1.39|631038|33|CP033898|PILER-CR matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
43. spacer 1.39|631038|33|CP033898|PILER-CR matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
44. spacer 1.39|631038|33|CP033898|PILER-CR matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
45. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH779515 (Mycobacterium phage Sweets, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
46. spacer 1.39|631038|33|CP033898|PILER-CR matches to KC787111 (Mycobacterium phage Sedge, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
47. spacer 1.39|631038|33|CP033898|PILER-CR matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
48. spacer 1.39|631038|33|CP033898|PILER-CR matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
49. spacer 1.39|631038|33|CP033898|PILER-CR matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
50. spacer 1.39|631038|33|CP033898|PILER-CR matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
51. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
52. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
53. spacer 1.39|631038|33|CP033898|PILER-CR matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
54. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
55. spacer 1.39|631038|33|CP033898|PILER-CR matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
56. spacer 1.39|631038|33|CP033898|PILER-CR matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
57. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
58. spacer 1.39|631038|33|CP033898|PILER-CR matches to NC_008202 (Mycobacterium phage Halo, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
59. spacer 1.39|631038|33|CP033898|PILER-CR matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
60. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
61. spacer 1.39|631038|33|CP033898|PILER-CR matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
62. spacer 1.39|631038|33|CP033898|PILER-CR matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
63. spacer 1.39|631038|33|CP033898|PILER-CR matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
64. spacer 1.39|631038|33|CP033898|PILER-CR matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
65. spacer 1.39|631038|33|CP033898|PILER-CR matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
66. spacer 1.39|631038|33|CP033898|PILER-CR matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
67. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 7, identity: 0.788
ccaacgagatcaacgaggacatcaccaacgccc- CRISPR spacer
ataacgagatcaaccaggacatcacc-atgcaaa Protospacer
.************ *********** *.**
68. spacer 1.68|628753|32|CP033898|CRT matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 7, identity: 0.781
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cgcggtgatcatcaaggacatcaccaacgcct Protospacer
*. * ***** *.*****************.
69. spacer 1.69|628814|32|CP033898|CRT matches to MN562221 (Photobacterium phage PDCC-1, complete genome) position: , mismatch: 7, identity: 0.781
gagaaacgtaccaagggaaagaag--tcgctggt CRISPR spacer
aagaaacgtaccaatggatagaaggtttgttg-- Protospacer
.************* *** ***** *.*.**
70. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
gccggcggcttcgtctacgtctccgacgccta Protospacer
.** .***** ***** ***********.*.*
71. spacer 1.89|630034|32|CP033898|CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 7, identity: 0.781
atgtcgcagcgctctggatcatcagtcatttc CRISPR spacer
aacgcgcagcgctctggattttcagtcatggc Protospacer
* ***************. ******** *
72. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to MN729597 (Pseudomonas phage CHF19, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
73. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to AF493143 (Pseudomonas phage gh-1, complete sequence) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
74. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to MN729598 (Pseudomonas phage CHF21, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
75. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to MN729595 (Pseudomonas phage CHF1, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
76. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to KJ507099 (Pseudomonas phage phiPSA2, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
77. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to MN729596 (Pseudomonas phage CHF7, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
78. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to MN729600 (Pseudomonas phage CHF17, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
79. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to NC_047826 (Pseudomonas virus WRT, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
80. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to MG250485 (Pseudomonas virus Pf1 ERZ-2017, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
81. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to NC_004665 (Pseudomonas phage gh-1, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
82. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to NC_047827 (Pseudomonas virus KNP, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
83. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to NC_047747 (Pseudomonas phage phiPsa17, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
84. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to MN729599 (Pseudomonas phage CHF33, complete genome) position: , mismatch: 7, identity: 0.788
cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gtcaccattcaactgcgacacggttgccacagc Protospacer
*...***************.*** ****** *
85. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
86. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
87. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
88. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
89. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
90. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
91. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
92. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
93. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
94. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
95. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
96. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
97. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
98. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
99. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
100. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
101. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
102. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
103. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
104. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
105. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
106. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
107. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
108. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
109. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
110. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
111. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH779515 (Mycobacterium phage Sweets, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
112. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KC787111 (Mycobacterium phage Sedge, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
113. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
114. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
115. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
116. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
117. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
118. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
119. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
120. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
121. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
122. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
123. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
124. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to NC_008202 (Mycobacterium phage Halo, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
125. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
126. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
127. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
128. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
129. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
130. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
131. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
132. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 7, identity: 0.788
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagatgcgttcgactac Protospacer
* . ******** **************** .*
133. spacer 1.2|628754|33|CP033898|PILER-CR matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
acgcggtgatcatcaaggacatcaccaacgcct Protospacer
*. * ***** *.*****************.
134. spacer 1.2|628754|33|CP033898|PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cgcagccgatcaacgacgacatcaccagcgccg Protospacer
* * ********* **********.****
135. spacer 1.2|628754|33|CP033898|PILER-CR matches to NZ_CP044977 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-2, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
136. spacer 1.2|628754|33|CP033898|PILER-CR matches to MN536506 (Uncultured bacterium plasmid pEN1, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
137. spacer 1.2|628754|33|CP033898|PILER-CR matches to NZ_CP044551 (Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
138. spacer 1.2|628754|33|CP033898|PILER-CR matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
139. spacer 1.2|628754|33|CP033898|PILER-CR matches to NZ_LR594677 (Variovorax sp. PBS-H4 plasmid 3) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
140. spacer 1.23|630056|33|CP033898|PILER-CR matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 8, identity: 0.758
catgtcgcagcgctctggatcatcagtcatttc CRISPR spacer
gaacgcgcagcgctctggattttcagtcatggc Protospacer
* ***************. ******** *
141. spacer 1.37|630914|33|CP033898|PILER-CR matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.758
-cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gatcgacg-gcaactgcgacctggtggccacctc Protospacer
*.* *. ********** ********** **
142. spacer 1.37|630914|33|CP033898|PILER-CR matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.758
-cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gatcgacg-gcaactgcgacctggtggccacctc Protospacer
*.* *. ********** ********** **
143. spacer 1.39|631038|33|CP033898|PILER-CR matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 8, identity: 0.758
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagacgcgttcgactgg Protospacer
* . ******** ******.********* *
144. spacer 1.39|631038|33|CP033898|PILER-CR matches to MW119570 (Mycobacterium phage Lang, complete genome) position: , mismatch: 8, identity: 0.758
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagacgcgttcgactgg Protospacer
* . ******** ******.********* *
145. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
acgcggtgatcatcaaggacatcaccaacgcct Protospacer
*. * ***** *.*****************.
146. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cgcagccgatcaacgacgacatcaccagcgccg Protospacer
* * ********* **********.****
147. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to NZ_CP044977 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-2, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
148. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to MN536506 (Uncultured bacterium plasmid pEN1, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
149. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to NZ_CP044551 (Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
150. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
151. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to NZ_LR594677 (Variovorax sp. PBS-H4 plasmid 3) position: , mismatch: 8, identity: 0.758
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccactccgatcaacgacgacatcaccaaggcgg Protospacer
*** . ********* *********** **
152. spacer 1.63|630033|33|CP033898|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 8, identity: 0.758
catgtcgcagcgctctggatcatcagtcatttc CRISPR spacer
gaacgcgcagcgctctggattttcagtcatggc Protospacer
* ***************. ******** *
153. spacer 1.67|628692|32|CP033898|CRT matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 8, identity: 0.75
cctcccgtgcgcgcagcgctcgaattg-gctac CRISPR spacer
gctcccgtgcgcgcagcactcgaaaaacgccg- Protospacer
****************.****** . **..
154. spacer 1.68|628753|32|CP033898|CRT matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 8, identity: 0.75
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cactccgatcaacgacgacatcaccaaggcgg Protospacer
** . ********* *********** **
155. spacer 1.68|628753|32|CP033898|CRT matches to NZ_CP044977 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-2, complete sequence) position: , mismatch: 8, identity: 0.75
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cactccgatcaacgacgacatcaccaaggcgg Protospacer
** . ********* *********** **
156. spacer 1.68|628753|32|CP033898|CRT matches to MN536506 (Uncultured bacterium plasmid pEN1, complete sequence) position: , mismatch: 8, identity: 0.75
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cactccgatcaacgacgacatcaccaaggcgg Protospacer
** . ********* *********** **
157. spacer 1.68|628753|32|CP033898|CRT matches to NZ_CP044551 (Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence) position: , mismatch: 8, identity: 0.75
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cactccgatcaacgacgacatcaccaaggcgg Protospacer
** . ********* *********** **
158. spacer 1.68|628753|32|CP033898|CRT matches to NZ_LR594677 (Variovorax sp. PBS-H4 plasmid 3) position: , mismatch: 8, identity: 0.75
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cactccgatcaacgacgacatcaccaaggcgg Protospacer
** . ********* *********** **
159. spacer 1.68|628753|32|CP033898|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ccacgacatcatcgaggacatcaccgatcagc Protospacer
* **** **** *************.*. *
160. spacer 1.73|629058|32|CP033898|CRT matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 8, identity: 0.75
gctacgttgatgcgcgtcctgcga-tgtggatg CRISPR spacer
attacgttgatgcgcgtaatgcgattaccgat- Protospacer
..*************** ***** *.. ***
161. spacer 1.73|629058|32|CP033898|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
gctacgttgatgcgcgtcctgcgatgtggatg CRISPR spacer
ggttggttgttgcgcgtccttcgatgtgttgg Protospacer
* * **** ********** ******* *
162. spacer 1.73|629058|32|CP033898|CRT matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
gctacgttgatgcgcgtcctgcga-tgtggatg CRISPR spacer
attacgttgatgcgcgtaatgcgattaccgat- Protospacer
..*************** ***** *.. ***
163. spacer 1.77|629302|32|CP033898|CRT matches to MK524500 (Mycobacterium phage Kevin1, complete genome) position: , mismatch: 8, identity: 0.75
gagttgctgcacggcgcgaatgtcatggctcg CRISPR spacer
gagttgctggacgacgcgaatgtccgtgccgt Protospacer
********* ***.********** **.
164. spacer 1.88|629973|32|CP033898|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 8, identity: 0.75
gaacagcttcggcctgcgcatgggcactttgc CRISPR spacer
tattgatatctgcctgcgcatgggcactttgc Protospacer
* .... ** *********************
165. spacer 1.88|629973|32|CP033898|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75
gaacagcttcggcctgcgcatgggcactttgc---- CRISPR spacer
tcacagcttcggcctgcgcatgagcg----gcggca Protospacer
********************.**. **
166. spacer 1.88|629973|32|CP033898|CRT matches to NZ_CP012664 (Defluviimonas alba strain cai42 plasmid pcai42C, complete sequence) position: , mismatch: 8, identity: 0.75
gaacagcttcggcctgcgcatgggcactttgc CRISPR spacer
cgtcagcttcggcctgcccatggtcagcgtgc Protospacer
. ************** ***** ** . ***
167. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.758
-cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gatcgacg-gcaactgcgacctggtggccacctc Protospacer
*.* *. ********** ********** **
168. spacer 1.102|630870|33|CP033898|CRT,CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.758
-cttgtcattcaactgcgacatggtggccacatc CRISPR spacer
gatcgacg-gcaactgcgacctggtggccacctc Protospacer
*.* *. ********** ********** **
169. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 8, identity: 0.758
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagacgcgttcgactgg Protospacer
* . ******** ******.********* *
170. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to MW119570 (Mycobacterium phage Lang, complete genome) position: , mismatch: 8, identity: 0.758
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
ctgggccggctcgatcaagacgcgttcgactgg Protospacer
* . ******** ******.********* *
171. spacer 1.9|629188|33|CP033898|PILER-CR matches to CP024688 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-4-144K, complete sequence) position: , mismatch: 9, identity: 0.727
catctatcagtatgtcgctgattacatgggcaa CRISPR spacer
cagctatcattatgtcgctgattattgtggtgt Protospacer
** ****** **************. **..
172. spacer 1.11|629312|33|CP033898|PILER-CR matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 9, identity: 0.727
ggagttgctgcacggcgcgaatgtcatggctcg CRISPR spacer
gccgctgctgcacggcgccaatgtcctggtgga Protospacer
* *.************* ****** ***. .
173. spacer 1.11|629312|33|CP033898|PILER-CR matches to MK524500 (Mycobacterium phage Kevin1, complete genome) position: , mismatch: 9, identity: 0.727
ggagttgctgcacggcgcgaatgtcatggctcg CRISPR spacer
agagttgctggacgacgcgaatgtccgtgccgt Protospacer
.********* ***.********** **.
174. spacer 1.22|629994|33|CP033898|PILER-CR matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 9, identity: 0.727
cgaacagcttcggcctgcgcatgggcactttgc CRISPR spacer
gtattgatatctgcctgcgcatgggcactttgc Protospacer
* .... ** *********************
175. spacer 1.28|630356|33|CP033898|PILER-CR matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
cccgccccgccggtagcccccggaattcgcttt CRISPR spacer
tccgcccagccggtagccgccggaatccagaag Protospacer
.****** ********** *******.*.
176. spacer 1.36|630852|33|CP033898|PILER-CR matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ggttccgccgccgaacattttgatgtcgttgga CRISPR spacer
cgccgcgccgccgtacattttggtgtcgtggac Protospacer
*.. ******** ********.****** *.
177. spacer 1.49|629179|33|CP033898|CRISPRCasFinder matches to CP024688 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-4-144K, complete sequence) position: , mismatch: 9, identity: 0.727
catctatcagtatgtcgctgattacatgggcaa CRISPR spacer
cagctatcattatgtcgctgattattgtggtgt Protospacer
** ****** **************. **..
178. spacer 1.51|629301|33|CP033898|CRISPRCasFinder matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 9, identity: 0.727
ggagttgctgcacggcgcgaatgtcatggctcg CRISPR spacer
gccgctgctgcacggcgccaatgtcctggtgga Protospacer
* *.************* ****** ***. .
179. spacer 1.51|629301|33|CP033898|CRISPRCasFinder matches to MK524500 (Mycobacterium phage Kevin1, complete genome) position: , mismatch: 9, identity: 0.727
ggagttgctgcacggcgcgaatgtcatggctcg CRISPR spacer
agagttgctggacgacgcgaatgtccgtgccgt Protospacer
.********* ***.********** **.
180. spacer 1.62|629972|33|CP033898|CRISPRCasFinder matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 9, identity: 0.727
cgaacagcttcggcctgcgcatgggcactttgc CRISPR spacer
gtattgatatctgcctgcgcatgggcactttgc Protospacer
* .... ** *********************
181. spacer 1.68|628753|32|CP033898|CRT matches to MH248947 (Streptomyces phage Yosif, complete genome) position: , mismatch: 9, identity: 0.719
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ggctgagatcaacgagggcatcaccaacctga Protospacer
. .*************.********** .
182. spacer 1.68|628753|32|CP033898|CRT matches to CP031731 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
tgccgaaatcaacgaggccatcaccaaagagg Protospacer
.. ***.********** ********* *
183. spacer 1.68|628753|32|CP033898|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.719
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cgtcgagctcaacgaggagatcaccacgacgg Protospacer
*. **** ********** ******* .*
184. spacer 1.68|628753|32|CP033898|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 9, identity: 0.719
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cgacgagctcaacgaggacatcgccggcctgg Protospacer
*.***** **************.**..* .
185. spacer 1.68|628753|32|CP033898|CRT matches to MN694482 (Marine virus AFVG_250M11, complete genome) position: , mismatch: 9, identity: 0.719
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
taggtaacgcagcgaggacatcatcaacgccc Protospacer
.*. *. **.***********.********
186. spacer 1.68|628753|32|CP033898|CRT matches to KU530220 (Streptomyces phage Xkcd426, complete genome) position: , mismatch: 9, identity: 0.719
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
cgcgaagatcaacgtggacagcaccaacatgc Protospacer
*. .********* ***** *******.. *
187. spacer 1.68|628753|32|CP033898|CRT matches to MF403007 (Agrobacterium phage Atu_ph04, complete genome) position: , mismatch: 9, identity: 0.719
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
agctgcgatcaacgaggtcatcaccagcgtcg Protospacer
. .* *********** ********.**.*
188. spacer 1.69|628814|32|CP033898|CRT matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 9, identity: 0.719
------gagaaacgtaccaagggaaagaagtcgctggt CRISPR spacer
ttttgcgcg------accaagggaaagaagtcaccggt Protospacer
* * *****************.*.***
189. spacer 1.75|629180|32|CP033898|CRT matches to NZ_CP041162 (Leisingera aquaemixtae strain R2C4 plasmid unnamed6) position: , mismatch: 9, identity: 0.719
atctatcagtatgtcgctgattacatgggcaa CRISPR spacer
gcctcaagctatgtcgctgatttcattggcaa Protospacer
..** . ************* *** *****
190. spacer 1.77|629302|32|CP033898|CRT matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 9, identity: 0.719
gagttgctgcacggcgcgaatgtcatggctcg CRISPR spacer
ccgctgctgcacggcgccaatgtcctggtgga Protospacer
*.************* ****** ***. .
191. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
192. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
193. spacer 1.78|629363|32|CP033898|CRT matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
194. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
195. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
196. spacer 1.78|629363|32|CP033898|CRT matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
197. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
198. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
199. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
200. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
201. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
202. spacer 1.78|629363|32|CP033898|CRT matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
203. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
204. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
205. spacer 1.78|629363|32|CP033898|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
gtgcacggcagcgtctccgtcaccgaatcccc Protospacer
.. ****** *********** **** .**
206. spacer 1.78|629363|32|CP033898|CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 9, identity: 0.719
acccacggctgcgtctccgtctccgacgtcca CRISPR spacer
tgggccggctgcgtcgccgcctccgacgacga Protospacer
********** ***.******** * *
207. spacer 1.84|629729|32|CP033898|CRT matches to NZ_CP039925 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129b, complete sequence) position: , mismatch: 9, identity: 0.719
gcgctgatgcaggccattgtgcctacgcagaa CRISPR spacer
gcgctgatgctggccatcgtgccgggcgtgat Protospacer
********** ******.***** . **
208. spacer 1.88|629973|32|CP033898|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.719
gaacagcttcggcctgcgcatgggcactttgc CRISPR spacer
gccgagcttcggcctgcccatgagcacgcttt Protospacer
* ************* ****.**** .* .
209. spacer 1.89|630034|32|CP033898|CRT matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 9, identity: 0.719
atgtcgcagcgctctggatcatcagtcatttc CRISPR spacer
gccgcgcagcgctctggatcttcggtcacatt Protospacer
.. **************** **.****. *.
210. spacer 1.91|630156|32|CP033898|CRT matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 9, identity: 0.719
tctagcacccgaggcagtgcgtgccattgccg CRISPR spacer
catgatcaccggggcagtgcttgccattgccg Protospacer
. *... ***.******** ***********
211. spacer 1.93|630320|33|CP033898|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
cccgccccgccggtagcccccggaattcgcttt CRISPR spacer
tccgcccagccggtagccgccggaatccagaag Protospacer
.****** ********** *******.*.
212. spacer 1.101|630809|33|CP033898|CRT,CRISPRCasFinder matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ggttccgccgccgaacattttgatgtcgttgga CRISPR spacer
cgccgcgccgccgtacattttggtgtcgtggac Protospacer
*.. ******** ********.****** *.
213. spacer 1.2|628754|33|CP033898|PILER-CR matches to MH248947 (Streptomyces phage Yosif, complete genome) position: , mismatch: 10, identity: 0.697
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
aggctgagatcaacgagggcatcaccaacctga Protospacer
. .*************.********** .
214. spacer 1.2|628754|33|CP033898|PILER-CR matches to CP031731 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ttgccgaaatcaacgaggccatcaccaaagagg Protospacer
... ***.********** ********* *
215. spacer 1.23|630056|33|CP033898|PILER-CR matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 10, identity: 0.697
catgtcgcagcgctctggatcatcagtcatttc CRISPR spacer
ggccgcgcagcgctctggatcttcggtcacatt Protospacer
.. **************** **.****. *.
216. spacer 1.25|630180|33|CP033898|PILER-CR matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 10, identity: 0.697
ctctagcacccgaggcagtgcgtgccattgccg CRISPR spacer
acatgatcaccggggcagtgcttgccattgccg Protospacer
. *... ***.******** ***********
217. spacer 1.39|631038|33|CP033898|PILER-CR matches to CP000619 (Burkholderia vietnamiensis G4 plasmid pBVIE03, complete sequence) position: , mismatch: 10, identity: 0.697
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
cttgtccggctcgttcacgatgcggtcgaggcg Protospacer
* ...************ ****** **** .
218. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to MH248947 (Streptomyces phage Yosif, complete genome) position: , mismatch: 10, identity: 0.697
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
aggctgagatcaacgagggcatcaccaacctga Protospacer
. .*************.********** .
219. spacer 1.42|628752|33|CP033898|CRISPRCasFinder matches to CP031731 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697
ccaacgagatcaacgaggacatcaccaacgccc CRISPR spacer
ttgccgaaatcaacgaggccatcaccaaagagg Protospacer
... ***.********** ********* *
220. spacer 1.63|630033|33|CP033898|CRISPRCasFinder matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 10, identity: 0.697
catgtcgcagcgctctggatcatcagtcatttc CRISPR spacer
ggccgcgcagcgctctggatcttcggtcacatt Protospacer
.. **************** **.****. *.
221. spacer 1.65|630155|33|CP033898|CRISPRCasFinder matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 10, identity: 0.697
ctctagcacccgaggcagtgcgtgccattgccg CRISPR spacer
acatgatcaccggggcagtgcttgccattgccg Protospacer
. *... ***.******** ***********
222. spacer 1.68|628753|32|CP033898|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 10, identity: 0.688
caacgagatcaacgaggacatcaccaacgccc CRISPR spacer
tgacgagctcaacgaggacatcgccggcctgg Protospacer
..***** **************.**..* .
223. spacer 1.77|629302|32|CP033898|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gagttgctgcacggcgcgaatgtcatggctcg CRISPR spacer
ggagggcggcacggcgcgaatgtcacgggcgc Protospacer
*.. ** *****************.** .
224. spacer 1.84|629729|32|CP033898|CRT matches to NZ_CP041044 (Paracoccus sp. AK26 plasmid pAK2, complete sequence) position: , mismatch: 10, identity: 0.688
gcgctgatgcaggccattgtgcctacgcagaa CRISPR spacer
aagatgatgcaggccattatggctacgtcttc Protospacer
. * **************.** *****.
225. spacer 1.86|629851|32|CP033898|CRT matches to CP015514 (Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gcatcaaccttatccaaggtggattgcacatt CRISPR spacer
tcatcaaccttatccaagttgaatcttttaag Protospacer
***************** **.**. . .*
226. spacer 1.88|629973|32|CP033898|CRT matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 10, identity: 0.688
gaacagcttcggcctgcgcatgggcactttgc CRISPR spacer
tcccggctacgacctgcgcatgggcactagca Protospacer
*.*** **.****************
227. spacer 1.91|630156|32|CP033898|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
tctagcacccgaggcagtgcgtgccattgccg CRISPR spacer
aaccgcaaccgaggccgtgcgtgccatccgca Protospacer
. *** ******* ***********. *.
228. spacer 1.91|630156|32|CP033898|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688
tctagcacccgaggcagtgcgtgccattgccg CRISPR spacer
aaccgcaaccgaggccgtgcgtgccatccgca Protospacer
. *** ******* ***********. *.
229. spacer 1.104|630992|33|CP033898|CRT,CRISPRCasFinder matches to CP000619 (Burkholderia vietnamiensis G4 plasmid pBVIE03, complete sequence) position: , mismatch: 10, identity: 0.697
cacacccggctcgttcaagatgcgttcgacagc CRISPR spacer
cttgtccggctcgttcacgatgcggtcgaggcg Protospacer
* ...************ ****** **** .
