Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033932 Chryseobacterium bernardetii strain G0229 chromosome, complete genome 4 crisprs DEDDh,WYL,cas3,PD-DExK,csa3,cas1,cas9,c2c10_CAS-V-U3 0 1 7 0

Results visualization

1. CP033932
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033932_1 1205474-1205572 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033932_4 2615345-2615425 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033932_3 2615157-2615265 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033932_5 2691837-2691918 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065458 Streptococcus phage IPP17, complete genome 12566-12594 6 0.793
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065495 Streptococcus phage IPP58, complete genome 11963-11991 6 0.793
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065470 Streptococcus phage IPP29, complete genome 14220-14248 6 0.793
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065494 Streptococcus phage IPP57, complete genome 11963-11991 6 0.793
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 MG592499 Vibrio phage 1.124.O._10N.286.49.B1, partial genome 31536-31564 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 MG592531 Vibrio phage 1.164.O._10N.261.51.A7, partial genome 32360-32388 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 MG592611 Vibrio phage 1.246.O._10N.261.54.E10, partial genome 29199-29227 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065462 Streptococcus phage IPP21, complete genome 14891-14919 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065454 Streptococcus phage IPP12, complete genome 13770-13798 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065471 Streptococcus phage IPP30, complete genome 15222-15250 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065461 Streptococcus phage IPP20, complete genome 14812-14840 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065463 Streptococcus phage IPP22, complete genome 13700-13728 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065453 Streptococcus phage IPP11, complete genome 14265-14293 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065469 Streptococcus phage IPP28, complete genome 13017-13045 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065460 Streptococcus phage IPP19, complete genome 11736-11764 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065499 Streptococcus phage IPP63, complete genome 12638-12666 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KT337342 Streptococcus phage phiARI0131-2, complete genome 21360-21388 7 0.759
CP033932_1 1.1|1205509|29|CP033932|CRISPRCasFinder 1205509-1205537 29 KY065459 Streptococcus phage IPP18, complete genome 14258-14286 7 0.759

1. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065458 (Streptococcus phage IPP17, complete genome) position: , mismatch: 6, identity: 0.793

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caatcaaggattgtattggcagaaaaaaa	Protospacer
.  * ** **** ****************

2. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065495 (Streptococcus phage IPP58, complete genome) position: , mismatch: 6, identity: 0.793

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caatcaaggattgtattggcagaaaaaaa	Protospacer
.  * ** **** ****************

3. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065470 (Streptococcus phage IPP29, complete genome) position: , mismatch: 6, identity: 0.793

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caatcaaggattgtattggcagaaaaaaa	Protospacer
.  * ** **** ****************

4. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065494 (Streptococcus phage IPP57, complete genome) position: , mismatch: 6, identity: 0.793

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caatcaaggattgtattggcagaaaaaaa	Protospacer
.  * ** **** ****************

5. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to MG592499 (Vibrio phage 1.124.O._10N.286.49.B1, partial genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
cgaataatgattttattgtcagaaaaata	Protospacer
.    ************* ******** *

6. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to MG592531 (Vibrio phage 1.164.O._10N.261.51.A7, partial genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
cgaataatgattttattgtcagaaaaata	Protospacer
.    ************* ******** *

7. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to MG592611 (Vibrio phage 1.246.O._10N.261.54.E10, partial genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
cgaataatgattttattgtcagaaaaata	Protospacer
.    ************* ******** *

8. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065462 (Streptococcus phage IPP21, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

9. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065454 (Streptococcus phage IPP12, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

10. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065471 (Streptococcus phage IPP30, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

11. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065461 (Streptococcus phage IPP20, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

12. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065463 (Streptococcus phage IPP22, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

13. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065453 (Streptococcus phage IPP11, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

14. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065469 (Streptococcus phage IPP28, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

15. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065460 (Streptococcus phage IPP19, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

16. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065499 (Streptococcus phage IPP63, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

17. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KT337342 (Streptococcus phage phiARI0131-2, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

18. spacer 1.1|1205509|29|CP033932|CRISPRCasFinder matches to KY065459 (Streptococcus phage IPP18, complete genome) position: , mismatch: 7, identity: 0.759

tcttaaatgattttattggcagaaaaaaa	CRISPR spacer
caaccaaggattgtattggcagaaaaaaa	Protospacer
.  . ** **** ****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 539014 : 566538 31 Riemerella_phage(57.14%) transposase,integrase,holin,bacteriocin attL 538228:538243|attR 568378:568393
DBSCAN-SWA_2 572159 : 586637 21 Riemerella_phage(18.18%) portal NA
DBSCAN-SWA_3 993805 : 1033749 31 Klebsiella_phage(50.0%) transposase,protease,tRNA NA
DBSCAN-SWA_4 3460602 : 3520377 52 uncultured_Caudovirales_phage(33.33%) transposase,integrase attL 3462060:3462076|attR 3498631:3498647
DBSCAN-SWA_5 3742748 : 3792941 43 uncultured_Mediterranean_phage(14.29%) transposase,protease NA
DBSCAN-SWA_6 4272842 : 4295882 27 Bacillus_phage(66.67%) transposase,protease,bacteriocin NA
DBSCAN-SWA_7 5099455 : 5145100 50 Bacillus_phage(41.67%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage