Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027755 Pseudomonas synxantha strain 2-79 chromosome, complete genome 3 crisprs DEDDh,DinG,csa3,cas3,WYL,c2c9_V-U4,RT 1 0 6 0

Results visualization

1. CP027755
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027755_1 2512428-2512539 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027755_2 2893092-2893194 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027755_3 4873471-4873581 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP027755_2 2.1|2893124|39|CP027755|CRISPRCasFinder 2893124-2893162 39 CP027755.1 3512955-3512993 1 0.974

1. spacer 2.1|2893124|39|CP027755|CRISPRCasFinder matches to position: 3512955-3512993, mismatch: 1, identity: 0.974

tatttgactgatggtctcggtccagatgtgggagggggc	CRISPR spacer
tatttgactgatggtctcggtccaaatgtgggagggggc	Protospacer
************************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 364563 : 397850 41 Pseudomonas_phage(68.97%) tail,capsid,terminase,head NA
DBSCAN-SWA_2 1374852 : 1460280 98 Pseudomonas_phage(33.33%) plate,tRNA,tail NA
DBSCAN-SWA_3 1536971 : 1541933 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_4 3746025 : 3811293 81 uncultured_Caudovirales_phage(67.39%) plate,tRNA,portal,integrase,protease,terminase,tail attL 3769850:3769865|attR 3784922:3784937
DBSCAN-SWA_5 4464406 : 4467476 6 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_6 5293443 : 5300471 7 uncultured_Caudovirales_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage