Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027724 Pseudomonas orientalis strain L1-3-08 chromosome, complete genome 3 crisprs DEDDh,DinG,csa3,cas3,WYL 1 1 8 0

Results visualization

1. CP027724
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027724_1 2236206-2236303 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027724_2 2363273-2363379 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027724_3 3800517-3800628 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP027724_1 1.1|2236233|44|CP027724|CRISPRCasFinder 2236233-2236276 44 CP027724.1 3800512-3800555 2 0.955

1. spacer 1.1|2236233|44|CP027724|CRISPRCasFinder matches to position: 3800512-3800555, mismatch: 2, identity: 0.955

gaccaggatttttgtgtcgatcccggtccaaatgtgggaggggg	CRISPR spacer
gaccaggattttgatgtcgatcccggtccaaatgtgggaggggg	Protospacer
************ .******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027724_3 3.1|3800559|28|CP027724|CRISPRCasFinder 3800559-3800586 28 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 398991-399018 6 0.786

1. spacer 3.1|3800559|28|CP027724|CRISPRCasFinder matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ccagaggccgccatgggggcaagcccct	CRISPR spacer
tcagaggccgccatgggggcatcgcggt	Protospacer
.********************   *  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1305558 : 1344753 45 uncultured_Caudovirales_phage(31.82%) tRNA,plate,tail NA
DBSCAN-SWA_2 1452155 : 1457118 7 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_3 1594656 : 1600647 7 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 2868926 : 2924592 42 Bacillus_phage(42.86%) protease,integrase attL 2867715:2867731|attR 2877465:2877481
DBSCAN-SWA_5 3536771 : 3542998 8 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_6 3843985 : 3914784 88 Pseudomonas_phage(58.82%) tRNA,terminase,tail NA
DBSCAN-SWA_7 3919483 : 3935334 30 uncultured_Caudovirales_phage(58.82%) NA NA
DBSCAN-SWA_8 5557078 : 5567907 8 Mannheimia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage