Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034015 Shewanella livingstonensis strain LMG 19866 chromosome, complete genome 3 crisprs csa3,PD-DExK,RT,cas3,DinG,DEDDh 1 0 5 0

Results visualization

1. CP034015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034015_1 1835775-1835987 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034015_2 3698327-3698422 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034015_3 3813706-3813800 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034015_3 3.1|3813739|29|CP034015|CRISPRCasFinder 3813739-3813767 29 CP034015.1 660130-660158 2 0.931

1. spacer 3.1|3813739|29|CP034015|CRISPRCasFinder matches to position: 660130-660158, mismatch: 2, identity: 0.931

gagcgcactatccgtgtagcggcctagga	CRISPR spacer
gagcgcactatccgcgtagcggtctagga	Protospacer
**************.*******.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1580123 : 1587624 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 2082316 : 2092189 9 Faustovirus(14.29%) NA NA
DBSCAN-SWA_3 2925470 : 2987897 52 Paenibacillus_phage(15.38%) tRNA,transposase,integrase attL 2917447:2917476|attR 2941408:2941437
DBSCAN-SWA_4 3740722 : 3785393 44 Enterobacteria_phage(30.0%) transposase,integrase attL 3750111:3750126|attR 3763168:3763183
DBSCAN-SWA_5 4497897 : 4559878 49 Leptospira_phage(50.0%) tRNA,transposase,protease,integrase attL 4521804:4521819|attR 4566702:4566717
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage