Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034044 Mycoplasma sp. 237IA chromosome, complete genome 1 crisprs NA 1 0 1 0

Results visualization

1. CP034044
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034044_3 710207-710307 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034044_1 1.1|149119|52|CP034044|CRISPRCasFinder 149119-149170 52 CP034044.1 152637-152688 1 0.981

1. spacer 1.1|149119|52|CP034044|CRISPRCasFinder matches to position: 152637-152688, mismatch: 1, identity: 0.981

tcaacctggagccaaaggtgaaaaaggagacaagggagataaaggtgaaact	CRISPR spacer
tcaacccggagccaaaggtgaaaaaggagacaagggagataaaggtgaaact	Protospacer
******.*********************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 204716 : 213013 6 Mycoplasma_phage(83.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage