Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034098 Staphylococcus aureus strain 80wphwpl_v1 chromosome, complete genome 13 crisprs cas3,DEDDh,DinG,csa3,WYL 4 1 8 0

Results visualization

1. CP034098
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_1 600088-600180 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_2 664818-664917 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_3 752552-752636 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_4 810763-810842 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_5 876098-876183 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_6 1177600-1177692 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_7 1895675-1895817 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_8 1929765-1929848 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_9 1940428-1940619 Orphan NA
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_10 2121694-2121783 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_11 2140708-2140909 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_12 2199241-2199366 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034098_13 2725908-2725991 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034098_3 3.1|752578|33|CP034098|CRISPRCasFinder 752578-752610 33 CP034098.1 1002233-1002265 1 0.97
CP034098_3 3.1|752578|33|CP034098|CRISPRCasFinder 752578-752610 33 CP034098.1 2271959-2271991 1 0.97
CP034098_13 13.1|2725934|32|CP034098|CRISPRCasFinder 2725934-2725965 32 CP034098.1 2271928-2271959 1 0.969
CP034098_5 5.1|876128|26|CP034098|CRISPRCasFinder 876128-876153 26 CP034098.1 2014677-2014702 2 0.923
CP034098_5 5.1|876128|26|CP034098|CRISPRCasFinder 876128-876153 26 CP034098.1 2076960-2076985 2 0.923
CP034098_9 9.2|1940507|34|CP034098|CRT 1940507-1940540 34 CP034098.1 255836-255869 2 0.941
CP034098_9 9.2|1940507|34|CP034098|CRT 1940507-1940540 34 CP034098.1 335128-335161 2 0.941
CP034098_9 9.2|1940507|34|CP034098|CRT 1940507-1940540 34 CP034098.1 719413-719446 2 0.941
CP034098_9 9.2|1940507|34|CP034098|CRT 1940507-1940540 34 CP034098.1 752617-752650 2 0.941
CP034098_9 9.2|1940507|34|CP034098|CRT 1940507-1940540 34 CP034098.1 1028390-1028423 2 0.941
CP034098_9 9.2|1940507|34|CP034098|CRT 1940507-1940540 34 CP034098.1 1723081-1723114 2 0.941
CP034098_9 9.2|1940507|34|CP034098|CRT 1940507-1940540 34 CP034098.1 2237549-2237582 2 0.941
CP034098_9 9.2|1940507|34|CP034098|CRT 1940507-1940540 34 CP034098.1 2377795-2377828 2 0.941
CP034098_13 13.1|2725934|32|CP034098|CRISPRCasFinder 2725934-2725965 32 CP034098.1 752610-752641 2 0.938
CP034098_13 13.1|2725934|32|CP034098|CRISPRCasFinder 2725934-2725965 32 CP034098.1 1002323-1002354 2 0.938

1. spacer 3.1|752578|33|CP034098|CRISPRCasFinder matches to position: 1002233-1002265, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctgtgttggggccca	Protospacer
******************** ************

2. spacer 3.1|752578|33|CP034098|CRISPRCasFinder matches to position: 2271959-2271991, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttgggaccca	Protospacer
****************************.****

3. spacer 13.1|2725934|32|CP034098|CRISPRCasFinder matches to position: 2271928-2271959, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

4. spacer 5.1|876128|26|CP034098|CRISPRCasFinder matches to position: 2014677-2014702, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cgcggccccaacacagaagctggcgg	Protospacer
** ********************.**

5. spacer 5.1|876128|26|CP034098|CRISPRCasFinder matches to position: 2076960-2076985, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cggggccccaacacaaaagctggcgg	Protospacer
***************.*******.**

6. spacer 9.2|1940507|34|CP034098|CRT matches to position: 255836-255869, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

7. spacer 9.2|1940507|34|CP034098|CRT matches to position: 335128-335161, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

8. spacer 9.2|1940507|34|CP034098|CRT matches to position: 719413-719446, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

9. spacer 9.2|1940507|34|CP034098|CRT matches to position: 752617-752650, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

10. spacer 9.2|1940507|34|CP034098|CRT matches to position: 1028390-1028423, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

11. spacer 9.2|1940507|34|CP034098|CRT matches to position: 1723081-1723114, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

12. spacer 9.2|1940507|34|CP034098|CRT matches to position: 2237549-2237582, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

13. spacer 9.2|1940507|34|CP034098|CRT matches to position: 2377795-2377828, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

14. spacer 13.1|2725934|32|CP034098|CRISPRCasFinder matches to position: 752610-752641, mismatch: 2, identity: 0.938

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaacttgcattgcctgtagaatttct	Protospacer
******.****.********************

15. spacer 13.1|2725934|32|CP034098|CRISPRCasFinder matches to position: 1002323-1002354, mismatch: 2, identity: 0.938

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaacttgcattgcctgtagaatttct	Protospacer
******.****.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034098_1 1.1|600120|29|CP034098|CRISPRCasFinder 600120-600148 29 NZ_CP026273 Klebsiella oxytoca strain KONIH4 plasmid pKOX-ea2b, complete sequence 142439-142467 8 0.724

1. spacer 1.1|600120|29|CP034098|CRISPRCasFinder matches to NZ_CP026273 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-ea2b, complete sequence) position: , mismatch: 8, identity: 0.724

ccgcacaactgcataaatccctctaatcg	CRISPR spacer
attcacaactatataaatccctctaaatt	Protospacer
 . *******..************** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 697793 : 705614 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 717586 : 731724 15 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 814718 : 830362 25 Staphylococcus_phage(89.47%) terminase,coat,integrase attL 814559:814578|attR 830817:830836
DBSCAN-SWA_4 917699 : 967757 46 Bacillus_virus(22.22%) transposase,protease,tRNA,bacteriocin,holin NA
DBSCAN-SWA_5 1003703 : 1012176 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1572872 : 1581184 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_7 1650621 : 1661585 8 uncultured_Mediterranean_phage(42.86%) transposase,tRNA NA
DBSCAN-SWA_8 1784715 : 1854213 67 Staphylococcus_phage(93.18%) transposase,protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage