Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034104 Brucella melitensis strain BmWS93 chromosome 2, complete sequence 0 crisprs csa3,DEDDh,cas3 0 0 96 0
CP034103 Brucella melitensis strain BmWS93 chromosome 1, complete sequence 1 crisprs csa3,WYL,DEDDh 0 1 2 0

Results visualization

1. CP034103
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034103_1 658648-658730 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034103_1 1.1|658676|27|CP034103|CRISPRCasFinder 658676-658702 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|658676|27|CP034103|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ataagatgcgcgcaaggaaagatctgt	CRISPR spacer
aacagatgctctcaaggaaagatctga	Protospacer
*  ****** * ************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 874750 : 886662 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_2 957370 : 965709 11 Brucella_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP034104
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5286 4 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_2 9545 : 10547 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_3 20180 : 23596 2 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_4 35789 : 36926 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_5 48734 : 49451 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_6 55542 : 59620 5 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_7 67039 : 71834 6 Caulobacter_phage(33.33%) NA NA
DBSCAN-SWA_8 75524 : 76412 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_9 79556 : 87019 6 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_10 100253 : 100976 1 Bartonella_henselae_phage(100.0%) NA NA
DBSCAN-SWA_11 105009 : 106080 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_12 121011 : 135807 12 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_13 148215 : 149778 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_14 153683 : 164809 8 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_15 183342 : 184410 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_16 189575 : 195533 5 Skermania_phage(20.0%) NA NA
DBSCAN-SWA_17 198636 : 199638 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_18 207919 : 211684 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_19 218698 : 219676 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_20 225103 : 225544 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_21 228861 : 229857 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_22 236022 : 237873 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_23 243164 : 243992 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_24 247722 : 248643 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_25 257433 : 258246 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_26 267736 : 268912 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_27 285747 : 287619 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_28 291138 : 291390 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_29 296518 : 311934 13 uncultured_virus(28.57%) tRNA NA
DBSCAN-SWA_30 317202 : 323430 7 Tupanvirus(66.67%) tRNA NA
DBSCAN-SWA_31 349758 : 355133 6 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_32 360812 : 361793 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_33 380886 : 383453 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_34 393118 : 394252 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_35 400670 : 405139 6 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_36 410093 : 411956 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_37 417156 : 422412 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_38 446823 : 447294 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_39 454326 : 458531 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_40 461626 : 467439 6 Synechococcus_phage(20.0%) NA NA
DBSCAN-SWA_41 478098 : 485637 6 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_42 490468 : 500235 9 Staphylococcus_phage(40.0%) NA NA
DBSCAN-SWA_43 508967 : 509681 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_44 513402 : 514575 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_45 519818 : 520523 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_46 532036 : 534680 2 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_47 546604 : 548140 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_48 583428 : 584325 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_49 595050 : 596228 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_50 600151 : 602186 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_51 619930 : 621930 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_52 626132 : 628099 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_53 633195 : 634272 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_54 638584 : 643176 6 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_55 646974 : 651383 3 Dishui_lake_phycodnavirus(33.33%) NA NA
DBSCAN-SWA_56 662525 : 664355 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_57 672299 : 677132 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_58 681092 : 683725 3 Rhizobium_phage(50.0%) NA NA
DBSCAN-SWA_59 695009 : 695768 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_60 699173 : 706130 6 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_61 715273 : 716095 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_62 729687 : 733100 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_63 740967 : 754301 17 Acanthocystis_turfacea_Chlorella_virus(16.67%) holin NA
DBSCAN-SWA_64 760781 : 761801 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_65 773580 : 775170 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_66 802621 : 810192 7 Only_Syngen_Nebraska_virus(33.33%) NA NA
DBSCAN-SWA_67 816263 : 827197 12 Klosneuvirus(40.0%) tRNA,protease NA
DBSCAN-SWA_68 832971 : 841007 6 Indivirus(25.0%) NA NA
DBSCAN-SWA_69 850659 : 852204 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_70 859306 : 861782 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_71 869423 : 875129 3 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_72 879042 : 879600 1 Geobacillus_phage(100.0%) NA NA
DBSCAN-SWA_73 894627 : 897708 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_74 901664 : 905636 3 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_75 913074 : 914660 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_76 923431 : 924088 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_77 933164 : 940296 6 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_78 951508 : 953044 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_79 961875 : 964995 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_80 968188 : 970019 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_81 973027 : 974194 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_82 986327 : 989126 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_83 998107 : 1003564 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_84 1011064 : 1018375 6 Burkholderia_virus(33.33%) NA NA
DBSCAN-SWA_85 1027901 : 1034410 6 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_86 1040726 : 1043390 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_87 1053200 : 1058320 4 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_88 1064703 : 1066166 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_89 1072337 : 1073141 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_90 1088452 : 1112308 21 Bacillus_phage(18.18%) NA NA
DBSCAN-SWA_91 1117749 : 1119849 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_92 1129764 : 1133056 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_93 1147603 : 1149166 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_94 1158841 : 1161280 3 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_95 1169421 : 1174276 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_96 1180822 : 1182433 1 Planktothrix_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage