Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP023835 Escherichia coli strain 4/2-1 plasmid p4_2_1.1, complete sequence 0 crisprs RT 0 0 2 0
CP023837 Escherichia coli strain 4/2-1 plasmid p4_2_1.3, complete sequence 0 crisprs NA 0 0 0 0
CP023836 Escherichia coli strain 4/2-1 plasmid p4_2_1.2, complete sequence 0 crisprs NA 0 0 0 0
CP023838 Escherichia coli strain 4/2-1 plasmid p4_2_1.4, complete sequence 0 crisprs NA 0 0 0 0
CP023834 Escherichia coli strain 4/2-1 chromosome, complete genome 6 crisprs DinG,cas3,RT,c2c9_V-U4,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 14 5 0

Results visualization

1. CP023835
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 38968 : 81809 47 Stx2-converting_phage(44.44%) transposase,protease NA
DBSCAN-SWA_2 87719 : 117606 30 Escherichia_phage(58.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP023834
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023834_1 424273-424417 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023834_2 564459-564555 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023834_3 2392320-2392446 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023834_4 2886739-2887440 TypeI-E I-E
11 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023834_5 2912989-2913323 Unclear I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023834_6 4602901-4603050 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP023834_4 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887134-2887165 32 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 65474-65505 5 0.844
CP023834_4 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887134-2887165 32 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 208287-208318 6 0.812
CP023834_5 5.4|2913202|31|CP023834|CRISPRCasFinder 2913202-2913232 31 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755174-755204 6 0.806
CP023834_5 5.4|2913202|31|CP023834|CRISPRCasFinder 2913202-2913232 31 MH067970 Arthrobacter sp. strain ANT_H40 plasmid pA40H1, complete sequence 47826-47856 6 0.806
CP023834_4 4.5|2887012|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887012-2887043 32 MF351863 Synechococcus phage Bellamy, complete genome 123998-124029 7 0.781
CP023834_4 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887073-2887104 32 MK416018 Klebsiella phage ST147-VIM1phi7.1, complete genome 24790-24821 7 0.781
CP023834_5 5.1|2913019|31|CP023834|CRISPRCasFinder 2913019-2913049 31 MG945629 UNVERIFIED: Microviridae sp. isolate 6200-1602, complete genome 4209-4239 7 0.774
CP023834_5 5.1|2913019|31|CP023834|CRISPRCasFinder 2913019-2913049 31 MK814759 Gordonia phage Reyja, complete genome 4468-4498 7 0.774
CP023834_4 4.1|2886768|32|CP023834|CRISPRCasFinder,CRT 2886768-2886799 32 NZ_AP018516 Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence 48296-48327 8 0.75
CP023834_4 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887134-2887165 32 MK113951 Phage 5P_3, complete genome 11967-11998 8 0.75
CP023834_4 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887134-2887165 32 AP017924 Ralstonia phage RP12 DNA, complete genome 11643-11674 8 0.75
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 375744-375776 8 0.758
CP023834_5 5.2|2913080|31|CP023834|CRISPRCasFinder 2913080-2913110 31 NZ_CP033579 Vibrio mediterranei strain 117-T6 plasmid unnamed, complete sequence 47369-47399 8 0.742
CP023834_5 5.4|2913202|31|CP023834|CRISPRCasFinder 2913202-2913232 31 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191950 8 0.742
CP023834_5 5.14|2913202|33|CP023834|CRT 2913202-2913234 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229083-229131 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229184-229232 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229285-229333 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239577-239625 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239678-239726 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239779-239827 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230489-230537 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230590-230638 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230691-230739 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211459-211507 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211560-211608 9 0.816
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211661-211709 9 0.816
CP023834_4 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887073-2887104 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1143591-1143622 9 0.719
CP023834_4 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887073-2887104 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 891493-891524 9 0.719
CP023834_4 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887073-2887104 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1143594-1143625 9 0.719
CP023834_4 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887073-2887104 32 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 315030-315061 9 0.719
CP023834_4 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887073-2887104 32 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1123532-1123563 9 0.719
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 26182-26214 9 0.727
CP023834_5 5.5|2913263|31|CP023834|CRISPRCasFinder 2913263-2913293 31 MF158039 Shigella phage Sf12, complete genome 4976-5006 9 0.71
CP023834_5 5.5|2913263|31|CP023834|CRISPRCasFinder 2913263-2913293 31 MF158042 Shigella phage Sd1, complete genome 939-969 9 0.71
CP023834_1 1.1|424316|59|CP023834|CRISPRCasFinder 424316-424374 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229386-229434 10 0.796
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239880-239928 10 0.796
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230792-230840 10 0.796
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211762-211810 10 0.796
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7442-7490 10 0.796
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84266-84314 10 0.796
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386508-386556 10 0.796
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14196-14244 10 0.796
CP023834_4 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887134-2887165 32 NC_002580 Propionibacterium freudenreichii plasmid p545, complete sequence 2898-2929 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 156123-156154 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NZ_CP053984 Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence 21888-21919 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NC_010935 Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence 28766-28797 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 JX469826 Uncultured bacterium plasmid pB12, complete sequence 11283-11314 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 JN106171 Uncultured bacterium plasmid pAKD26, complete sequence 11289-11320 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NC_016968 Comamonas testosteroni plasmid pTB30, complete sequence 11287-11318 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 11272-11303 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NZ_CP017760 Cupriavidus necator strain NH9 plasmid pENH91, complete sequence 67078-67109 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NZ_CP053554 Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence 4235-4266 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NC_019263 Delftia acidovorans plasmid pLME1, complete sequence 11288-11319 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NC_019264 Delftia acidovorans plasmid pNB8c, complete sequence 11288-11319 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NC_019283 Delftia acidovorans plasmid pC1-1, complete sequence 11288-11319 10 0.688
CP023834_4 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887195-2887226 32 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 11350-11381 10 0.688
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 CP046443 Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed2, complete sequence 31933-31965 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_LT963392 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence 103013-103045 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_LT963392 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence 110510-110542 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_CP034079 Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-1, complete sequence 48454-48486 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_CP034080 Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-2, complete sequence 39480-39512 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NC_005918 Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence 31117-31149 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_CP047262 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence 30966-30998 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_CP026560 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence 19118-19150 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_LT963406 Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence 54820-54852 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 LT985193 Pseudomonas syringae strain CFBP 2116 genome assembly, plasmid: PP2 32077-32109 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_LT963393 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP2, complete sequence 50597-50629 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_LT985210 Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence 105842-105874 10 0.697
CP023834_4 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR 2887317-2887349 33 NZ_LT985211 Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP2, complete sequence 84272-84304 10 0.697
CP023834_5 5.5|2913263|31|CP023834|CRISPRCasFinder 2913263-2913293 31 MT840185 Bacteriophage sp. Joined_contig_19 genomic sequence 64310-64340 10 0.677
CP023834_5 5.5|2913263|31|CP023834|CRISPRCasFinder 2913263-2913293 31 KF356199 Microcystis phage MaMV-DC, complete genome 50157-50187 10 0.677
CP023834_5 5.5|2913263|31|CP023834|CRISPRCasFinder 2913263-2913293 31 NC_008562 Microcystis phage Ma-LMM01 DNA, complete genome 44744-44774 10 0.677
CP023834_1 1.1|424316|59|CP023834|CRISPRCasFinder 424316-424374 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194003-194051 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194096-194144 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194282-194330 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204497-204545 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204590-204638 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204776-204824 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195331-195379 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195424-195472 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195610-195658 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176286-176334 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176379-176427 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176565-176613 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27282-27330 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27381-27429 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51834-51882 11 0.776
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 19389-19437 11 0.776
CP023834_5 5.15|2913263|33|CP023834|CRT 2913263-2913295 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
CP023834_5 5.15|2913263|33|CP023834|CRT 2913263-2913295 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211730-211778 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211930-211978 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194189-194237 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222224-222272 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222424-222472 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204683-204731 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213058-213106 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213258-213306 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195517-195565 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194013-194061 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194213-194261 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176472-176520 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 11511-11559 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397088-397136 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404133-404181 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 27994-28042 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31299-31347 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33059-33107 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141016-141064 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 MF374379 Escherichia phage DN1, complete genome 31158-31206 12 0.755
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14105-14153 13 0.735
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 6859-6907 13 0.735
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NC_049343 Escherichia phage 500465-2, complete genome 31797-31845 13 0.735
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 94-142 13 0.735
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 82842-82890 14 0.714
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313592-313640 14 0.714
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 63889-63937 14 0.714
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 110186-110234 14 0.714
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 198909-198957 14 0.714
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40305-40353 14 0.714
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 91418-91466 14 0.714
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 102544-102592 15 0.694
CP023834_3 3.1|2392359|49|CP023834|CRISPRCasFinder 2392359-2392407 49 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56031-56079 15 0.694

1. spacer 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 5, identity: 0.844

tgggcggcttgccttgcagccagctccagcag-	CRISPR spacer
tgggcggcttgcgttgcagcctgc-cgagcgga	Protospacer
************ ******** ** * ***.* 

2. spacer 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 6, identity: 0.812

tgggcggcttgccttgcagccagctccagcag-	CRISPR spacer
ggggcggcttgcgttgcagcctgc-cgagcgga	Protospacer
 *********** ******** ** * ***.* 

3. spacer 5.4|2913202|31|CP023834|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806

tggctctgcaacagcagcacccatgaccacg	CRISPR spacer
cgctccagcaacagcagcacccacgaccacg	Protospacer
.* ..* ****************.*******

4. spacer 5.4|2913202|31|CP023834|CRISPRCasFinder matches to MH067970 (Arthrobacter sp. strain ANT_H40 plasmid pA40H1, complete sequence) position: , mismatch: 6, identity: 0.806

tggctctgcaacagcagcacccatgaccacg	CRISPR spacer
aggcgtgggaacagcagcacccttgaccacg	Protospacer
 *** . * ************* ********

5. spacer 4.5|2887012|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 7, identity: 0.781

atcgtccatattaacaatcgtggtgagttcaa	CRISPR spacer
atcgcccatatcaacaatcgtggtgatacctt	Protospacer
****.******.**************  .*  

6. spacer 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to MK416018 (Klebsiella phage ST147-VIM1phi7.1, complete genome) position: , mismatch: 7, identity: 0.781

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
tccatcacaccgccaaaaaacgcgctgatggg	Protospacer
 *.** .* *** **************.****

7. spacer 5.1|2913019|31|CP023834|CRISPRCasFinder matches to MG945629 (UNVERIFIED: Microviridae sp. isolate 6200-1602, complete genome) position: , mismatch: 7, identity: 0.774

gacagaacggcctcagtagtctcgtcaggct	CRISPR spacer
gactgaacggcctcagtagtcttggcctttt	Protospacer
*** ******************.* *   .*

8. spacer 5.1|2913019|31|CP023834|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 7, identity: 0.774

-gacagaacggcctcagtagtctcgtcaggct	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggct	Protospacer
  ** *  .****.******.***********

9. spacer 4.1|2886768|32|CP023834|CRISPRCasFinder,CRT matches to NZ_AP018516 (Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence) position: , mismatch: 8, identity: 0.75

cagcgtcaggcgtgaaatctcaccgtcgttgc	CRISPR spacer
attctttaggcgtgacatcttaccgtcgttga	Protospacer
   * *.******** ****.********** 

10. spacer 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to MK113951 (Phage 5P_3, complete genome) position: , mismatch: 8, identity: 0.75

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
ggggcagcttgccttgcagccagccgatgctc	Protospacer
 ****.******************.   **  

11. spacer 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to AP017924 (Ralstonia phage RP12 DNA, complete genome) position: , mismatch: 8, identity: 0.75

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
tgggccgcttgccgtgcagccagcgcttccgc	Protospacer
***** ******* ********** *.  *. 

12. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.758

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
cgcgtcggcgacgcgcaggtaatgcgcgatcag	Protospacer
   * **************  *********. *

13. spacer 5.2|2913080|31|CP023834|CRISPRCasFinder matches to NZ_CP033579 (Vibrio mediterranei strain 117-T6 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

ctgttttcgcaaatctatggactattgctat	CRISPR spacer
cagttttcgcaaatcaatggactacaaacct	Protospacer
* ************* ********. . . *

14. spacer 5.4|2913202|31|CP023834|CRISPRCasFinder matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

tggctctgcaacagcagcacccatgaccacg	CRISPR spacer
catcactgcaacatcagcatccatgaccgca	Protospacer
.. * ******** *****.********.*.

15. spacer 5.14|2913202|33|CP023834|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

tggctctgcaacagcagcacccatgaccacgtc	CRISPR spacer
cgctccagcaacagcagcacccacgaccacgga	Protospacer
.* ..* ****************.*******  

16. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

17. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

18. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

19. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

20. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

21. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

22. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

23. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

24. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

25. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

26. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

27. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

28. spacer 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

29. spacer 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

30. spacer 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

31. spacer 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

32. spacer 4.6|2887073|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

33. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 9, identity: 0.727

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
cgaggcggcgacacgcaaggtatgcgggtcgag	Protospacer
  **********.****.******** * .  *

34. spacer 5.5|2913263|31|CP023834|CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 9, identity: 0.71

gaaatactggtgagcgttaatgccgcaaaca	CRISPR spacer
cggcacttggggagcgttaatgctgcaaaca	Protospacer
 ..   .*** ************.*******

35. spacer 5.5|2913263|31|CP023834|CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 9, identity: 0.71

gaaatactggtgagcgttaatgccgcaaaca	CRISPR spacer
cggcacttggagagcgttaatgctgcaaaca	Protospacer
 ..   .*** ************.*******

36. spacer 1.1|424316|59|CP023834|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg-	CRISPR spacer
gagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgat-cgtgcactga	Protospacer
*.   ************ ****************************.**  **** *.* 

37. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

38. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

39. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

40. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

41. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

42. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

43. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga--	CRISPR spacer
cacaagtgccggatgcggcgtaaacgccttatccggcctacg--ccagact	Protospacer
. *..***********.****.********************  .*.**  

44. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gctggttgccggatgcggcgtgaacgccttatccggcctacattcggca	Protospacer
 *.** **********.************************. .. * *

45. spacer 4.7|2887134|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_002580 (Propionibacterium freudenreichii plasmid p545, complete sequence) position: , mismatch: 10, identity: 0.688

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
ccagcggcttgcgtggcagccagctctcaggg	Protospacer
. .********* * ***********. . .*

46. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
gcgtgtgctggcaatcgcttccggggtgacgt	Protospacer
. *.  ********** ***.********  .

47. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053984 (Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

48. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_010935 (Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

49. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to JX469826 (Uncultured bacterium plasmid pB12, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

50. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

51. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_016968 (Comamonas testosteroni plasmid pTB30, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

52. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

53. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

54. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053554 (Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

55. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_019263 (Delftia acidovorans plasmid pLME1, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

56. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_019264 (Delftia acidovorans plasmid pNB8c, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

57. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_019283 (Delftia acidovorans plasmid pC1-1, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

58. spacer 4.8|2887195|32|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

59. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to CP046443 (Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

60. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963392 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

61. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963392 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

62. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034079 (Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

63. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034080 (Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

64. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NC_005918 (Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

65. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047262 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

66. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026560 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

67. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963406 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

68. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to LT985193 (Pseudomonas syringae strain CFBP 2116 genome assembly, plasmid: PP2) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

69. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963393 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

70. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985210 (Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

71. spacer 4.10|2887317|33|CP023834|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985211 (Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

72. spacer 5.5|2913263|31|CP023834|CRISPRCasFinder matches to MT840185 (Bacteriophage sp. Joined_contig_19 genomic sequence) position: , mismatch: 10, identity: 0.677

gaaatactggtgagcgttaatgccgcaaaca	CRISPR spacer
accatacttgtgagcattaatgccgccgcac	Protospacer
.  ***** ******.********** .   

73. spacer 5.5|2913263|31|CP023834|CRISPRCasFinder matches to KF356199 (Microcystis phage MaMV-DC, complete genome) position: , mismatch: 10, identity: 0.677

gaaatactggtgagcgttaatgccgcaaaca	CRISPR spacer
accatacttgtgagcattaatgccgccgcac	Protospacer
.  ***** ******.********** .   

74. spacer 5.5|2913263|31|CP023834|CRISPRCasFinder matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 10, identity: 0.677

gaaatactggtgagcgttaatgccgcaaaca	CRISPR spacer
accatacttgtgagcattaatgccgccgcac	Protospacer
.  ***** ******.********** .   

75. spacer 1.1|424316|59|CP023834|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

-ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg	CRISPR spacer
tcgcacca-aaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgtacc	Protospacer
  *..*** ***********************.**************** ***.  * * 

76. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

77. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

78. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

79. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

80. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

81. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

82. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

83. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

84. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

85. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

86. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

87. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

88. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagc	Protospacer
. *.. .*********.************************** * .* 

89. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagt	Protospacer
. *.. .*********.************************** * .* 

90. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agctggtgccggatgcggcgtaaacgccttatccggcctacaaatgcgc	Protospacer
  * ************.****.*******************.. *  * 

91. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggtgtgaacgccttatccggcctacggatggcc	Protospacer
* .  .**********.*.************************ * *  

92. spacer 5.15|2913263|33|CP023834|CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

gaaatactggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggggagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

93. spacer 5.15|2913263|33|CP023834|CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

gaaatactggtgagcgttaatgccgcaaacaca	CRISPR spacer
cggcacttggagagcgttaatgctgcaaacaat	Protospacer
 ..   .*** ************.*******  

94. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

95. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

96. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

97. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

98. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

99. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

100. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

101. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

102. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

103. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

104. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

105. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

106. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
aatttttgccggatgcggcgtgaacgccttatccggcctacaacgggca	Protospacer
  .   **********.************************..*  * *

107. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga---	CRISPR spacer
cacaattgccggatgcggcgtaaacgccttatccggcctaca---tggataa	Protospacer
. *.. **********.****.*******************.   .***   

108. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttttcttgccggatgcggcgtaaacgccttatccggcctacaggacgtg	Protospacer
*..   **********.****.*******************.*  ** .

109. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ctcaaatgccggatgcggcgtgaacgccttatccggcctacgcacacta	Protospacer
..*...**********.*************************  .   *

110. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agcaaatgccggatgcggcgtaaacgccttatccggcctacatttggca	Protospacer
  *...**********.****.*******************. .* * *

111. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

112. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

113. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to MF374379 (Escherichia phage DN1, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtgaacgccttatccggcctacaaaccgcg	Protospacer
* .  .**********.************************.. .** .

114. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gttgattgccggatgcggcgtaaacgccttatccggcctacattcggca	Protospacer
 ..*. **********.****.*******************. .. * *

115. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttgttttgccggatgcggcgtgaacgccttatccggcctacaaaaccat	Protospacer
*.    **********.************************..  * . 

116. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtgtttgccggatgcggcgtgaacgccttatccgacctacgtgtgacg	Protospacer
  .*  **********.******************.******  * . .

117. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttatgttgccggatgcggcgtaaacgccttatccggcctacaaaagcaa	Protospacer
*.  * **********.****.*******************..    .*

118. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gtaaaatgccggatgcggcgtgaacgccttatccggcctacaaaccaag	Protospacer
 . ...**********.************************.. .*...

119. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acaaaatgccggatgcggcgtaaacgccttatccggcctacaaaatcgt	Protospacer
 * ...**********.****.*******************..  . * 

120. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

121. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

122. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

123. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtaaacgccttatccggcctacaaaaagcg	Protospacer
* .  .**********.****.*******************..   * .

124. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

125. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtcaatgccggatgcggcgtgaacgccttatccggcctacaaaagcat	Protospacer
  . ..**********.************************..    . 

126. spacer 3.1|2392359|49|CP023834|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtaaacgccttatccggcctacaaaaaacg	Protospacer
. * . **********.****.*******************..   . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 201313 : 274156 59 Emiliania_huxleyi_virus(11.11%) plate,transposase,tRNA,protease NA
DBSCAN-SWA_2 1191954 : 1247996 67 Escherichia_phage(44.68%) tail,head,integrase,tRNA,holin,portal,capsid,terminase attL 1187049:1187063|attR 1193529:1193543
DBSCAN-SWA_3 2866129 : 2879312 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_4 4141235 : 4206490 74 Escherichia_phage(54.17%) tail,plate,head,integrase,lysis,tRNA,transposase,holin,portal,capsid,terminase attL 4132760:4132775|attR 4184723:4184738
DBSCAN-SWA_5 4576694 : 4655379 68 Enterobacteria_phage(36.67%) integrase,tRNA,protease,transposase,holin attL 4624929:4624945|attR 4631513:4631529
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage