Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024959 Bifidobacterium adolescentis strain P2P3 chromosome, complete genome 1 crisprs WYL,csa3,DEDDh 1 0 1 0

Results visualization

1. CP024959
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024959_3 1643087-1643255 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP024959_2 2.1|1167941|33|CP024959|CRISPRCasFinder 1167941-1167973 33 CP024959.1 1416800-1416832 0 1.0

1. spacer 2.1|1167941|33|CP024959|CRISPRCasFinder matches to position: 1416800-1416832, mismatch: 0, identity: 1.0

gcgatatgccaaaacgcatggcccattcaccgc	CRISPR spacer
gcgatatgccaaaacgcatggcccattcaccgc	Protospacer
*********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 862232 : 872844 12 Bifidobacterium_phage(77.78%) tail,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage