Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034164 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence 0 crisprs NA 0 0 0 0
CP034165 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-1, complete sequence 0 crisprs NA 0 0 0 0
CP034167 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence 0 crisprs NA 0 0 0 0
CP034166 Escherichia albertii strain 2014C-4015 chromosome, complete genome 6 crisprs NA 5 6 0 0

Results visualization

1. CP034164
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP034166
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034166_1 1004154-1004298 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034166_2 1091016-1091155 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034166_3 1413708-1413922 Orphan I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034166_4 1439747-1439830 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034166_5 3108182-3108315 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034166_6 4292570-4292755 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 CP034164.1 2174-2205 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 CP034164.1 2176-2205 0 1.0
CP034166_6 6.1|4292594|39|CP034166|PILER-CR 4292594-4292632 39 CP034166.1 550490-550528 1 0.974
CP034166_6 6.1|4292594|39|CP034166|PILER-CR 4292594-4292632 39 CP034166.1 679903-679941 1 0.974
CP034166_6 6.1|4292594|39|CP034166|PILER-CR 4292594-4292632 39 CP034166.1 1281206-1281244 1 0.974
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 CP034164.1 73143-73175 2 0.939
CP034166_6 6.2|4292657|75|CP034166|PILER-CR 4292657-4292731 75 CP034166.1 550391-550465 16 0.787
CP034166_6 6.2|4292657|75|CP034166|PILER-CR 4292657-4292731 75 CP034166.1 679804-679878 16 0.787
CP034166_6 6.2|4292657|75|CP034166|PILER-CR 4292657-4292731 75 CP034166.1 1281107-1281181 16 0.787
CP034166_6 6.2|4292657|75|CP034166|PILER-CR 4292657-4292731 75 CP034166.1 3809699-3809773 16 0.787

1. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to position: 2174-2205, mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

2. spacer 3.5|1413862|30|CP034166|PILER-CR matches to position: 2176-2205, mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

3. spacer 6.1|4292594|39|CP034166|PILER-CR matches to position: 550490-550528, mismatch: 1, identity: 0.974

aggggtgaacggggagagaccggtctgacgggaagtaca	CRISPR spacer
aggggagaacggggagagaccggtctgacgggaagtaca	Protospacer
***** *********************************

4. spacer 6.1|4292594|39|CP034166|PILER-CR matches to position: 679903-679941, mismatch: 1, identity: 0.974

aggggtgaacggggagagaccggtctgacgggaagtaca	CRISPR spacer
aggggggaacggggagagaccggtctgacgggaagtaca	Protospacer
***** *********************************

5. spacer 6.1|4292594|39|CP034166|PILER-CR matches to position: 1281206-1281244, mismatch: 1, identity: 0.974

aggggtgaacggggagagaccggtctgacgggaagtaca	CRISPR spacer
aggggagaacggggagagaccggtctgacgggaagtaca	Protospacer
***** *********************************

6. spacer 3.1|1413737|33|CP034166|CRT matches to position: 73143-73175, mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaactccgccga	Protospacer
****************.******** *******

7. spacer 6.2|4292657|75|CP034166|PILER-CR matches to position: 550391-550465, mismatch: 16, identity: 0.787

actggtgcagcaggcccggcaggcccacagggaccgaaaggagaaacaggagcggcaggt	CRISPR spacer
accggtgcagcaggcccggcaggcccacagggaccgaaaggagaaacaggagcggcaggt	Protospacer
**.*********************************************************

8. spacer 6.2|4292657|75|CP034166|PILER-CR matches to position: 679804-679878, mismatch: 16, identity: 0.787

actggtgcagcaggcccggcaggcccacagggaccgaaaggagaaacaggagcggcaggt	CRISPR spacer
accggtgcagcaggcccggcaggcccacagggaccgaaaggagaaacaggagcggcaggt	Protospacer
**.*********************************************************

9. spacer 6.2|4292657|75|CP034166|PILER-CR matches to position: 1281107-1281181, mismatch: 16, identity: 0.787

actggtgcagcaggcccggcaggcccacagggaccgaaaggagaaacaggagcggcaggt	CRISPR spacer
accggtgcagcaggcccggcaggcccacagggaccgaaaggagaaacaggagcggcaggt	Protospacer
**.*********************************************************

10. spacer 6.2|4292657|75|CP034166|PILER-CR matches to position: 3809699-3809773, mismatch: 16, identity: 0.787

actggtgcagcaggcccggcaggcccacagggaccgaaaggagaaacaggagcggcaggt	CRISPR spacer
accggtgcagcaggcccggcaggcccacagggaccgaaaggagaaacaggagcggcaggt	Protospacer
**.*********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_KX880944 Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence 8078-8110 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_KU980950 Escherichia coli strain WE-0250 plasmid U2501, complete sequence 21184-21216 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP010146 Escherichia coli strain D5 plasmid A, complete genome 53017-53049 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP043218 Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence 8314-8346 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP019188 Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence 25890-25922 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP034959 Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence 8314-8346 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP020522 Escherichia coli strain 190 plasmid unnamed3, complete sequence 30150-30182 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP047090 Salmonella sp. S13 plasmid pS13-1, complete sequence 89470-89502 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP015997 Escherichia coli strain S51 plasmid pS51_2, complete sequence 75930-75962 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 MN232192 Escherichia coli plasmid pGD27-62, complete sequence 37541-37573 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 208-240 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP009051 Escherichia coli NCCP15648 plasmid p15648-1, complete sequence 49922-49954 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 88829-88861 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 111882-111914 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP039843 Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1 17830-17862 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP035313 Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence 32634-32666 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP029103 Escherichia coli strain AR437 plasmid unnamed1, complete sequence 4398-4430 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP031232 Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_2, complete sequence 26138-26170 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP023896 Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence 2418-2450 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 83209-83241 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP046005 Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence 2394-2426 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP023381 Escherichia coli strain 127 plasmid p91, complete sequence 8314-8346 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 MF510496 Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence 39229-39261 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP052881 Escherichia coli strain C21 plasmid pC21-4, complete sequence 9051-9083 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP016549 Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence 39267-39299 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP016549 Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence 125701-125733 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_LT985263 Escherichia coli strain 511 plasmid RCS54_p, complete sequence 94140-94172 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP031654 Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence 8314-8346 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MK419152 Escherichia coli strain D72C plasmid pD72C, complete sequence 111003-111035 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MK410117 Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence 8415-8447 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MK455768 Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence 8415-8447 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 56169-56201 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MH580301 Escherichia coli strain 1107 plasmid p1107-99K, complete sequence 93246-93278 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MH781719 Klebsiella pneumoniae strain SCKLB684 plasmid pSCKLB684-mcr, complete sequence 8214-8246 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MK256965 Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence 8150-8182 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MG196293 Escherichia coli strain SDX5C133 plasmid pHNSD133T1, complete sequence 105922-105954 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MG825379 Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence 9835-9867 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MG288678 Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence 9051-9083 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP027199 Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence 8314-8346 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 39553-39584 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_KX518745 Escherichia coli strain HYEC7 plasmid pHYEC7-mcr1, complete sequence 36030-36061 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 119567-119598 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_KX880944 Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence 40907-40938 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 20364-20395 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_KU980950 Escherichia coli strain WE-0250 plasmid U2501, complete sequence 91151-91182 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP045829 Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence 43889-43920 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 45303-45334 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 CP054337 Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence 85772-85803 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP043218 Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence 25770-25801 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP019188 Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence 92540-92571 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP034163 Escherichia albertii strain 06-3542 plasmid p06-3542, complete sequence 52838-52869 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_LT905089 Salmonella enterica subsp. enterica serovar Typhi strain ty3-243 genome assembly, plasmid: 1 22365-22396 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP034959 Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence 36108-36139 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP020522 Escherichia coli strain 190 plasmid unnamed3, complete sequence 2578-2609 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP047090 Salmonella sp. S13 plasmid pS13-1, complete sequence 58032-58063 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_LR130557 Escherichia coli strain MS14385 isolate MS14385 plasmid 3 38088-38119 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP026725 Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence 38057-38088 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP021729 Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence 17260-17291 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP015997 Escherichia coli strain S51 plasmid pS51_2, complete sequence 6243-6274 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP029244 Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence 46160-46191 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 MN232192 Escherichia coli plasmid pGD27-62, complete sequence 65356-65387 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 64670-64701 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 53033-53064 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP021336 Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence 53034-53065 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP009051 Escherichia coli NCCP15648 plasmid p15648-1, complete sequence 20568-20599 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 118695-118726 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP030183 Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence 35793-35824 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP027133 Escherichia coli strain AR_0372 plasmid unnamed4 2352-2383 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 48839-48870 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP038378 Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence 25642-25673 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 48006-48037 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 119390-119421 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP039843 Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1 88929-88960 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 16610-16641 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 37191-37222 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP035313 Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence 1196-1227 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 LC511659 Escherichia coli 2017.15.03CC plasmid p2017.15.03CC DNA, complete genome 35966-35997 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP021203 Escherichia coli strain Z1002 plasmid p1002-1, complete sequence 23745-23776 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 62578-62609 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP022733 Escherichia coli strain SA186 plasmid pSA186_4, complete sequence 30341-30372 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP029103 Escherichia coli strain AR437 plasmid unnamed1, complete sequence 66248-66279 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_AP018809 Escherichia coli strain E2865 plasmid pE2865-1, complete sequence 21733-21764 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 45546-45577 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 35606-35637 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 95383-95414 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP032239 Escherichia coli strain ECCWS199 plasmid pTB222, complete sequence 72082-72113 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP023896 Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence 65603-65634 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 56259-56290 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP009168 Escherichia coli 1303 plasmid p1303_95, complete sequence 35565-35596 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP046005 Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence 72694-72725 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 95481-95512 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP023381 Escherichia coli strain 127 plasmid p91, complete sequence 33305-33336 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 91441-91472 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP013030 Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence 23117-23148 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 MF510496 Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence 70387-70418 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP030784 Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence 67142-67173 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP052881 Escherichia coli strain C21 plasmid pC21-4, complete sequence 37335-37366 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP040069 Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence 33788-33819 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 83819-83850 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP034164 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence 2174-2205 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 12651-12682 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 30347-30378 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NC_017653 Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence 23079-23110 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP019054 Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence 97475-97506 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 96286-96317 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP028125 Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence 68464-68495 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP041630 Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence 36033-36064 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 18639-18670 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP041922 Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence 32136-32167 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 84431-84462 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 20223-20254 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP033882 Escherichia coli strain 50579417 plasmid p50579417_1, complete sequence 2262-2293 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP033848 Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence 14306-14337 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP026938 Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence 21083-21114 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 70758-70789 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 20246-20277 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 42279-42310 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP037905 Escherichia coli strain LHM10-1 plasmid unnamed2, complete sequence 42022-42053 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_LT985263 Escherichia coli strain 511 plasmid RCS54_p, complete sequence 67035-67066 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP031654 Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence 36108-36139 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MK419152 Escherichia coli strain D72C plasmid pD72C, complete sequence 46124-46155 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MK410117 Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence 37723-37754 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MK455768 Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence 37705-37736 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 25446-25477 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 23894-23925 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 20544-20575 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MH844525 Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence 72963-72994 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MH580301 Escherichia coli strain 1107 plasmid p1107-99K, complete sequence 63811-63842 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MH781719 Klebsiella pneumoniae strain SCKLB684 plasmid pSCKLB684-mcr, complete sequence 36339-36370 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MK256965 Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence 36076-36107 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MG196293 Escherichia coli strain SDX5C133 plasmid pHNSD133T1, complete sequence 76315-76346 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MG825383 Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence 92989-93020 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MG825379 Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence 39503-39534 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_MG288678 Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence 40209-40240 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 89464-89495 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 20414-20445 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP027199 Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence 34085-34116 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP038288 Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence 35999-36030 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 MH160767 Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome 19182-19213 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 AF234173 Enterobacteria phage P1 mod1902::IS5 c1.100 rev dmt(del)MB mutant, complete genome 25884-25915 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 MH422554 Escherichia phage P1, complete genome 18772-18803 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NC_050152 Enterobacteria phage P7, complete genome 29023-29054 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NC_005856 Enterobacteria phage P1, complete genome 25884-25915 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 119645-119676 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NC_042128 Escherichia phage RCS47, complete genome 29485-29516 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 AJ000741 Bacteriophage P1 darA operon 6332-6363 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NC_031129 Salmonella phage SJ46, complete genome 41193-41224 0 1.0
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 AF234172 Enterobacteria phage P1 mod749::IS5 c1.100 mutant, complete genome 25884-25915 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_KX518745 Escherichia coli strain HYEC7 plasmid pHYEC7-mcr1, complete sequence 36032-36061 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_KX880944 Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence 40909-40938 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP045829 Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence 43891-43920 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP043218 Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence 25772-25801 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP034163 Escherichia albertii strain 06-3542 plasmid p06-3542, complete sequence 52840-52869 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_LT905089 Salmonella enterica subsp. enterica serovar Typhi strain ty3-243 genome assembly, plasmid: 1 22367-22396 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP034959 Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence 36110-36139 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_LR130557 Escherichia coli strain MS14385 isolate MS14385 plasmid 3 38090-38119 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP026725 Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence 38059-38088 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP021729 Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence 17262-17291 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP015997 Escherichia coli strain S51 plasmid pS51_2, complete sequence 6245-6274 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 MN232192 Escherichia coli plasmid pGD27-62, complete sequence 65358-65387 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 118697-118726 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP030183 Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence 35795-35824 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP027133 Escherichia coli strain AR_0372 plasmid unnamed4 2354-2383 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 48841-48870 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP038378 Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence 25644-25673 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 48008-48037 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 119392-119421 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 LC511659 Escherichia coli 2017.15.03CC plasmid p2017.15.03CC DNA, complete genome 35968-35997 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP021203 Escherichia coli strain Z1002 plasmid p1002-1, complete sequence 23747-23776 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 62580-62609 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP022733 Escherichia coli strain SA186 plasmid pSA186_4, complete sequence 30343-30372 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 35608-35637 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP009168 Escherichia coli 1303 plasmid p1303_95, complete sequence 35567-35596 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP023381 Escherichia coli strain 127 plasmid p91, complete sequence 33307-33336 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP013030 Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence 23119-23148 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 MF510496 Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence 70389-70418 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP052881 Escherichia coli strain C21 plasmid pC21-4, complete sequence 37337-37366 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP040069 Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence 33790-33819 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 83821-83850 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP034164 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence 2176-2205 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 12653-12682 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP041630 Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence 36035-36064 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP041922 Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence 32138-32167 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 20225-20254 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP033882 Escherichia coli strain 50579417 plasmid p50579417_1, complete sequence 2264-2293 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP033848 Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence 14308-14337 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP026938 Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence 21085-21114 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 42281-42310 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP031654 Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence 36110-36139 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MK419152 Escherichia coli strain D72C plasmid pD72C, complete sequence 46126-46155 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MK410117 Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence 37725-37754 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MK455768 Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence 37707-37736 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MH844525 Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence 72965-72994 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MH781719 Klebsiella pneumoniae strain SCKLB684 plasmid pSCKLB684-mcr, complete sequence 36341-36370 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MK256965 Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence 36078-36107 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MG825383 Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence 92991-93020 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MG825379 Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence 39505-39534 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MG288678 Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence 40211-40240 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP027199 Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence 34087-34116 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP038288 Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence 36001-36030 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 AJ000741 Bacteriophage P1 darA operon 6334-6363 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NC_031129 Salmonella phage SJ46, complete genome 41195-41224 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 39553-39582 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 119567-119596 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 20364-20393 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_KU980950 Escherichia coli strain WE-0250 plasmid U2501, complete sequence 91151-91180 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 45303-45332 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 CP054337 Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence 85772-85801 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP019188 Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence 92540-92569 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP020522 Escherichia coli strain 190 plasmid unnamed3, complete sequence 2578-2607 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP047090 Salmonella sp. S13 plasmid pS13-1, complete sequence 58032-58061 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP029244 Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence 46160-46189 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 64670-64699 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 53033-53062 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP021336 Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence 53034-53063 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP009051 Escherichia coli NCCP15648 plasmid p15648-1, complete sequence 20568-20597 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP039843 Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1 88929-88958 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 16610-16639 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 37191-37220 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP035313 Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence 1196-1225 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP029103 Escherichia coli strain AR437 plasmid unnamed1, complete sequence 66248-66277 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_AP018809 Escherichia coli strain E2865 plasmid pE2865-1, complete sequence 21733-21762 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 45546-45575 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 95383-95412 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP032239 Escherichia coli strain ECCWS199 plasmid pTB222, complete sequence 72082-72111 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP023896 Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence 65603-65632 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 56259-56288 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP046005 Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence 72694-72723 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 95481-95510 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 91441-91470 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP030784 Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence 67142-67171 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 30347-30376 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NC_017653 Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence 23079-23108 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP019054 Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence 97475-97504 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 96286-96315 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP028125 Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence 68464-68493 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 18639-18668 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 84431-84460 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 70758-70787 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 20246-20275 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP037905 Escherichia coli strain LHM10-1 plasmid unnamed2, complete sequence 42022-42051 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_LT985263 Escherichia coli strain 511 plasmid RCS54_p, complete sequence 67035-67064 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 25446-25475 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 23894-23923 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 20544-20573 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MH580301 Escherichia coli strain 1107 plasmid p1107-99K, complete sequence 63811-63840 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_MG196293 Escherichia coli strain SDX5C133 plasmid pHNSD133T1, complete sequence 76315-76344 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 89464-89493 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 20414-20443 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 MH160767 Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome 19182-19211 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 AF234173 Enterobacteria phage P1 mod1902::IS5 c1.100 rev dmt(del)MB mutant, complete genome 25884-25913 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 MH422554 Escherichia phage P1, complete genome 18772-18801 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NC_050152 Enterobacteria phage P7, complete genome 29023-29052 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NC_005856 Enterobacteria phage P1, complete genome 25884-25913 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 119645-119674 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NC_042128 Escherichia phage RCS47, complete genome 29485-29514 0 1.0
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 AF234172 Enterobacteria phage P1 mod749::IS5 c1.100 mutant, complete genome 25884-25913 0 1.0
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP029493 Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence 9066-9098 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP010234 Escherichia coli strain S30 plasmid C, complete sequence 50564-50596 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP044294 Escherichia coli strain P276M plasmid p276M-CTX-M-55, complete sequence 14020-14052 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP010173 Escherichia coli strain H8 plasmid A, complete sequence 31306-31338 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP021846 Escherichia coli strain EC1515 plasmid pEC1515-2, complete sequence 49816-49848 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP019262 Escherichia coli strain 13C1065T plasmid p13C1065T-3, complete sequence 92444-92476 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP029244 Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence 115495-115527 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP021842 Escherichia coli strain EC974 plasmid pEC974-2, complete sequence 15388-15420 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP030183 Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence 8150-8182 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP038378 Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence 97832-97864 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 62334-62366 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP022733 Escherichia coli strain SA186 plasmid pSA186_4, complete sequence 355-387 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_AP018809 Escherichia coli strain E2865 plasmid pE2865-1, complete sequence 48018-48050 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP019216 Escherichia coli strain WCHEC050613 plasmid p2_050613, complete sequence 62569-62601 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 22131-22163 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP023732 Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence 17788-17820 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP009168 Escherichia coli 1303 plasmid p1303_95, complete sequence 8413-8445 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 23699-23731 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP013030 Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence 95728-95760 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP020936 Escherichia coli strain HB-Coli0 plasmid unnamed3, complete sequence 32298-32330 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 67496-67528 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP040069 Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence 8150-8182 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 57739-57771 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 151887-151919 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP034789 Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence 101167-101199 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NC_017653 Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence 49811-49843 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP029688 Escherichia coli strain E706 plasmid pLKJULY7989, complete sequence 142798-142830 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP019054 Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence 9524-9556 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP028125 Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence 93601-93633 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP041630 Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence 8149-8181 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 86491-86523 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP026938 Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence 92392-92424 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 3310-3342 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 45401-45433 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_MG825383 Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence 113279-113311 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_KY887590 Escherichia coli strain Ec9 plasmid pEc9, complete sequence 169445-169477 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 23192-23224 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP038288 Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence 9692-9724 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 MH160767 Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome 44321-44353 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 MH422554 Escherichia phage P1, complete genome 47382-47414 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 18833-18865 1 0.97
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 MH445381 Escherichia virus P1, complete genome 17058-17090 1 0.97
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP010173 Escherichia coli strain H8 plasmid A, complete sequence 3684-3715 1 0.969
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP041960 Escherichia coli strain EC2 plasmid pEC2_5, complete sequence 39872-39903 1 0.969
CP034166_3 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder 1413860-1413891 32 NZ_CP023732 Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence 83615-83646 1 0.969
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP041960 Escherichia coli strain EC2 plasmid pEC2_5, complete sequence 39874-39903 1 0.967
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP010173 Escherichia coli strain H8 plasmid A, complete sequence 3684-3713 1 0.967
CP034166_3 3.5|1413862|30|CP034166|PILER-CR 1413862-1413891 30 NZ_CP023732 Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence 83615-83644 1 0.967
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 66547-66579 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP026237 Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence 166911-166943 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP021729 Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence 88051-88083 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 40115-40147 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 36358-36390 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 390089-390121 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP010154 Escherichia coli strain D9 plasmid B, complete genome 47804-47836 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP033095 Escherichia coli strain CP53 plasmid pCP53-92k, complete sequence 83983-84015 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP030784 Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence 97622-97654 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP034164 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence 73143-73175 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP047574 Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence 22915-22947 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 401759-401791 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP041922 Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence 2717-2749 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP033848 Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence 81831-81863 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP021734 Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence 24516-24548 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NC_050152 Enterobacteria phage P7, complete genome 57004-57036 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NC_042128 Escherichia phage RCS47, complete genome 59371-59403 2 0.939
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NC_031129 Salmonella phage SJ46, complete genome 12197-12229 2 0.939
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065675 UNVERIFIED: Campylobacter phage A118, complete genome 10442-10473 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065687 UNVERIFIED: Campylobacter phage A136, complete genome 33530-33561 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065667 UNVERIFIED: Campylobacter phage A127, complete genome 34854-34885 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065671 UNVERIFIED: Campylobacter phage A120, complete genome 42545-42576 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 NC_049823 Escherichia phage herni, complete genome 11950-11981 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065679 UNVERIFIED: Campylobacter phage A13a, complete genome 18095-18126 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065665 UNVERIFIED: Campylobacter phage A131, complete genome 33366-33397 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065685 UNVERIFIED: Campylobacter phage A112a, complete genome 13847-13878 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 NC_049821 Salmonella phage slyngel, complete genome 39562-39593 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MK373798 Escherichia phage vB_EcoS_G29-2, complete genome 45904-45935 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065663 UNVERIFIED: Campylobacter phage A134, complete genome 33366-33397 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065670 UNVERIFIED: Campylobacter phage A121, complete genome 26793-26824 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065638 UNVERIFIED: Campylobacter phage A15a, complete genome 9750-9781 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 NC_049830 Escherichia phage PGN590, complete genome 13832-13863 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MN850607 Escherichia phage egaa, complete genome 6672-6703 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065640 UNVERIFIED: Campylobacter phage A14b, complete genome 2233-2264 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MN850600 Escherichia phage haarsle, complete genome 42921-42952 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065673 UNVERIFIED: Campylobacter phage A119, complete genome 26576-26607 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065641 UNVERIFIED: Campylobacter phage A14a, complete genome 28683-28714 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065669 UNVERIFIED: Campylobacter phage A123, complete genome 10426-10457 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MT360681 Shigella virus 2019SD1, complete genome 38097-38128 5 0.844
CP034166_3 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder 1413799-1413830 32 MG065636 UNVERIFIED: Campylobacter phage A16a, complete genome 26252-26283 5 0.844
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065667 UNVERIFIED: Campylobacter phage A127, complete genome 34854-34883 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065685 UNVERIFIED: Campylobacter phage A112a, complete genome 13847-13876 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 NC_049830 Escherichia phage PGN590, complete genome 13832-13861 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MN850607 Escherichia phage egaa, complete genome 6672-6701 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065673 UNVERIFIED: Campylobacter phage A119, complete genome 26576-26605 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MT360681 Shigella virus 2019SD1, complete genome 38097-38126 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065675 UNVERIFIED: Campylobacter phage A118, complete genome 10444-10473 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065687 UNVERIFIED: Campylobacter phage A136, complete genome 33532-33561 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065671 UNVERIFIED: Campylobacter phage A120, complete genome 42547-42576 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 NC_049823 Escherichia phage herni, complete genome 11952-11981 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065679 UNVERIFIED: Campylobacter phage A13a, complete genome 18097-18126 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065665 UNVERIFIED: Campylobacter phage A131, complete genome 33368-33397 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 NC_049821 Salmonella phage slyngel, complete genome 39564-39593 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MK373798 Escherichia phage vB_EcoS_G29-2, complete genome 45906-45935 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065663 UNVERIFIED: Campylobacter phage A134, complete genome 33368-33397 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065670 UNVERIFIED: Campylobacter phage A121, complete genome 26795-26824 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065638 UNVERIFIED: Campylobacter phage A15a, complete genome 9752-9781 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065640 UNVERIFIED: Campylobacter phage A14b, complete genome 2235-2264 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MN850600 Escherichia phage haarsle, complete genome 42923-42952 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065641 UNVERIFIED: Campylobacter phage A14a, complete genome 28685-28714 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065669 UNVERIFIED: Campylobacter phage A123, complete genome 10428-10457 5 0.833
CP034166_3 3.4|1413801|30|CP034166|PILER-CR 1413801-1413830 30 MG065636 UNVERIFIED: Campylobacter phage A16a, complete genome 26254-26283 5 0.833
CP034166_3 3.1|1413737|33|CP034166|CRT 1413737-1413769 33 NZ_CP018781 Ochrobactrum pituitosum strain AA2 plasmid pOAAA2, complete sequence 262003-262035 6 0.818
CP034166_2 2.1|1091059|54|CP034166|CRISPRCasFinder 1091059-1091112 54 NZ_CP019906 Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence 2754-2807 12 0.778
CP034166_2 2.1|1091059|54|CP034166|CRISPRCasFinder 1091059-1091112 54 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24815-24868 12 0.778

1. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_KX880944 (Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

2. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_KU980950 (Escherichia coli strain WE-0250 plasmid U2501, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

3. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP010146 (Escherichia coli strain D5 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

4. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP043218 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

5. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP019188 (Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

6. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP034959 (Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

7. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP020522 (Escherichia coli strain 190 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

8. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP047090 (Salmonella sp. S13 plasmid pS13-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

9. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP015997 (Escherichia coli strain S51 plasmid pS51_2, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

10. spacer 3.1|1413737|33|CP034166|CRT matches to MN232192 (Escherichia coli plasmid pGD27-62, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

11. spacer 3.1|1413737|33|CP034166|CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

12. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP009051 (Escherichia coli NCCP15648 plasmid p15648-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

13. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

14. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

15. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP039843 (Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

16. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP035313 (Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

17. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP029103 (Escherichia coli strain AR437 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

18. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP031232 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_2, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

19. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP023896 (Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

20. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

21. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP046005 (Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

22. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP023381 (Escherichia coli strain 127 plasmid p91, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

23. spacer 3.1|1413737|33|CP034166|CRT matches to MF510496 (Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

24. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP052881 (Escherichia coli strain C21 plasmid pC21-4, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

25. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP016549 (Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

26. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP016549 (Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

27. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_LT985263 (Escherichia coli strain 511 plasmid RCS54_p, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

28. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP031654 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

29. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MK419152 (Escherichia coli strain D72C plasmid pD72C, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

30. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MK410117 (Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

31. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MK455768 (Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

32. spacer 3.1|1413737|33|CP034166|CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

33. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MH580301 (Escherichia coli strain 1107 plasmid p1107-99K, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

34. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MH781719 (Klebsiella pneumoniae strain SCKLB684 plasmid pSCKLB684-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

35. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MK256965 (Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

36. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MG196293 (Escherichia coli strain SDX5C133 plasmid pHNSD133T1, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

37. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MG825379 (Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

38. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MG288678 (Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

39. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP027199 (Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccga	Protospacer
*********************************

40. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

41. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_KX518745 (Escherichia coli strain HYEC7 plasmid pHYEC7-mcr1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

42. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

43. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_KX880944 (Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

44. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

45. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_KU980950 (Escherichia coli strain WE-0250 plasmid U2501, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

46. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP045829 (Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

47. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

48. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

49. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP043218 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

50. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP019188 (Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

51. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP034163 (Escherichia albertii strain 06-3542 plasmid p06-3542, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

52. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_LT905089 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-243 genome assembly, plasmid: 1) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

53. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP034959 (Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

54. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP020522 (Escherichia coli strain 190 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

55. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP047090 (Salmonella sp. S13 plasmid pS13-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

56. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_LR130557 (Escherichia coli strain MS14385 isolate MS14385 plasmid 3) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

57. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP026725 (Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

58. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP021729 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

59. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP015997 (Escherichia coli strain S51 plasmid pS51_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

60. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP029244 (Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

61. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to MN232192 (Escherichia coli plasmid pGD27-62, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

62. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

63. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP021340 (Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

64. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP021336 (Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

65. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP009051 (Escherichia coli NCCP15648 plasmid p15648-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

66. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

67. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP030183 (Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

68. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP027133 (Escherichia coli strain AR_0372 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

69. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

70. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP038378 (Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

71. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

72. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

73. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP039843 (Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

74. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

75. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

76. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP035313 (Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

77. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to LC511659 (Escherichia coli 2017.15.03CC plasmid p2017.15.03CC DNA, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

78. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP021203 (Escherichia coli strain Z1002 plasmid p1002-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

79. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

80. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP022733 (Escherichia coli strain SA186 plasmid pSA186_4, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

81. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP029103 (Escherichia coli strain AR437 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

82. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_AP018809 (Escherichia coli strain E2865 plasmid pE2865-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

83. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

84. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

85. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

86. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP032239 (Escherichia coli strain ECCWS199 plasmid pTB222, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

87. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP023896 (Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

88. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

89. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP009168 (Escherichia coli 1303 plasmid p1303_95, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

90. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP046005 (Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

91. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

92. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP023381 (Escherichia coli strain 127 plasmid p91, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

93. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

94. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP013030 (Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

95. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to MF510496 (Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

96. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP030784 (Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

97. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP052881 (Escherichia coli strain C21 plasmid pC21-4, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

98. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP040069 (Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

99. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

100. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP034164 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

101. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

102. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

103. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NC_017653 (Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

104. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP019054 (Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

105. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

106. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP028125 (Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

107. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP041630 (Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

108. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

109. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP041922 (Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

110. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

111. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

112. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP033882 (Escherichia coli strain 50579417 plasmid p50579417_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

113. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP033848 (Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

114. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP026938 (Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

115. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

116. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

117. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

118. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP037905 (Escherichia coli strain LHM10-1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

119. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_LT985263 (Escherichia coli strain 511 plasmid RCS54_p, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

120. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP031654 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

121. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MK419152 (Escherichia coli strain D72C plasmid pD72C, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

122. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MK410117 (Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

123. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MK455768 (Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

124. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

125. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

126. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

127. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MH844525 (Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

128. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MH580301 (Escherichia coli strain 1107 plasmid p1107-99K, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

129. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MH781719 (Klebsiella pneumoniae strain SCKLB684 plasmid pSCKLB684-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

130. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MK256965 (Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

131. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MG196293 (Escherichia coli strain SDX5C133 plasmid pHNSD133T1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

132. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MG825383 (Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

133. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MG825379 (Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

134. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_MG288678 (Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

135. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

136. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

137. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP027199 (Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

138. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP038288 (Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

139. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to MH160767 (Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

140. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to AF234173 (Enterobacteria phage P1 mod1902::IS5 c1.100 rev dmt(del)MB mutant, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

141. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

142. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

143. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NC_005856 (Enterobacteria phage P1, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

144. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

145. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NC_042128 (Escherichia phage RCS47, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

146. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to AJ000741 (Bacteriophage P1 darA operon) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

147. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

148. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to AF234172 (Enterobacteria phage P1 mod749::IS5 c1.100 mutant, complete genome) position: , mismatch: 0, identity: 1.0

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattgactggttttc	Protospacer
********************************

149. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_KX518745 (Escherichia coli strain HYEC7 plasmid pHYEC7-mcr1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

150. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_KX880944 (Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

151. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP045829 (Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

152. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP043218 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

153. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP034163 (Escherichia albertii strain 06-3542 plasmid p06-3542, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

154. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_LT905089 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-243 genome assembly, plasmid: 1) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

155. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP034959 (Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

156. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_LR130557 (Escherichia coli strain MS14385 isolate MS14385 plasmid 3) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

157. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP026725 (Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

158. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP021729 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

159. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP015997 (Escherichia coli strain S51 plasmid pS51_2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

160. spacer 3.5|1413862|30|CP034166|PILER-CR matches to MN232192 (Escherichia coli plasmid pGD27-62, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

161. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

162. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP030183 (Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

163. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP027133 (Escherichia coli strain AR_0372 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

164. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

165. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP038378 (Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

166. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

167. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

168. spacer 3.5|1413862|30|CP034166|PILER-CR matches to LC511659 (Escherichia coli 2017.15.03CC plasmid p2017.15.03CC DNA, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

169. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP021203 (Escherichia coli strain Z1002 plasmid p1002-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

170. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

171. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP022733 (Escherichia coli strain SA186 plasmid pSA186_4, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

172. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

173. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP009168 (Escherichia coli 1303 plasmid p1303_95, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

174. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP023381 (Escherichia coli strain 127 plasmid p91, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

175. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP013030 (Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

176. spacer 3.5|1413862|30|CP034166|PILER-CR matches to MF510496 (Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

177. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP052881 (Escherichia coli strain C21 plasmid pC21-4, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

178. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP040069 (Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

179. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

180. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP034164 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

181. spacer 3.5|1413862|30|CP034166|PILER-CR matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

182. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP041630 (Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

183. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP041922 (Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

184. spacer 3.5|1413862|30|CP034166|PILER-CR matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

185. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP033882 (Escherichia coli strain 50579417 plasmid p50579417_1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

186. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP033848 (Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

187. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP026938 (Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

188. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

189. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP031654 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

190. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MK419152 (Escherichia coli strain D72C plasmid pD72C, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

191. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MK410117 (Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

192. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MK455768 (Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

193. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MH844525 (Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

194. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MH781719 (Klebsiella pneumoniae strain SCKLB684 plasmid pSCKLB684-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

195. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MK256965 (Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

196. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MG825383 (Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

197. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MG825379 (Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

198. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MG288678 (Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

199. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP027199 (Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

200. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP038288 (Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

201. spacer 3.5|1413862|30|CP034166|PILER-CR matches to AJ000741 (Bacteriophage P1 darA operon) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

202. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

203. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

204. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

205. spacer 3.5|1413862|30|CP034166|PILER-CR matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

206. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_KU980950 (Escherichia coli strain WE-0250 plasmid U2501, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

207. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

208. spacer 3.5|1413862|30|CP034166|PILER-CR matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

209. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP019188 (Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

210. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP020522 (Escherichia coli strain 190 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

211. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP047090 (Salmonella sp. S13 plasmid pS13-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

212. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP029244 (Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

213. spacer 3.5|1413862|30|CP034166|PILER-CR matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

214. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP021340 (Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

215. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP021336 (Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

216. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP009051 (Escherichia coli NCCP15648 plasmid p15648-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

217. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP039843 (Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

218. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

219. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

220. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP035313 (Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

221. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP029103 (Escherichia coli strain AR437 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

222. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_AP018809 (Escherichia coli strain E2865 plasmid pE2865-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

223. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

224. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

225. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP032239 (Escherichia coli strain ECCWS199 plasmid pTB222, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

226. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP023896 (Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

227. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

228. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP046005 (Escherichia coli strain 1919D3 plasmid p1919D3-2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

229. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

230. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

231. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP030784 (Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

232. spacer 3.5|1413862|30|CP034166|PILER-CR matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

233. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NC_017653 (Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

234. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP019054 (Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

235. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

236. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP028125 (Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

237. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

238. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

239. spacer 3.5|1413862|30|CP034166|PILER-CR matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

240. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

241. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP037905 (Escherichia coli strain LHM10-1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

242. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_LT985263 (Escherichia coli strain 511 plasmid RCS54_p, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

243. spacer 3.5|1413862|30|CP034166|PILER-CR matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

244. spacer 3.5|1413862|30|CP034166|PILER-CR matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

245. spacer 3.5|1413862|30|CP034166|PILER-CR matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

246. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MH580301 (Escherichia coli strain 1107 plasmid p1107-99K, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

247. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_MG196293 (Escherichia coli strain SDX5C133 plasmid pHNSD133T1, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

248. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

249. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

250. spacer 3.5|1413862|30|CP034166|PILER-CR matches to MH160767 (Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

251. spacer 3.5|1413862|30|CP034166|PILER-CR matches to AF234173 (Enterobacteria phage P1 mod1902::IS5 c1.100 rev dmt(del)MB mutant, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

252. spacer 3.5|1413862|30|CP034166|PILER-CR matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

253. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

254. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NC_005856 (Enterobacteria phage P1, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

255. spacer 3.5|1413862|30|CP034166|PILER-CR matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

256. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NC_042128 (Escherichia phage RCS47, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

257. spacer 3.5|1413862|30|CP034166|PILER-CR matches to AF234172 (Enterobacteria phage P1 mod749::IS5 c1.100 mutant, complete genome) position: , mismatch: 0, identity: 1.0

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattgactggttttc	Protospacer
******************************

258. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP029493 (Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

259. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP010234 (Escherichia coli strain S30 plasmid C, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

260. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP044294 (Escherichia coli strain P276M plasmid p276M-CTX-M-55, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

261. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP010173 (Escherichia coli strain H8 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

262. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP021846 (Escherichia coli strain EC1515 plasmid pEC1515-2, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

263. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP019262 (Escherichia coli strain 13C1065T plasmid p13C1065T-3, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

264. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP029244 (Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

265. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP021842 (Escherichia coli strain EC974 plasmid pEC974-2, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

266. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP030183 (Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

267. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP038378 (Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

268. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

269. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP022733 (Escherichia coli strain SA186 plasmid pSA186_4, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

270. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_AP018809 (Escherichia coli strain E2865 plasmid pE2865-1, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

271. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP019216 (Escherichia coli strain WCHEC050613 plasmid p2_050613, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

272. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

273. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP023732 (Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

274. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP009168 (Escherichia coli 1303 plasmid p1303_95, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

275. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

276. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP013030 (Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

277. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP020936 (Escherichia coli strain HB-Coli0 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

278. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

279. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP040069 (Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

280. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

281. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

282. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP034789 (Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

283. spacer 3.1|1413737|33|CP034166|CRT matches to NC_017653 (Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

284. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP029688 (Escherichia coli strain E706 plasmid pLKJULY7989, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

285. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP019054 (Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

286. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP028125 (Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

287. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP041630 (Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

288. spacer 3.1|1413737|33|CP034166|CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

289. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP026938 (Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

290. spacer 3.1|1413737|33|CP034166|CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

291. spacer 3.1|1413737|33|CP034166|CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

292. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_MG825383 (Escherichia coli strain 1079 plasmid p1079-IncFIB-N, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

293. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_KY887590 (Escherichia coli strain Ec9 plasmid pEc9, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

294. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

295. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP038288 (Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

296. spacer 3.1|1413737|33|CP034166|CRT matches to MH160767 (Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaggggggaacaccgccaa	Protospacer
*******************************.*

297. spacer 3.1|1413737|33|CP034166|CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

298. spacer 3.1|1413737|33|CP034166|CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

299. spacer 3.1|1413737|33|CP034166|CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 1, identity: 0.97

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaacaccgccga	Protospacer
****************.****************

300. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP010173 (Escherichia coli strain H8 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.969

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattaactggttttc	Protospacer
*********************.**********

301. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP041960 (Escherichia coli strain EC2 plasmid pEC2_5, complete sequence) position: , mismatch: 1, identity: 0.969

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattaactggttttc	Protospacer
*********************.**********

302. spacer 3.3|1413860|32|CP034166|CRT,CRISPRCasFinder matches to NZ_CP023732 (Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence) position: , mismatch: 1, identity: 0.969

ggagatatgccaccagctattgactggttttc	CRISPR spacer
ggagatatgccaccagctattaactggttttc	Protospacer
*********************.**********

303. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP041960 (Escherichia coli strain EC2 plasmid pEC2_5, complete sequence) position: , mismatch: 1, identity: 0.967

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattaactggttttc	Protospacer
*******************.**********

304. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP010173 (Escherichia coli strain H8 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.967

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattaactggttttc	Protospacer
*******************.**********

305. spacer 3.5|1413862|30|CP034166|PILER-CR matches to NZ_CP023732 (Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence) position: , mismatch: 1, identity: 0.967

agatatgccaccagctattgactggttttc	CRISPR spacer
agatatgccaccagctattaactggttttc	Protospacer
*******************.**********

306. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

307. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP026237 (Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

308. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP021729 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

309. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

310. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

311. spacer 3.1|1413737|33|CP034166|CRT matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

312. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

313. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP033095 (Escherichia coli strain CP53 plasmid pCP53-92k, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

314. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP030784 (Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

315. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP034164 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaagggggaactccgccga	Protospacer
****************.******** *******

316. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP047574 (Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

317. spacer 3.1|1413737|33|CP034166|CRT matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

318. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP041922 (Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

319. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP033848 (Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

320. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP021734 (Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

321. spacer 3.1|1413737|33|CP034166|CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

322. spacer 3.1|1413737|33|CP034166|CRT matches to NC_042128 (Escherichia phage RCS47, complete genome) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

323. spacer 3.1|1413737|33|CP034166|CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 2, identity: 0.939

gcttaatggtttgggaggggggaacaccgccga	CRISPR spacer
gcttaatggtttgggaaggggggacaccgccga	Protospacer
****************.*****.**********

324. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065675 (UNVERIFIED: Campylobacter phage A118, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

325. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065687 (UNVERIFIED: Campylobacter phage A136, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

326. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065667 (UNVERIFIED: Campylobacter phage A127, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccattcg	Protospacer
*************.******** ***..* **

327. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065671 (UNVERIFIED: Campylobacter phage A120, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

328. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to NC_049823 (Escherichia phage herni, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

329. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065679 (UNVERIFIED: Campylobacter phage A13a, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

330. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065665 (UNVERIFIED: Campylobacter phage A131, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccattcg	Protospacer
*************.******** ***..* **

331. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065685 (UNVERIFIED: Campylobacter phage A112a, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

332. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to NC_049821 (Salmonella phage slyngel, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

333. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MK373798 (Escherichia phage vB_EcoS_G29-2, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

334. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065663 (UNVERIFIED: Campylobacter phage A134, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccattcg	Protospacer
*************.******** ***..* **

335. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065670 (UNVERIFIED: Campylobacter phage A121, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

336. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065638 (UNVERIFIED: Campylobacter phage A15a, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccattcg	Protospacer
*************.******** ***..* **

337. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to NC_049830 (Escherichia phage PGN590, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

338. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MN850607 (Escherichia phage egaa, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

339. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065640 (UNVERIFIED: Campylobacter phage A14b, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

340. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MN850600 (Escherichia phage haarsle, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

341. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065673 (UNVERIFIED: Campylobacter phage A119, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

342. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065641 (UNVERIFIED: Campylobacter phage A14a, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

343. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065669 (UNVERIFIED: Campylobacter phage A123, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

344. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MT360681 (Shigella virus 2019SD1, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

345. spacer 3.2|1413799|32|CP034166|CRT,CRISPRCasFinder matches to MG065636 (UNVERIFIED: Campylobacter phage A16a, complete genome) position: , mismatch: 5, identity: 0.844

tcaagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
tcaagcatcggcagcagttgcgtttccatacg	Protospacer
*************.******** ***..*.**

346. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065667 (UNVERIFIED: Campylobacter phage A127, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccattcg	Protospacer
***********.******** ***..* **

347. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065685 (UNVERIFIED: Campylobacter phage A112a, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

348. spacer 3.4|1413801|30|CP034166|PILER-CR matches to NC_049830 (Escherichia phage PGN590, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

349. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MN850607 (Escherichia phage egaa, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

350. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065673 (UNVERIFIED: Campylobacter phage A119, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

351. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MT360681 (Shigella virus 2019SD1, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

352. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065675 (UNVERIFIED: Campylobacter phage A118, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

353. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065687 (UNVERIFIED: Campylobacter phage A136, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

354. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065671 (UNVERIFIED: Campylobacter phage A120, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

355. spacer 3.4|1413801|30|CP034166|PILER-CR matches to NC_049823 (Escherichia phage herni, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

356. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065679 (UNVERIFIED: Campylobacter phage A13a, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

357. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065665 (UNVERIFIED: Campylobacter phage A131, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccattcg	Protospacer
***********.******** ***..* **

358. spacer 3.4|1413801|30|CP034166|PILER-CR matches to NC_049821 (Salmonella phage slyngel, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

359. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MK373798 (Escherichia phage vB_EcoS_G29-2, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

360. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065663 (UNVERIFIED: Campylobacter phage A134, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccattcg	Protospacer
***********.******** ***..* **

361. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065670 (UNVERIFIED: Campylobacter phage A121, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

362. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065638 (UNVERIFIED: Campylobacter phage A15a, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccattcg	Protospacer
***********.******** ***..* **

363. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065640 (UNVERIFIED: Campylobacter phage A14b, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

364. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MN850600 (Escherichia phage haarsle, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

365. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065641 (UNVERIFIED: Campylobacter phage A14a, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

366. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065669 (UNVERIFIED: Campylobacter phage A123, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

367. spacer 3.4|1413801|30|CP034166|PILER-CR matches to MG065636 (UNVERIFIED: Campylobacter phage A16a, complete genome) position: , mismatch: 5, identity: 0.833

aagcatcggcaacagttgcgattctgtgcg	CRISPR spacer
aagcatcggcagcagttgcgtttccatacg	Protospacer
***********.******** ***..*.**

368. spacer 3.1|1413737|33|CP034166|CRT matches to NZ_CP018781 (Ochrobactrum pituitosum strain AA2 plasmid pOAAA2, complete sequence) position: , mismatch: 6, identity: 0.818

gcttaatg-gtttgggaggggggaacaccgccga	CRISPR spacer
-cgcaatgcgtttgggaggggggaacgccgacgc	Protospacer
 * .**** *****************.*** ** 

369. spacer 2.1|1091059|54|CP034166|CRISPRCasFinder matches to NZ_CP019906 (Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence) position: , mismatch: 12, identity: 0.778

tcccgcaggccggataagacgcggcaagcgtcgcatcaggcaatgcgtcactaa	CRISPR spacer
attcgtcggccggataagacgcggcaagcgtcgcatccggcaatgtgcttcaac	Protospacer
 ..**. ****************************** *******.*.. * * 

370. spacer 2.1|1091059|54|CP034166|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 12, identity: 0.778

tcccgcaggccggataagacgcggcaagcgtcgcatcaggcaatgcgtcactaa-	CRISPR spacer
tggcgtaggcctgataagacgcggcaagcgtcgcatcaggcgttg-atgtcggat	Protospacer
*  **.***** *****************************. ** .*  * .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage