Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034158 Chryseobacterium sp. H3001 chromosome, complete genome 3 crisprs DEDDh,cas3,csa3 0 1 0 0

Results visualization

1. CP034158
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034158_1 81846-81924 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034158_2 804522-804620 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034158_3 1946288-1946426 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034158_1 1.1|81870|31|CP034158|CRISPRCasFinder 81870-81900 31 NZ_LN879503 Candidatus Protochlamydia naegleriophila strain KNic plasmid pPNK, complete sequence 74492-74522 8 0.742
CP034158_1 1.1|81870|31|CP034158|CRISPRCasFinder 81870-81900 31 NC_018066 Desulfosporosinus acidiphilus SJ4 plasmid pDESACI.01, complete sequence 58477-58507 9 0.71
CP034158_1 1.1|81870|31|CP034158|CRISPRCasFinder 81870-81900 31 NZ_CP015251 Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence 96204-96234 9 0.71
CP034158_1 1.1|81870|31|CP034158|CRISPRCasFinder 81870-81900 31 NZ_CP033130 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence 278854-278884 10 0.677
CP034158_1 1.1|81870|31|CP034158|CRISPRCasFinder 81870-81900 31 NZ_CP010351 Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence 246848-246878 10 0.677
CP034158_1 1.1|81870|31|CP034158|CRISPRCasFinder 81870-81900 31 NZ_CP032285 Acinetobacter sp. WCHA55 plasmid pOXA58_010055, complete sequence 260926-260956 10 0.677
CP034158_1 1.1|81870|31|CP034158|CRISPRCasFinder 81870-81900 31 NZ_CP043309 Acinetobacter johnsonii strain Acsw19 plasmid pAcsw19-2, complete sequence 314767-314797 10 0.677

1. spacer 1.1|81870|31|CP034158|CRISPRCasFinder matches to NZ_LN879503 (Candidatus Protochlamydia naegleriophila strain KNic plasmid pPNK, complete sequence) position: , mismatch: 8, identity: 0.742

ctcatgaatatttaaaaaaatgccgctaaag	CRISPR spacer
tccctgaatatttaagaaaatgccgttattt	Protospacer
..* ***********.*********.**   

2. spacer 1.1|81870|31|CP034158|CRISPRCasFinder matches to NC_018066 (Desulfosporosinus acidiphilus SJ4 plasmid pDESACI.01, complete sequence) position: , mismatch: 9, identity: 0.71

ctcatgaatatttaaaaaaatgccgctaaag	CRISPR spacer
gaaatggatatttaaaaaaatgcagcaatgt	Protospacer
   ***.**************** ** * . 

3. spacer 1.1|81870|31|CP034158|CRISPRCasFinder matches to NZ_CP015251 (Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence) position: , mismatch: 9, identity: 0.71

ctcatgaatatttaaaaaaatgccgctaaag	CRISPR spacer
aacatgaatattcaaaaaaataccgggtgaa	Protospacer
  **********.********.***   .*.

4. spacer 1.1|81870|31|CP034158|CRISPRCasFinder matches to NZ_CP033130 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence) position: , mismatch: 10, identity: 0.677

ctcatgaatatttaaaaaaatgccgctaaag	CRISPR spacer
tgcatgaagatttaaaacaatgccgtatctt	Protospacer
. ****** ******** *******.     

5. spacer 1.1|81870|31|CP034158|CRISPRCasFinder matches to NZ_CP010351 (Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence) position: , mismatch: 10, identity: 0.677

ctcatgaatatttaaaaaaatgccgctaaag	CRISPR spacer
tgcatgaagatttaaaacaatgccgtatctt	Protospacer
. ****** ******** *******.     

6. spacer 1.1|81870|31|CP034158|CRISPRCasFinder matches to NZ_CP032285 (Acinetobacter sp. WCHA55 plasmid pOXA58_010055, complete sequence) position: , mismatch: 10, identity: 0.677

ctcatgaatatttaaaaaaatgccgctaaag	CRISPR spacer
tgcatgaagatttaaaacaatgccgtatctt	Protospacer
. ****** ******** *******.     

7. spacer 1.1|81870|31|CP034158|CRISPRCasFinder matches to NZ_CP043309 (Acinetobacter johnsonii strain Acsw19 plasmid pAcsw19-2, complete sequence) position: , mismatch: 10, identity: 0.677

ctcatgaatatttaaaaaaatgccgctaaag	CRISPR spacer
tgcatgaagatttaaaacaatgccgtatctt	Protospacer
. ****** ******** *******.     

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage