Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034233 Salmonella enterica strain ATCC 8400 chromosome, complete genome 2 crisprs csa3,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,PD-DExK 0 28 6 0

Results visualization

1. CP034233
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034233_1 304685-306484 TypeI-E I-E
29 spacers
cas3,cas8e,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034233_2 322733-323921 TypeI-E I-E
19 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034233_2 2.28|323251|32|CP034233|CRISPRCasFinder,CRT 323251-323282 32 MK422450 Klebsiella phage ST13-OXA48phi12.4, complete genome 36616-36647 2 0.938
CP034233_2 2.9|323249|34|CP034233|PILER-CR 323249-323282 34 MK422450 Klebsiella phage ST13-OXA48phi12.4, complete genome 36616-36649 3 0.912
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MG812490 Mycobacterium phage Holeinone, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MH051249 Mycobacterium phage Boyle, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MN428049 Mycobacterium phage West99, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MN586045 Mycobacterium phage Brownie5, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MH001452 Mycobacterium phage Kheth, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MH697584 Mycobacterium phage FrenchFry, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MG757162 Mycobacterium phage Opia, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MK814751 Mycobacterium phage Bananafish, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 KT365402 Mycobacterium phage Tres, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 KM101117 Mycobacterium phage LizLemon, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 JN698991 Mycobacterium phage Hedgerow, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 NC_043767 Mycobacterium virus TA17a, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MN586046 Mycobacterium phage Tinciduntsolum, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MK620898 Mycobacterium phage Coffee, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 JN699004 Mycobacterium phage Ares, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MG812491 Mycobacterium phage ItsyBitsy1, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MN234225 Mycobacterium phage Rhinoforte, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 DQ398048 Mycobacterium phage Qyrzula, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 AY129334 Mycobacterium phage Rosebush, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MH590591 Mycobacterium phage Sabella, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 JN618996 Mycobacterium phage Arbiter, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 KX443696 Mycobacterium phage Laurie, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MH727546 Mycobacterium phage Eaglehorse, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MK061411 Mycobacterium phage Faze9, complete genome 129-160 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 KT880194 Mycobacterium phage Glass, complete genome 129-160 5 0.844
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 24647-24678 5 0.844
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 CP051275 Salmonella phage SW-37, complete genome 23972-24003 5 0.844
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MN813678 Mycobacterium phage Lephleur, complete genome 129-160 6 0.812
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 MT639652 Mycobacterium phage MasterPo, complete genome 129-160 6 0.812
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 KR997932 Mycobacterium phage Godines, complete genome 129-160 6 0.812
CP034233_1 1.27|306302|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 306302-306333 32 MF150911 Ralstonia phage DU_RP_II, complete genome 23701-23732 6 0.812
CP034233_1 1.27|306302|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 306302-306333 32 MN996301 Ralstonia phage RpY1, complete genome 40170-40201 6 0.812
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 NC_022754 Salmonella phage SETP7, complete genome 33704-33735 6 0.812
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 37078-37109 6 0.812
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 MT074484 Salmonella phage celemicas, complete genome 40185-40216 6 0.812
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 MG969408 UNVERIFIED: Salmonella phage GE_vB_HIL, complete genome 39678-39709 6 0.812
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 MG969409 UNVERIFIED: Salmonella phage GE_vB_M4, complete genome 11222-11253 6 0.812
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 AF349435 Bacteriophage MB78 22 kDa protein gene, complete cds; and unknown gene 1507-1538 6 0.812
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 MG969410 UNVERIFIED: Salmonella phage GE_vB_M5, complete genome 7449-7480 6 0.812
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 NZ_AP014802 Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351 69804-69835 7 0.781
CP034233_1 1.11|305324|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305324-305355 32 NZ_CP035407 Bacillus subtilis strain SRCM103612 plasmid unnamed1 19038-19069 7 0.781
CP034233_1 1.11|305324|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305324-305355 32 NC_001884 Bacillus phage SPBc2, complete genome 894-925 7 0.781
CP034233_1 1.11|305324|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305324-305355 32 AF020713 Bacteriophage SPBc2 complete genome 894-925 7 0.781
CP034233_1 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305568-305599 32 NZ_CP021139 Sulfuriferula sp. AH1 plasmid unnamed, complete sequence 32668-32699 7 0.781
CP034233_1 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305568-305599 32 LC155906 Achromobacter xylosoxidans plasmid pKUN4507_1 DNA, complete sequence, strain: KUN4507 4936-4967 7 0.781
CP034233_1 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305568-305599 32 NC_007206 Haemophilus influenzae biotype aegyptius plasmid pF1947, complete sequence 28452-28483 7 0.781
CP034233_1 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305568-305599 32 NC_004846 Haemophilus influenzae biotype aegyptius plasmid pF3031, complete sequence 28175-28206 7 0.781
CP034233_1 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305568-305599 32 NC_004058 Haemophilus influenzae biotype aegyptius BPF plasmid pF3028, complete sequence 28121-28152 7 0.781
CP034233_1 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305629-305660 32 KR296691 Salmonella phage 37, complete genome 429-460 7 0.781
CP034233_1 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305629-305660 32 LR026998 unidentified phage genome assembly, chromosome: 1 429-460 7 0.781
CP034233_1 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305629-305660 32 NC_048666 Salmonella phage YSD1 strain YSD1_PHAGE genome assembly 429-460 7 0.781
CP034233_1 1.18|305752|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305752-305783 32 MT701590 Klebsiella phage Miami, complete genome 35185-35216 7 0.781
CP034233_2 2.5|323005|34|CP034233|PILER-CR 323005-323038 34 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 24647-24680 7 0.794
CP034233_2 2.5|323005|34|CP034233|PILER-CR 323005-323038 34 CP051275 Salmonella phage SW-37, complete genome 23970-24003 7 0.794
CP034233_2 2.21|322823|33|CP034233|CRISPRCasFinder,CRT 322823-322855 33 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 73049-73081 7 0.788
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 NC_006949 Enterobacteria phage ES18, complete genome 28717-28748 7 0.781
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 AY736146 Salmonella typhimurium bacteriophage ES18, complete sequence 28717-28748 7 0.781
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 NC_047875 Salmonella phage UPF_BP1, complete genome 34840-34871 7 0.781
CP034233_2 2.35|323678|32|CP034233|CRISPRCasFinder,CRT 323678-323709 32 KM659092 Ochrobactrum sp. LM19 plasmid pLM19O2, complete sequence 78263-78294 7 0.781
CP034233_1 1.5|304958|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 304958-304989 32 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 149001-149032 8 0.75
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 57507-57538 8 0.75
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 NC_002682 Mesorhizobium japonicum MAFF 303099 plasmid pMLb, complete sequence 100885-100916 8 0.75
CP034233_1 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305019-305050 32 NC_016655 Rhodococcus phage REQ1, complete genome 18878-18909 8 0.75
CP034233_1 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305568-305599 32 NZ_CP015374 Pandoraea pnomenusa strain MCB032 plasmid unnamed 3, complete sequence 13725-13756 8 0.75
CP034233_1 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305568-305599 32 NZ_LR594694 Variovorax sp. WDL1 plasmid 6 17864-17895 8 0.75
CP034233_1 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305568-305599 32 NZ_CP010894 Pseudomonas sp. MRSN12121 plasmid, complete sequence 15102-15133 8 0.75
CP034233_1 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305629-305660 32 KC139631 Salmonella phage FSL SP-019 primase and hypothetical protein genes, complete cds 3166-3197 8 0.75
CP034233_1 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305629-305660 32 KC139680 Salmonella phage FSL SP-099 tape measure protein gene, partial cds; and pre-tape measure frameshift protein G-Ts, hypothetical proteins, capsid protein E, decorator protein D, prohead protease ClpP, portal protein, head-tail joining protein lambda W, terminase large subunit, TerS, helicase, hypothetical protein, DNA polymerase I, hypothetical proteins, DR0530-like primase, and helix-turn-helix XRE-family of transcriptional regulators genes, complete cds 25218-25249 8 0.75
CP034233_1 1.20|305874|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305874-305905 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 1189194-1189225 8 0.75
CP034233_2 2.5|323005|34|CP034233|PILER-CR 323005-323038 34 NC_022754 Salmonella phage SETP7, complete genome 33704-33737 8 0.765
CP034233_2 2.5|323005|34|CP034233|PILER-CR 323005-323038 34 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 37076-37109 8 0.765
CP034233_2 2.5|323005|34|CP034233|PILER-CR 323005-323038 34 NC_006949 Enterobacteria phage ES18, complete genome 28717-28750 8 0.765
CP034233_2 2.5|323005|34|CP034233|PILER-CR 323005-323038 34 AY736146 Salmonella typhimurium bacteriophage ES18, complete sequence 28717-28750 8 0.765
CP034233_2 2.5|323005|34|CP034233|PILER-CR 323005-323038 34 NC_047875 Salmonella phage UPF_BP1, complete genome 34840-34873 8 0.765
CP034233_2 2.20|322762|32|CP034233|CRISPRCasFinder,CRT 322762-322793 32 NZ_CP050070 Klebsiella aerogenes strain 035 plasmid p35_C, complete sequence 16772-16803 8 0.75
CP034233_2 2.20|322762|32|CP034233|CRISPRCasFinder,CRT 322762-322793 32 NZ_CP040996 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed4 24020-24051 8 0.75
CP034233_2 2.20|322762|32|CP034233|CRISPRCasFinder,CRT 322762-322793 32 NZ_CP026209 Escherichia coli strain ECONIH5 plasmid unnamed, complete sequence 25179-25210 8 0.75
CP034233_2 2.20|322762|32|CP034233|CRISPRCasFinder,CRT 322762-322793 32 NZ_CP030875 Raoultella sp. X13 plasmid unnamed, complete sequence 26515-26546 8 0.75
CP034233_2 2.20|322762|32|CP034233|CRISPRCasFinder,CRT 322762-322793 32 NZ_CP024432 Klebsiella pneumoniae strain DA48896 plasmid p48896_3, complete sequence 18055-18086 8 0.75
CP034233_2 2.20|322762|32|CP034233|CRISPRCasFinder,CRT 322762-322793 32 NZ_CP011864 Enterobacter asburiae strain ATCC 35953 plasmid unnamed 1, complete sequence 27556-27587 8 0.75
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 11707-11738 8 0.75
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 37421-37452 8 0.75
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 115676-115707 8 0.75
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 NC_004813 Enterobacteria phage BP-4795, complete genome 2667-2698 8 0.75
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 AJ556162 Phage BP-4795 complete genome 2667-2698 8 0.75
CP034233_2 2.32|323495|32|CP034233|CRISPRCasFinder,CRT 323495-323526 32 MK448721 Streptococcus phage Javan263, complete genome 22083-22114 8 0.75
CP034233_2 2.32|323495|32|CP034233|CRISPRCasFinder,CRT 323495-323526 32 JX560968 Escherichia phage EC6, complete genome 39205-39236 8 0.75
CP034233_2 2.32|323495|32|CP034233|CRISPRCasFinder,CRT 323495-323526 32 MG065664 UNVERIFIED: Campylobacter phage A132, complete genome 26272-26303 8 0.75
CP034233_1 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305629-305660 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 44767-44798 9 0.719
CP034233_1 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305629-305660 32 NC_021780 Salmonella phage FSL SP-088, complete genome 59028-59059 9 0.719
CP034233_1 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305629-305660 32 KC139515 Salmonella phage FSL SP-124, complete genome 58785-58816 9 0.719
CP034233_1 1.20|305874|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305874-305905 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 213435-213466 9 0.719
CP034233_1 1.22|305996|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305996-306027 32 KT264824 Gokushovirus WZ-2015a isolate 76Mky15, complete genome 935-966 9 0.719
CP034233_1 1.26|306240|33|CP034233|PILER-CR,CRISPRCasFinder,CRT 306240-306272 33 AB863625 Ralstonia phage RSK1 DNA, complete genome 30229-30261 9 0.727
CP034233_1 1.26|306240|33|CP034233|PILER-CR,CRISPRCasFinder,CRT 306240-306272 33 MT740737 Ralstonia phage Firinga, complete genome 33352-33384 9 0.727
CP034233_1 1.26|306240|33|CP034233|PILER-CR,CRISPRCasFinder,CRT 306240-306272 33 MT740741 Ralstonia phage Hennie, complete genome 26821-26853 9 0.727
CP034233_1 1.27|306302|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 306302-306333 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 715052-715083 9 0.719
CP034233_1 1.29|306424|32|CP034233|CRISPRCasFinder,CRT 306424-306455 32 MN369756 Gordonia phage Anon, complete genome 19662-19693 9 0.719
CP034233_2 2.20|322762|32|CP034233|CRISPRCasFinder,CRT 322762-322793 32 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 666961-666992 9 0.719
CP034233_2 2.22|322885|32|CP034233|CRISPRCasFinder,CRT 322885-322916 32 NC_011314 Aliivibrio salmonicida LFI1238 plasmid pVSAL320, complete sequence 685-716 9 0.719
CP034233_2 2.22|322885|32|CP034233|CRISPRCasFinder,CRT 322885-322916 32 NZ_CP034239 Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence 23838-23869 9 0.719
CP034233_2 2.24|323007|32|CP034233|CRISPRCasFinder,CRT 323007-323038 32 MK799832 Synechococcus phage S-B05, complete genome 153933-153964 9 0.719
CP034233_2 2.32|323495|32|CP034233|CRISPRCasFinder,CRT 323495-323526 32 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 380188-380219 9 0.719
CP034233_2 2.32|323495|32|CP034233|CRISPRCasFinder,CRT 323495-323526 32 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 362467-362498 9 0.719
CP034233_2 2.37|323800|32|CP034233|CRISPRCasFinder,CRT 323800-323831 32 MK765592 Tortoise microvirus 41 isolate 41_SP_100, complete genome 4812-4843 9 0.719
CP034233_2 2.37|323800|32|CP034233|CRISPRCasFinder,CRT 323800-323831 32 MK765657 Tortoise microvirus 2 isolate 2_SP_12, complete genome 4839-4870 9 0.719
CP034233_2 2.37|323800|32|CP034233|CRISPRCasFinder,CRT 323800-323831 32 MK765611 Tortoise microvirus 59 isolate 59_SP_97, complete genome 4812-4843 9 0.719
CP034233_2 2.37|323800|32|CP034233|CRISPRCasFinder,CRT 323800-323831 32 MW149100 Microvirus sp. isolate gila21, complete genome 4803-4834 9 0.719
CP034233_2 2.37|323800|32|CP034233|CRISPRCasFinder,CRT 323800-323831 32 MK765552 Tortoise microvirus 2 isolate 2_SP_25, complete genome 4839-4870 9 0.719
CP034233_1 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 304897-304928 32 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 166933-166964 10 0.688
CP034233_1 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 304897-304928 32 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 89170-89201 10 0.688
CP034233_1 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 304897-304928 32 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 63705-63736 10 0.688
CP034233_1 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 304897-304928 32 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 349899-349930 10 0.688
CP034233_1 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 304897-304928 32 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 281115-281146 10 0.688
CP034233_1 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 304897-304928 32 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 9043-9074 10 0.688
CP034233_1 1.8|305141|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305141-305172 32 NC_019749 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.02, complete sequence 98514-98545 10 0.688
CP034233_1 1.20|305874|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 305874-305905 32 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 131465-131496 10 0.688
CP034233_2 2.20|322762|32|CP034233|CRISPRCasFinder,CRT 322762-322793 32 AP013980 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S31-C4, *** SEQUENCING IN PROGRESS *** 36023-36054 10 0.688
CP034233_2 2.34|323617|32|CP034233|CRISPRCasFinder,CRT 323617-323648 32 MK531536 Acinetobacter baumannii strain MC1 plasmid pMC1.1, complete sequence 180192-180223 10 0.688
CP034233_2 2.34|323617|32|CP034233|CRISPRCasFinder,CRT 323617-323648 32 NZ_CP027531 Acinetobacter baumannii strain AR_0088 plasmid unnamed1, complete sequence 111758-111789 10 0.688
CP034233_2 2.34|323617|32|CP034233|CRISPRCasFinder,CRT 323617-323648 32 NZ_CP050386 Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence 49136-49167 10 0.688
CP034233_2 2.34|323617|32|CP034233|CRISPRCasFinder,CRT 323617-323648 32 LT605060 Acinetobacter calcoaceticus strain NCTC7364 genome assembly, plasmid: 2 77707-77738 10 0.688
CP034233_2 2.34|323617|32|CP034233|CRISPRCasFinder,CRT 323617-323648 32 NZ_CP020596 Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence 89803-89834 10 0.688
CP034233_2 2.34|323617|32|CP034233|CRISPRCasFinder,CRT 323617-323648 32 NZ_CP040260 Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence 1715-1746 10 0.688
CP034233_2 2.34|323617|32|CP034233|CRISPRCasFinder,CRT 323617-323648 32 NZ_CP022285 Acinetobacter baumannii strain 7804 plasmid pAba7804b, complete sequence 8427-8458 10 0.688
CP034233_2 2.34|323617|32|CP034233|CRISPRCasFinder,CRT 323617-323648 32 NZ_CP012005 Acinetobacter baumannii strain ATCC 17978-mff plasmid pAB3, complete sequence 19752-19783 10 0.688
CP034233_2 2.34|323617|32|CP034233|CRISPRCasFinder,CRT 323617-323648 32 CP033562 Acinetobacter nosocomialis strain 2010S01-197 plasmid p2010S01-197-1, complete sequence 95546-95577 10 0.688
CP034233_2 2.38|323861|32|CP034233|CRISPRCasFinder,CRT 323861-323892 32 NZ_CP045342 Vibrio sp. THAF190c plasmid pTHAF190c_d, complete sequence 39805-39836 10 0.688
CP034233_1 1.3|304836|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 304836-304867 32 NC_011981 Agrobacterium vitis S4 plasmid pAtS4e, complete sequence 57926-57957 11 0.656
CP034233_1 1.24|306118|32|CP034233|PILER-CR,CRISPRCasFinder,CRT 306118-306149 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 300567-300598 11 0.656
CP034233_2 2.36|323739|32|CP034233|CRISPRCasFinder,CRT 323739-323770 32 NZ_CP026426 Acinetobacter sp. ACNIH1 plasmid pACI-df08, complete sequence 74277-74308 11 0.656

1. spacer 2.28|323251|32|CP034233|CRISPRCasFinder,CRT matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 2, identity: 0.938

cgtgattacggcaaggtgcatacgtccttttg	CRISPR spacer
cgtgattacggcaaggtgcatacatcattttg	Protospacer
***********************.** *****

2. spacer 2.9|323249|34|CP034233|PILER-CR matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 3, identity: 0.912

cgcgtgattacggcaaggtgcatacgtccttttg	CRISPR spacer
tgcgtgattacggcaaggtgcatacatcattttg	Protospacer
.************************.** *****

3. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MG812490 (Mycobacterium phage Holeinone, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

4. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MH051249 (Mycobacterium phage Boyle, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

5. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MN428049 (Mycobacterium phage West99, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

6. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MN586045 (Mycobacterium phage Brownie5, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

7. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MH001452 (Mycobacterium phage Kheth, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

8. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MH697584 (Mycobacterium phage FrenchFry, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

9. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MG757162 (Mycobacterium phage Opia, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

10. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MK814751 (Mycobacterium phage Bananafish, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

11. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KT365402 (Mycobacterium phage Tres, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

12. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KM101117 (Mycobacterium phage LizLemon, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

13. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to JN698991 (Mycobacterium phage Hedgerow, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

14. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_043767 (Mycobacterium virus TA17a, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

15. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MN586046 (Mycobacterium phage Tinciduntsolum, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

16. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MK620898 (Mycobacterium phage Coffee, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

17. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to JN699004 (Mycobacterium phage Ares, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

18. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MG812491 (Mycobacterium phage ItsyBitsy1, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

19. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MN234225 (Mycobacterium phage Rhinoforte, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

20. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to DQ398048 (Mycobacterium phage Qyrzula, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

21. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to AY129334 (Mycobacterium phage Rosebush, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

22. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MH590591 (Mycobacterium phage Sabella, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

23. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to JN618996 (Mycobacterium phage Arbiter, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

24. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KX443696 (Mycobacterium phage Laurie, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

25. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MH727546 (Mycobacterium phage Eaglehorse, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

26. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MK061411 (Mycobacterium phage Faze9, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

27. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KT880194 (Mycobacterium phage Glass, complete genome) position: , mismatch: 5, identity: 0.844

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacgggt	Protospacer
**. *******************.***** *.

28. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacaaactaacagacgaacgcgtttc	Protospacer
*********************** ***.*.  

29. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 5, identity: 0.844

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacaaactaacagacgaacgcgtttc	Protospacer
*********************** ***.*.  

30. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MN813678 (Mycobacterium phage Lephleur, complete genome) position: , mismatch: 6, identity: 0.812

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacaggt	Protospacer
**. *******************.****. *.

31. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MT639652 (Mycobacterium phage MasterPo, complete genome) position: , mismatch: 6, identity: 0.812

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacaggt	Protospacer
**. *******************.****. *.

32. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KR997932 (Mycobacterium phage Godines, complete genome) position: , mismatch: 6, identity: 0.812

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gcgtttccgggctggcgtcgctgaacacaggt	Protospacer
**. *******************.****. *.

33. spacer 1.27|306302|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MF150911 (Ralstonia phage DU_RP_II, complete genome) position: , mismatch: 6, identity: 0.812

gaggcgcgcacggaggctgtgcc-gctacgtga	CRISPR spacer
taggcgcgctcgcaggctgtgccggcgacgcg-	Protospacer
 ******** ** ********** ** ***.* 

34. spacer 1.27|306302|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MN996301 (Ralstonia phage RpY1, complete genome) position: , mismatch: 6, identity: 0.812

gaggcgcgcacggaggctgtgcc-gctacgtga	CRISPR spacer
taggcgcgctcgcaggctgtgccggcgacgcg-	Protospacer
 ******** ** ********** ** ***.* 

35. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to NC_022754 (Salmonella phage SETP7, complete genome) position: , mismatch: 6, identity: 0.812

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacaaactaacagacgagcgacctga	Protospacer
*********************** **  ...*

36. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacaaactaccagacgaacgcgtttc	Protospacer
*************** ******* ***.*.  

37. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to MT074484 (Salmonella phage celemicas, complete genome) position: , mismatch: 6, identity: 0.812

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacaaactaacagacgaaacgctaaa	Protospacer
***********************     * **

38. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to MG969408 (UNVERIFIED: Salmonella phage GE_vB_HIL, complete genome) position: , mismatch: 6, identity: 0.812

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacaaactaacagacgaaacgctaaa	Protospacer
***********************     * **

39. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to MG969409 (UNVERIFIED: Salmonella phage GE_vB_M4, complete genome) position: , mismatch: 6, identity: 0.812

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacaaactaacagacgaaacgctaaa	Protospacer
***********************     * **

40. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to AF349435 (Bacteriophage MB78 22 kDa protein gene, complete cds; and unknown gene) position: , mismatch: 6, identity: 0.812

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacaaactaacagacgaaacgctaaa	Protospacer
***********************     * **

41. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to MG969410 (UNVERIFIED: Salmonella phage GE_vB_M5, complete genome) position: , mismatch: 6, identity: 0.812

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacaaactaacagacgaaacgctaaa	Protospacer
***********************     * **

42. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014802 (Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351) position: , mismatch: 7, identity: 0.781

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
gccggtccgagctgccgtcgctggacacggtc	Protospacer
** . ****.**** **************  *

43. spacer 1.11|305324|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035407 (Bacillus subtilis strain SRCM103612 plasmid unnamed1) position: , mismatch: 7, identity: 0.781

gagataaataaggtgatagaaaaaacaaaata	CRISPR spacer
gttaaatataaggttagagaaaaaacaaaaga	Protospacer
*  * * ******* * ************* *

44. spacer 1.11|305324|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_001884 (Bacillus phage SPBc2, complete genome) position: , mismatch: 7, identity: 0.781

gagataaataaggtgatagaaaaaacaaaata	CRISPR spacer
gttaaatataaggttagagaaaaaacaaaaga	Protospacer
*  * * ******* * ************* *

45. spacer 1.11|305324|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to AF020713 (Bacteriophage SPBc2 complete genome) position: , mismatch: 7, identity: 0.781

gagataaataaggtgatagaaaaaacaaaata	CRISPR spacer
gttaaatataaggttagagaaaaaacaaaaga	Protospacer
*  * * ******* * ************* *

46. spacer 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021139 (Sulfuriferula sp. AH1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

tcacgatatgaatatggggcttacgtgcaacc	CRISPR spacer
tgacaatatgaatatgcggcttacgctcgatc	Protospacer
* **.*********** ********. *.*.*

47. spacer 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to LC155906 (Achromobacter xylosoxidans plasmid pKUN4507_1 DNA, complete sequence, strain: KUN4507) position: , mismatch: 7, identity: 0.781

tcacgatatgaatatggggcttacgtgcaacc	CRISPR spacer
tgacgatatgaatatgcggcttgcgctcgact	Protospacer
* ************** *****.**. *.**.

48. spacer 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_007206 (Haemophilus influenzae biotype aegyptius plasmid pF1947, complete sequence) position: , mismatch: 7, identity: 0.781

tcacgatatgaatatggggcttacgtgcaacc	CRISPR spacer
taacgatatgaatatgtggtttacgctctatc	Protospacer
* ************** **.*****. * *.*

49. spacer 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_004846 (Haemophilus influenzae biotype aegyptius plasmid pF3031, complete sequence) position: , mismatch: 7, identity: 0.781

tcacgatatgaatatggggcttacgtgcaacc	CRISPR spacer
taacgatatgaatatgcggtttacgctctatc	Protospacer
* ************** **.*****. * *.*

50. spacer 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_004058 (Haemophilus influenzae biotype aegyptius BPF plasmid pF3028, complete sequence) position: , mismatch: 7, identity: 0.781

tcacgatatgaatatggggcttacgtgcaacc	CRISPR spacer
taacgatatgaatatgcggtttacgctctatc	Protospacer
* ************** **.*****. * *.*

51. spacer 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KR296691 (Salmonella phage 37, complete genome) position: , mismatch: 7, identity: 0.781

cgctgcga--ggccgtgaccatgttttcagtacc	CRISPR spacer
--ccacgactggccttgaccatgttttgagtaca	Protospacer
  *..***  **** ************ ***** 

52. spacer 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to LR026998 (unidentified phage genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781

cgctgcga--ggccgtgaccatgttttcagtacc	CRISPR spacer
--ccacgactggccttgaccatgttttgagtaca	Protospacer
  *..***  **** ************ ***** 

53. spacer 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_048666 (Salmonella phage YSD1 strain YSD1_PHAGE genome assembly) position: , mismatch: 7, identity: 0.781

cgctgcga--ggccgtgaccatgttttcagtacc	CRISPR spacer
--ccacgactggccttgaccatgttttgagtaca	Protospacer
  *..***  **** ************ ***** 

54. spacer 1.18|305752|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MT701590 (Klebsiella phage Miami, complete genome) position: , mismatch: 7, identity: 0.781

ggctgacaa--aatctgccgtcgtctttcttcgc	CRISPR spacer
--acgataaataatctgccgtgttctttcttcgc	Protospacer
   .**.**  **********  ***********

55. spacer 2.5|323005|34|CP034233|PILER-CR matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

cgaccaataacaaactaacagacgatcgcatcaa	CRISPR spacer
tcaccaataacaaactaacagacgaacgcgtttc	Protospacer
. *********************** ***.*.  

56. spacer 2.5|323005|34|CP034233|PILER-CR matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 7, identity: 0.794

cgaccaataacaaactaacagacgatcgcatcaa	CRISPR spacer
ttaccaataacaaactaacagacgaacgcgtttc	Protospacer
. *********************** ***.*.  

57. spacer 2.21|322823|33|CP034233|CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788

acgttggtgatacggaatagtggcaataaaatc	CRISPR spacer
aagattgagatacgcaatagtgccaataaaatg	Protospacer
* * * * ****** ******* ********* 

58. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to NC_006949 (Enterobacteria phage ES18, complete genome) position: , mismatch: 7, identity: 0.781

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
atgaataacaaactaacagacgaacgcgtttc	Protospacer
*. ******************** ***.*.  

59. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to AY736146 (Salmonella typhimurium bacteriophage ES18, complete sequence) position: , mismatch: 7, identity: 0.781

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
atgaataacaaactaacagacgaacgcgtttc	Protospacer
*. ******************** ***.*.  

60. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 7, identity: 0.781

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
atgaataacaaactaacagacgaacgcgtttc	Protospacer
*. ******************** ***.*.  

61. spacer 2.35|323678|32|CP034233|CRISPRCasFinder,CRT matches to KM659092 (Ochrobactrum sp. LM19 plasmid pLM19O2, complete sequence) position: , mismatch: 7, identity: 0.781

cattcgagagcaaaaccgctgactaaacttgg	CRISPR spacer
caatcgagagcaaaagcgctgacggcacgttg	Protospacer
** ************ ******* . ** * *

62. spacer 1.5|304958|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 8, identity: 0.75

ggcattgacccattcgaccctccg---gaaaacgc	CRISPR spacer
tgccttgaccgattcgaccctccgttcggaca---	Protospacer
 ** ****** *************   *.* *   

63. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
cgacgtccgggctggcggcgctggtcacgctg	Protospacer
  *  ************ ****** *****  

64. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_002682 (Mesorhizobium japonicum MAFF 303099 plasmid pMLb, complete sequence) position: , mismatch: 8, identity: 0.75

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
agaaacccgggctggcgccgctggacaagctt	Protospacer
. ** .***********.********* ** .

65. spacer 1.6|305019|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_016655 (Rhodococcus phage REQ1, complete genome) position: , mismatch: 8, identity: 0.75

gcaattccgggctggcgtcgctggacacgcgc	CRISPR spacer
cgaacgtccggctgccgtcgctggacacgagc	Protospacer
  **. .* ***** ************** **

66. spacer 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015374 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 3, complete sequence) position: , mismatch: 8, identity: 0.75

tcacgatatgaatatggggcttacgtgcaacc	CRISPR spacer
tgacgatgtgaatatgcggcttacgctcgatg	Protospacer
* *****.******** ********. *.*. 

67. spacer 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594694 (Variovorax sp. WDL1 plasmid 6) position: , mismatch: 8, identity: 0.75

tcacgatatgaatatggggcttacgtgcaacc	CRISPR spacer
tgacgatgtgaatatgcggcttacgctcgatg	Protospacer
* *****.******** ********. *.*. 

68. spacer 1.15|305568|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010894 (Pseudomonas sp. MRSN12121 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tcacgatatgaatatggggcttacgtgcaacc	CRISPR spacer
tgacgatgtgaatatgcggcttacgctcgatg	Protospacer
* *****.******** ********. *.*. 

69. spacer 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KC139631 (Salmonella phage FSL SP-019 primase and hypothetical protein genes, complete cds) position: , mismatch: 8, identity: 0.75

cgctgcga--ggccgtgaccatgttttcagtacc	CRISPR spacer
--tcacgactggccttgaccatgttttgagtaca	Protospacer
  ...***  **** ************ ***** 

70. spacer 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KC139680 (Salmonella phage FSL SP-099 tape measure protein gene, partial cds; and pre-tape measure frameshift protein G-Ts, hypothetical proteins, capsid protein E, decorator protein D, prohead protease ClpP, portal protein, head-tail joining protein lambda W, terminase large subunit, TerS, helicase, hypothetical protein, DNA polymerase I, hypothetical proteins, DR0530-like primase, and helix-turn-helix XRE-family of transcriptional regulators genes, complete cds) position: , mismatch: 8, identity: 0.75

cgctgcga--ggccgtgaccatgttttcagtacc	CRISPR spacer
--tcacgactggccttgaccatgttttgagtaca	Protospacer
  ...***  **** ************ ***** 

71. spacer 1.20|305874|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccatttgctcgccgttccggccgagttctgag	CRISPR spacer
acatatgctcgccggtccggccgaagcctggc	Protospacer
 *** ********* *********. .***. 

72. spacer 2.5|323005|34|CP034233|PILER-CR matches to NC_022754 (Salmonella phage SETP7, complete genome) position: , mismatch: 8, identity: 0.765

cgaccaataacaaactaacagacgatcgcatcaa	CRISPR spacer
ataccaataacaaactaacagacgagcgacctga	Protospacer
  *********************** **  ...*

73. spacer 2.5|323005|34|CP034233|PILER-CR matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

cgaccaataacaaactaacagacgatcgcatcaa	CRISPR spacer
ttaccaataacaaactaccagacgaacgcgtttc	Protospacer
. *************** ******* ***.*.  

74. spacer 2.5|323005|34|CP034233|PILER-CR matches to NC_006949 (Enterobacteria phage ES18, complete genome) position: , mismatch: 8, identity: 0.765

cgaccaataacaaactaacagacgatcgcatcaa	CRISPR spacer
agatgaataacaaactaacagacgaacgcgtttc	Protospacer
 **. ******************** ***.*.  

75. spacer 2.5|323005|34|CP034233|PILER-CR matches to AY736146 (Salmonella typhimurium bacteriophage ES18, complete sequence) position: , mismatch: 8, identity: 0.765

cgaccaataacaaactaacagacgatcgcatcaa	CRISPR spacer
agatgaataacaaactaacagacgaacgcgtttc	Protospacer
 **. ******************** ***.*.  

76. spacer 2.5|323005|34|CP034233|PILER-CR matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 8, identity: 0.765

cgaccaataacaaactaacagacgatcgcatcaa	CRISPR spacer
agatgaataacaaactaacagacgaacgcgtttc	Protospacer
 **. ******************** ***.*.  

77. spacer 2.20|322762|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP050070 (Klebsiella aerogenes strain 035 plasmid p35_C, complete sequence) position: , mismatch: 8, identity: 0.75

tctatgtattcatcaaaaagttcttttatcgt	CRISPR spacer
ccgatgtatttatcaataagttctttactgtt	Protospacer
.* *******.***** *********  *  *

78. spacer 2.20|322762|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP040996 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed4) position: , mismatch: 8, identity: 0.75

tctatgtattcatcaaaaagttcttttatcgt	CRISPR spacer
ccgatgtatttatcaataagttctttactgtt	Protospacer
.* *******.***** *********  *  *

79. spacer 2.20|322762|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP026209 (Escherichia coli strain ECONIH5 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctatgtattcatcaaaaagttcttttatcgt	CRISPR spacer
ccgatgtatttatcaataagttctttactgtt	Protospacer
.* *******.***** *********  *  *

80. spacer 2.20|322762|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP030875 (Raoultella sp. X13 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctatgtattcatcaaaaagttcttttatcgt	CRISPR spacer
ccgatgtatttatcaataagttctttactgtt	Protospacer
.* *******.***** *********  *  *

81. spacer 2.20|322762|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP024432 (Klebsiella pneumoniae strain DA48896 plasmid p48896_3, complete sequence) position: , mismatch: 8, identity: 0.75

tctatgtattcatcaaaaagttcttttatcgt	CRISPR spacer
ccgatgtatttatcaataagttctttactgtt	Protospacer
.* *******.***** *********  *  *

82. spacer 2.20|322762|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP011864 (Enterobacter asburiae strain ATCC 35953 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.75

tctatgtattcatcaaaaagttcttttatcgt	CRISPR spacer
ccgatgtatttatcaataagttctttactgtt	Protospacer
.* *******.***** *********  *  *

83. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacgaactaacagacgacgttttgga	Protospacer
*********.*************.  . * .*

84. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacgaactaacagacgacgttttgga	Protospacer
*********.*************.  . * .*

85. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaataacgaactaacagacgacgttttgga	Protospacer
*********.*************.  . * .*

86. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to NC_004813 (Enterobacteria phage BP-4795, complete genome) position: , mismatch: 8, identity: 0.75

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaatagcaaactaacagacgaatacgtttc	Protospacer
*******.*************** ..*.*.  

87. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to AJ556162 (Phage BP-4795 complete genome) position: , mismatch: 8, identity: 0.75

accaataacaaactaacagacgatcgcatcaa	CRISPR spacer
accaatagcaaactaacagacgaatacgtttc	Protospacer
*******.*************** ..*.*.  

88. spacer 2.32|323495|32|CP034233|CRISPRCasFinder,CRT matches to MK448721 (Streptococcus phage Javan263, complete genome) position: , mismatch: 8, identity: 0.75

attttttgatgagcaatcttgacaaaattaat	CRISPR spacer
aagatgtgatgagtaatcttgtcaaaattgaa	Protospacer
*   * *******.******* *******.* 

89. spacer 2.32|323495|32|CP034233|CRISPRCasFinder,CRT matches to JX560968 (Escherichia phage EC6, complete genome) position: , mismatch: 8, identity: 0.75

-----attttttgatgagcaatcttgacaaaattaat	CRISPR spacer
cagctactt-----tgagcaatcttgctaaaattaat	Protospacer
     *.**     ************ .*********

90. spacer 2.32|323495|32|CP034233|CRISPRCasFinder,CRT matches to MG065664 (UNVERIFIED: Campylobacter phage A132, complete genome) position: , mismatch: 8, identity: 0.75

-----attttttgatgagcaatcttgacaaaattaat	CRISPR spacer
tagctactt-----tgagcaatcttgctaaaattaat	Protospacer
     *.**     ************ .*********

91. spacer 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 9, identity: 0.719

cgctgcgagg-ccgtgaccatgttttcagtacc	CRISPR spacer
-attgaaaagtccgtgaccatgttttaagtatg	Protospacer
 ..** .*.* *************** ****. 

92. spacer 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_021780 (Salmonella phage FSL SP-088, complete genome) position: , mismatch: 9, identity: 0.719

cgctgcgaggccgtgaccatgttttcagtacc	CRISPR spacer
ccacgtctggccttgaccatgttttgagtaca	Protospacer
*  .*.  **** ************ ***** 

93. spacer 1.16|305629|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KC139515 (Salmonella phage FSL SP-124, complete genome) position: , mismatch: 9, identity: 0.719

cgctgcgaggccgtgaccatgttttcagtacc	CRISPR spacer
ccacgtctggccttgaccatgttttgagtaca	Protospacer
*  .*.  **** ************ ***** 

94. spacer 1.20|305874|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719

ccatttgctcgccgttccggccgagttctgag	CRISPR spacer
accagtgctcgccgttccagacgagttcgtcg	Protospacer
 *   *************.* *******   *

95. spacer 1.22|305996|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to KT264824 (Gokushovirus WZ-2015a isolate 76Mky15, complete genome) position: , mismatch: 9, identity: 0.719

gtgagcgaattatcagtagtttcattggtgtt	CRISPR spacer
atactgaaattatccgtagtttctttggtgta	Protospacer
.*.   .******* ******** ******* 

96. spacer 1.26|306240|33|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 9, identity: 0.727

tttttcgatgcgttcacgctccagacgttcggc	CRISPR spacer
catagagcggcgtccaggctccagacgttcggc	Protospacer
. *   *  ****.** ****************

97. spacer 1.26|306240|33|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 9, identity: 0.727

tttttcgatgcgttcacgctccagacgttcggc	CRISPR spacer
catagagcggcgtccaggctccagacgttcggc	Protospacer
. *   *  ****.** ****************

98. spacer 1.26|306240|33|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 9, identity: 0.727

tttttcgatgcgttcacgctccagacgttcggc	CRISPR spacer
catagagcggcgtccaggctccagacgttcggc	Protospacer
. *   *  ****.** ****************

99. spacer 1.27|306302|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gaggcgcgcacggaggctgtgccgctacgtga	CRISPR spacer
gaggcgggcacagaggctgtgccaggtctcca	Protospacer
****** ****.***********.   * . *

100. spacer 1.29|306424|32|CP034233|CRISPRCasFinder,CRT matches to MN369756 (Gordonia phage Anon, complete genome) position: , mismatch: 9, identity: 0.719

tccgggagcgtgattacctgcccagcgggaaa	CRISPR spacer
agacgaagcgtgatcatctgcccagcgggcag	Protospacer
    *.********.*.************ *.

101. spacer 2.20|322762|32|CP034233|CRISPRCasFinder,CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 9, identity: 0.719

tctatgtattcatcaaaaagttcttttatcgt	CRISPR spacer
acctcgtatttatcagaaagttcttttaatct	Protospacer
 *. .*****.****.************ . *

102. spacer 2.22|322885|32|CP034233|CRISPRCasFinder,CRT matches to NC_011314 (Aliivibrio salmonicida LFI1238 plasmid pVSAL320, complete sequence) position: , mismatch: 9, identity: 0.719

accaataacaaactaacaggtgtagagcacaa	CRISPR spacer
gctaataacaaattaacaagtgtagatatccc	Protospacer
.*.*********.*****.*******   *  

103. spacer 2.22|322885|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP034239 (Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence) position: , mismatch: 9, identity: 0.719

accaataacaaactaacaggtgtagagcacaa	CRISPR spacer
gctaataacaaattaacaagtgtagatatccc	Protospacer
.*.*********.*****.*******   *  

104. spacer 2.24|323007|32|CP034233|CRISPRCasFinder,CRT matches to MK799832 (Synechococcus phage S-B05, complete genome) position: , mismatch: 9, identity: 0.719

accaataacaaactaacagacga---tcgcatcaa	CRISPR spacer
accaataacaatctaaaagacgaagtttatct---	Protospacer
*********** **** ******   *... *   

105. spacer 2.32|323495|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 9, identity: 0.719

attttttgatgagcaatcttgacaaaattaat	CRISPR spacer
agcgagtgatgagcaatcttgtcgaaattcgt	Protospacer
* .   *************** *.***** .*

106. spacer 2.32|323495|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 9, identity: 0.719

attttttgatgagcaatcttgacaaaattaat	CRISPR spacer
agcgagtgatgagcaatcttgtcgaaattcgt	Protospacer
* .   *************** *.***** .*

107. spacer 2.37|323800|32|CP034233|CRISPRCasFinder,CRT matches to MK765592 (Tortoise microvirus 41 isolate 41_SP_100, complete genome) position: , mismatch: 9, identity: 0.719

gatacatctgataatcccagggatttcgctaa	CRISPR spacer
gatacatctgataatccaagcgacaagataaa	Protospacer
***************** ** **.   .. **

108. spacer 2.37|323800|32|CP034233|CRISPRCasFinder,CRT matches to MK765657 (Tortoise microvirus 2 isolate 2_SP_12, complete genome) position: , mismatch: 9, identity: 0.719

gatacatctgataatcccagggatttcgctaa	CRISPR spacer
gatacatctgataatccaagcgacaagataaa	Protospacer
***************** ** **.   .. **

109. spacer 2.37|323800|32|CP034233|CRISPRCasFinder,CRT matches to MK765611 (Tortoise microvirus 59 isolate 59_SP_97, complete genome) position: , mismatch: 9, identity: 0.719

gatacatctgataatcccagggatttcgctaa	CRISPR spacer
gatacatctgataatccaagcgacaagataaa	Protospacer
***************** ** **.   .. **

110. spacer 2.37|323800|32|CP034233|CRISPRCasFinder,CRT matches to MW149100 (Microvirus sp. isolate gila21, complete genome) position: , mismatch: 9, identity: 0.719

gatacatctgataatcccagggatttcgctaa	CRISPR spacer
gatacatctgataatccaagcgacaagataaa	Protospacer
***************** ** **.   .. **

111. spacer 2.37|323800|32|CP034233|CRISPRCasFinder,CRT matches to MK765552 (Tortoise microvirus 2 isolate 2_SP_25, complete genome) position: , mismatch: 9, identity: 0.719

gatacatctgataatcccagggatttcgctaa	CRISPR spacer
gatacatctgataatccaagcgacaagataaa	Protospacer
***************** ** **.   .. **

112. spacer 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 10, identity: 0.688

gcgtagccttcgctgcagcgaatccgactcac	CRISPR spacer
ttgaagctttcgctgcagcgaatgcgagatct	Protospacer
 .* ***.*************** ***  . .

113. spacer 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 10, identity: 0.688

gcgtagccttcgctgcagcgaatccgactcac	CRISPR spacer
ttgaagctttcgctgcagcgaatgcgagatct	Protospacer
 .* ***.*************** ***  . .

114. spacer 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 10, identity: 0.688

gcgtagccttcgctgcagcgaatccgactcac	CRISPR spacer
ttgaagctttcgctgcagcgaatgcgagatct	Protospacer
 .* ***.*************** ***  . .

115. spacer 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

gcgtagccttcgctgcagcgaatccgactcac	CRISPR spacer
ttgaagctttcgctgcagcgaatgcgagatct	Protospacer
 .* ***.*************** ***  . .

116. spacer 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

gcgtagccttcgctgcagcgaatccgactcac	CRISPR spacer
ttgaagctttcgctgcagcgaatgcgagatct	Protospacer
 .* ***.*************** ***  . .

117. spacer 1.4|304897|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

gcgtagccttcgctgcagcgaatccgactcac	CRISPR spacer
ttgaagctttcgctgcagcgaatgcgagatct	Protospacer
 .* ***.*************** ***  . .

118. spacer 1.8|305141|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_019749 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.02, complete sequence) position: , mismatch: 10, identity: 0.688

cgatcgaccttaaaagcatattcaggcttcaa	CRISPR spacer
ttaaaactattaaaagcagattcaagcttcaa	Protospacer
. *  . . ********* *****.*******

119. spacer 1.20|305874|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 10, identity: 0.688

ccatttgctcgccgttccggccgagttctgag	CRISPR spacer
gatattgctcgccgagccggccgagttcgcga	Protospacer
    **********  ************  ..

120. spacer 2.20|322762|32|CP034233|CRISPRCasFinder,CRT matches to AP013980 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S31-C4, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

tctatgtattcatcaaaaagttcttttatcgt	CRISPR spacer
ttccagtcttcatcaacaagttcttttacttc	Protospacer
*..  ** ******** ***********.. .

121. spacer 2.34|323617|32|CP034233|CRISPRCasFinder,CRT matches to MK531536 (Acinetobacter baumannii strain MC1 plasmid pMC1.1, complete sequence) position: , mismatch: 10, identity: 0.688

ccatcagtgataaatgctgcaatcgcagtttt	CRISPR spacer
ttatcaatgataaatgctggaatcgatatcaa	Protospacer
..****.************ *****  .*.  

122. spacer 2.34|323617|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP027531 (Acinetobacter baumannii strain AR_0088 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccatcagtgataaatgctgcaatcgcagtttt	CRISPR spacer
ttatcaatgataaatgctggaatcgatatcaa	Protospacer
..****.************ *****  .*.  

123. spacer 2.34|323617|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP050386 (Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence) position: , mismatch: 10, identity: 0.688

ccatcagtgataaatgctgcaatcgcagtttt	CRISPR spacer
ttatcaatgataaatgctggaatcgatatcaa	Protospacer
..****.************ *****  .*.  

124. spacer 2.34|323617|32|CP034233|CRISPRCasFinder,CRT matches to LT605060 (Acinetobacter calcoaceticus strain NCTC7364 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688

ccatcagtgataaatgctgcaatcgcagtttt	CRISPR spacer
ttatcaatgataaatgctggaatcgatatcaa	Protospacer
..****.************ *****  .*.  

125. spacer 2.34|323617|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP020596 (Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence) position: , mismatch: 10, identity: 0.688

ccatcagtgataaatgctgcaatcgcagtttt	CRISPR spacer
ttatcaatgataaatgctggaatcgatatcaa	Protospacer
..****.************ *****  .*.  

126. spacer 2.34|323617|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP040260 (Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccatcagtgataaatgctgcaatcgcagtttt	CRISPR spacer
ttatcaatgataaatgctggaatcgatatcaa	Protospacer
..****.************ *****  .*.  

127. spacer 2.34|323617|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP022285 (Acinetobacter baumannii strain 7804 plasmid pAba7804b, complete sequence) position: , mismatch: 10, identity: 0.688

ccatcagtgataaatgctgcaatcgcagtttt	CRISPR spacer
ttatcaatgataaatgctggaatcgatatcaa	Protospacer
..****.************ *****  .*.  

128. spacer 2.34|323617|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP012005 (Acinetobacter baumannii strain ATCC 17978-mff plasmid pAB3, complete sequence) position: , mismatch: 10, identity: 0.688

ccatcagtgataaatgctgcaatcgcagtttt	CRISPR spacer
ttatcaatgataaatgctggaatcgatatcaa	Protospacer
..****.************ *****  .*.  

129. spacer 2.34|323617|32|CP034233|CRISPRCasFinder,CRT matches to CP033562 (Acinetobacter nosocomialis strain 2010S01-197 plasmid p2010S01-197-1, complete sequence) position: , mismatch: 10, identity: 0.688

ccatcagtgataaatgctgcaatcgcagtttt	CRISPR spacer
ttatcaatgataaatgctggaatcgatatcaa	Protospacer
..****.************ *****  .*.  

130. spacer 2.38|323861|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP045342 (Vibrio sp. THAF190c plasmid pTHAF190c_d, complete sequence) position: , mismatch: 10, identity: 0.688

actaatacactgacaattgacgcaatccgcgc	CRISPR spacer
actaatacactgacaaattacgcgcttgataa	Protospacer
**************** * ****. *. ... 

131. spacer 1.3|304836|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 11, identity: 0.656

aaatcccctaaaggcatagccatcgccgatcg	CRISPR spacer
ggcagttctaaaggcatggccttcgccgatga	Protospacer
..   ..**********.*** ******** .

132. spacer 1.24|306118|32|CP034233|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 11, identity: 0.656

ctggggatctgcatggactcccgcacgttgcg	CRISPR spacer
accacgatcggcatggactaccgcacgtcctt	Protospacer
 . . **** ********* ********. . 

133. spacer 2.36|323739|32|CP034233|CRISPRCasFinder,CRT matches to NZ_CP026426 (Acinetobacter sp. ACNIH1 plasmid pACI-df08, complete sequence) position: , mismatch: 11, identity: 0.656

gattaacagtaaacccggggtcttctattcca	CRISPR spacer
atttaacagtaaacccgaagtcttcaggcttg	Protospacer
. ***************..****** . ....

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 65152 : 77743 13 uncultured_Caudovirales_phage(55.56%) NA NA
DBSCAN-SWA_2 780219 : 791529 13 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_3 1033033 : 1042204 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1116440 : 1122737 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_5 3645985 : 3692886 50 Burkholderia_phage(36.36%) tail,plate,tRNA NA
DBSCAN-SWA_6 4717738 : 4727966 11 uncultured_Caudovirales_phage(88.89%) protease,portal,tail,capsid,terminase,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage