1. spacer 3.63|986138|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatatccgcccatcggcc Protospacer
********************************
2. spacer 3.63|986138|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP029990 (Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence) position: , mismatch: 1, identity: 0.969
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc Protospacer
*******************.************
3. spacer 3.63|986138|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc Protospacer
*******************.************
4. spacer 3.63|986138|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc Protospacer
*******************.************
5. spacer 3.63|986138|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc Protospacer
*******************.************
6. spacer 2.17|965277|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_015969 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS02, complete sequence) position: , mismatch: 4, identity: 0.875
tcaataaaatcaatgataagcagtgtcgttaa CRISPR spacer
agaataaaatcaatgataagcagtgtcgtata Protospacer
*************************** *
7. spacer 2.17|965277|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 4, identity: 0.875
tcaataaaatcaatgataagcagtgtcgttaa CRISPR spacer
agaataaaatcaatgataagcagtgtcgtata Protospacer
*************************** *
8. spacer 3.55|985649|32|CP034232|CRISPRCasFinder,CRT matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 4, identity: 0.875
agcaatgattgaaaagctggcgataaacaagg CRISPR spacer
ggcaatgattgaaaagctggcggtgaacaagc Protospacer
.*********************.*.******
9. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
cctgccgtcgccgtcgccatatccg-gcgctgt CRISPR spacer
ccagccgtcgccgtcgccacatcggcacgctg- Protospacer
** ****************.*** * .*****
10. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
cctgccgtcgccgtcgccatatccg-gcgctgt CRISPR spacer
ccagccgtcgccgtcgccacatcggcacgctg- Protospacer
** ****************.*** * .*****
11. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
cctgccgtcgccgtcgccatatccg-gcgctgt CRISPR spacer
ccagccgtcgccgtcgccacatcggcacgctg- Protospacer
** ****************.*** * .*****
12. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
atggaac-aggcccaggctgcgcagcagcaaca CRISPR spacer
-tgccacgaggcccaggctgcgcagcagtaact Protospacer
** ** ********************.***
13. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 5, identity: 0.844
aggcgatcgacgcggaactggtgcgcggtgaa- CRISPR spacer
aggcgatcgacgcggcactggcgc-tgatgaag Protospacer
*************** *****.** .*.****
14. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 5, identity: 0.844
aggcgatcgacgcggaactggtgcgcggtgaa- CRISPR spacer
aggcgatcgacgcggcactggcgc-tgatgaag Protospacer
*************** *****.** .*.****
15. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 5, identity: 0.844
aggcgatcgacgcggaactggtgcgcggtgaa- CRISPR spacer
aggcgatcgacgcggcactggcgc-tgatgaag Protospacer
*************** *****.** .*.****
16. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 5, identity: 0.844
aggcgatcgacgcggaactggtgcgcggtgaa- CRISPR spacer
aggcgatcgacgcggcactggcgc-tgatgaag Protospacer
*************** *****.** .*.****
17. spacer 3.31|984185|32|CP034232|CRISPRCasFinder,CRT matches to KY065149 (Vibrio phage JSF7, complete genome) position: , mismatch: 5, identity: 0.844
atcg-gcatttctccaatcatgcagcatgcgca- CRISPR spacer
-tcgtacattgctccaatcatgctgcatg-gcac Protospacer
*** .**** ************ ***** ***
18. spacer 3.55|985649|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844
agcaatgattgaaaagctggcgataaacaagg CRISPR spacer
ggcgatgattgaaaagctggagataaacaaaa Protospacer
.**.**************** *********..
19. spacer 3.55|985649|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844
agcaatgattgaaaagctggcgataaacaagg CRISPR spacer
ggcgatgattgaaaagctggagataaacaaaa Protospacer
.**.**************** *********..
20. spacer 3.55|985649|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844
agcaatgattgaaaagctggcgataaacaagg CRISPR spacer
ggcgatgattgaaaagctggagataaacaaaa Protospacer
.**.**************** *********..
21. spacer 2.2|964362|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018723 (Thiomicrorhabdus aquaedulcis strain HaS4 plasmid pTmrp1, complete sequence) position: , mismatch: 6, identity: 0.812
aacgctaccacccggcagtaaaagagc-cgacg CRISPR spacer
aacgctaccacccgccattaaaactgcaccac- Protospacer
************** ** ***** ** * **
22. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF373841 (Mycobacterium phage Hurricane, complete genome) position: , mismatch: 6, identity: 0.812
cctgccgtc--gccgtcgccatatccggcgctgt CRISPR spacer
--cgacgtcgagccgtcgacagatccggcgctgt Protospacer
.* **** ******* ** ************
23. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF373841 (Mycobacterium phage Hurricane, complete genome) position: , mismatch: 6, identity: 0.812
cctgccgtc--gccgtcgccatatccggcgctgt CRISPR spacer
--cgacgtcgagccgtcgacagatccggcgctgt Protospacer
.* **** ******* ** ************
24. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF373841 (Mycobacterium phage Hurricane, complete genome) position: , mismatch: 6, identity: 0.812
cctgccgtc--gccgtcgccatatccggcgctgt CRISPR spacer
--cgacgtcgagccgtcgacagatccggcgctgt Protospacer
.* **** ******* ** ************
25. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010418 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50c, complete sequence) position: , mismatch: 6, identity: 0.812
atggaacaggcccaggctgcgcagcagcaaca- CRISPR spacer
atggaacaggcccaggctacccag-gcccacac Protospacer
******************.* *** . * ***
26. spacer 2.20|965460|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 6, identity: 0.812
tgcggcgcggtagttggcctacat--gatagcca CRISPR spacer
cgcggcgcggtaattggccgacatcggatagg-- Protospacer
.***********.****** **** *****
27. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812
tttgcgacatttatattaatgattataaatat CRISPR spacer
tatgcgacttttatattaacgattatagaaag Protospacer
* ****** **********.*******.* *
28. spacer 3.55|985649|32|CP034232|CRISPRCasFinder,CRT matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 6, identity: 0.812
agcaa-tgattgaaaagctggcgataaacaagg CRISPR spacer
-gcaacctatttaaaaggtggcgataaacaaag Protospacer
**** . *** ***** *************.*
29. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 6, identity: 0.812
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
gacatgcccggatcggcaccgcagccaatgac Protospacer
*.*. .**** * *******************
30. spacer 2.5|964545|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021084 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence) position: , mismatch: 7, identity: 0.781
ttgttgcaggcgggagaacgcagcgcgtaccc CRISPR spacer
aggttgcaggtgggtgaacgcagcgcccagcc Protospacer
********.*** *********** .* **
31. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to KM101122 (Mycobacterium phage Hades, complete genome) position: , mismatch: 7, identity: 0.781
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
cttgccgccggcgtcgccatatccgatgcggg Protospacer
*.*****.** **************..** *
32. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to KM101122 (Mycobacterium phage Hades, complete genome) position: , mismatch: 7, identity: 0.781
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
cttgccgccggcgtcgccatatccgatgcggg Protospacer
*.*****.** **************..** *
33. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to KM101122 (Mycobacterium phage Hades, complete genome) position: , mismatch: 7, identity: 0.781
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
cttgccgccggcgtcgccatatccgatgcggg Protospacer
*.*****.** **************..** *
34. spacer 2.9|964789|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027406 (Roseobacter denitrificans strain FDAARGOS_309 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
--ggccacttatcagcaaaccgggcatccagaac CRISPR spacer
atggcag--tatcagcaaacctggcatccagatt Protospacer
*** . ************ ********** .
35. spacer 2.9|964789|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_008386 (Roseobacter denitrificans OCh 114 plasmid pTB1, complete sequence) position: , mismatch: 7, identity: 0.781
--ggccacttatcagcaaaccgggcatccagaac CRISPR spacer
atggcag--tatcagcaaacctggcatccagatt Protospacer
*** . ************ ********** .
36. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 7, identity: 0.781
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
ccggcgcaggcgcaggctgcccagcagcaacg Protospacer
.** .***** ******** **********.
37. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
ccggcgcaggcgcaggctgcccagcagcaacg Protospacer
.** .***** ******** **********.
38. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 7, identity: 0.781
-atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
catcaggca-gcccaggcagcacagcagcaaca Protospacer
** ...** ******** **.***********
39. spacer 2.18|965338|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 7, identity: 0.781
agaatcgccagcggaaagagaaggggttagcg CRISPR spacer
tgaagccccagcggaaagagaaggggtttatc Protospacer
*** * ********************* ..
40. spacer 3.20|983514|32|CP034232|CRISPRCasFinder,CRT matches to MG592666 (Vibrio phage 2.096.O._10N.286.48.B5, partial genome) position: , mismatch: 7, identity: 0.781
ctggctaatctgcgtgttgatgttgtccatgc CRISPR spacer
tgagctaatctgcgtgttgctgttgtgagtgc Protospacer
. .**************** ****** .***
41. spacer 3.26|983880|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 7, identity: 0.781
cccccaccaaccccgcaccgc------gctggctaaaa CRISPR spacer
cgcccaccaaccccgcaccgctcgggggctgg------ Protospacer
* ******************* *****
42. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781
aggcgatcgacgcggaactggtg----cgcggtgaa CRISPR spacer
aggcgaccggcgcggaactggtgtcgccgccg---- Protospacer
******.**.************* *** *
43. spacer 3.34|984368|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.781
atggagcgcggtggttacatcggcgttccgga CRISPR spacer
gtggagcgcggtggtgacatcggcgtgaagac Protospacer
.************** ********** *.
44. spacer 3.34|984368|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
atggagcgcggtggttacatcggcgttccgga CRISPR spacer
gtggagcgcggtggtgacatcggcgtgaagat Protospacer
.************** ********** *.
45. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 7, identity: 0.781
tttgcgacatttatattaatgattataaatat CRISPR spacer
ttttttcgatttaaattattgattataaatat Protospacer
*** . ***** **** *************
46. spacer 3.39|984673|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ccagctcaatttcgccaaccttcgcgctaatg CRISPR spacer
taagctcaatttcgccaacctgtgcgtccatg Protospacer
. ******************* .***.. ***
47. spacer 3.50|985344|32|CP034232|CRISPRCasFinder,CRT matches to MN693696 (Marine virus AFVG_250M1082, complete genome) position: , mismatch: 7, identity: 0.781
caaatgaaaaatggtttaaagga----ggtctgtaa CRISPR spacer
caaatgaaaaagcgtttaaaggatcctggttt---- Protospacer
*********** ********** ***.*
48. spacer 3.50|985344|32|CP034232|CRISPRCasFinder,CRT matches to MN694110 (Marine virus AFVG_250M1083, complete genome) position: , mismatch: 7, identity: 0.781
caaatgaaaaatggtttaaagga----ggtctgtaa CRISPR spacer
caaatgaaaaagcgtttaaaggatcctggttt---- Protospacer
*********** ********** ***.*
49. spacer 3.50|985344|32|CP034232|CRISPRCasFinder,CRT matches to MN694066 (Marine virus AFVG_250M1081, complete genome) position: , mismatch: 7, identity: 0.781
caaatgaaaaatggtttaaagga---ggtctgtaa CRISPR spacer
caaatgaaaaagcgtttaaaggatctggtttt--- Protospacer
*********** ********** ***.*
50. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013255 (Kocuria flava strain HO-9041 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
agcgaacccgcaccggcaccccagcgcagggc Protospacer
.*********** ******* **** * *.*
51. spacer 3.63|986138|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgagaaacgcctggatctccgcccaccgccg Protospacer
*** . *********** ********.** *
52. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
gccgccgccgccgtcgccatatccgacggcca Protospacer
*.****.*****************.** .
53. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
gccgccgccgccgtcgccatatccgacggcca Protospacer
*.****.*****************.** .
54. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 8, identity: 0.75
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
cttctcgtcgccgccgccatagccggcgaagg Protospacer
*.* .********.******* ****** *
55. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
gccgccgccgccgtcgccatatccgacggcca Protospacer
*.****.*****************.** .
56. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
gccgccgccgccgtcgccatatccgacggcca Protospacer
*.****.*****************.** .
57. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 8, identity: 0.75
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
cttctcgtcgccgccgccatagccggcgaagg Protospacer
*.* .********.******* ****** *
58. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
gccgccgccgccgtcgccatatccgacggcca Protospacer
*.****.*****************.** .
59. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
gccgccgccgccgtcgccatatccgacggcca Protospacer
*.****.*****************.** .
60. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 8, identity: 0.75
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
cttctcgtcgccgccgccatagccggcgaagg Protospacer
*.* .********.******* ****** *
61. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022209 (Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
ccggcgctggcgcaggctgcccagcagcaacg Protospacer
.** .* *** ******** **********.
62. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009321 (Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
ccggcgctggcgcaggctgcccagcagcaacg Protospacer
.** .* *** ******** **********.
63. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022007 (Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence) position: , mismatch: 8, identity: 0.75
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
ccggcgctggcgcaggctgcccagcagcaacg Protospacer
.** .* *** ******** **********.
64. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
cgcggacacgccctggctgcgcagcagcttca Protospacer
*.*** **** ************** **
65. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to NC_007762 (Rhizobium etli CFN 42 plasmid p42a, complete sequence) position: , mismatch: 8, identity: 0.75
gaattcgttatttttaaacgaaat----cattatca CRISPR spacer
taattcgttattttaaaccgaaatacaacgtt---- Protospacer
************* ** ****** *.**
66. spacer 3.16|983270|32|CP034232|CRISPRCasFinder,CRT matches to NC_048827 (Vibrio phage vB_VchM_Kuja, complete genome) position: , mismatch: 8, identity: 0.75
ccaaaaaca---ttgagtgcttcttgtacgttcat CRISPR spacer
---aaattgtttttgtgtgcttcttgtactttcat Protospacer
*** .. *** ************* *****
67. spacer 3.20|983514|32|CP034232|CRISPRCasFinder,CRT matches to MG592458 (Vibrio phage 1.083.O._10N.286.52.B9, partial genome) position: , mismatch: 8, identity: 0.75
ctggctaatctgcgtgttgatgttgtccatgc CRISPR spacer
tgagctaacctgcgtgttgctgttgtgagtgc Protospacer
. .*****.********** ****** .***
68. spacer 3.21|983575|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.75
gtccctacaaccgggaccgcccgcccgaccag CRISPR spacer
cgccggtcgaccggcaccgcccgcccgacgag Protospacer
** *.***** ************** **
69. spacer 3.21|983575|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.75
gtccctacaaccgggaccgcccgcccgaccag CRISPR spacer
cgccggtcgaccggcaccgcccgcccgacgag Protospacer
** *.***** ************** **
70. spacer 3.25|983819|32|CP034232|CRISPRCasFinder,CRT matches to MN026741 (Salmonella phage Th1, complete genome) position: , mismatch: 8, identity: 0.75
ttaagaggagattatttgtggctaaaaattac CRISPR spacer
ttttcaggagattatatgtgcctaaaaactta Protospacer
** ********** **** *******.*
71. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 8, identity: 0.75
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
cgccgaccaacgcggaactggtgcgcggcacc Protospacer
* ***.*.*******************..
72. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NC_018532 (Arthrobacter sp. Rue61a plasmid p232, complete sequence) position: , mismatch: 8, identity: 0.75
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
cggtggtcgacgcggaactggtgcgagtcgcc Protospacer
**.*.******************* * .*
73. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
ccgccccagacgcagaactgctgcgcggtgaa Protospacer
** . *****.****** ***********
74. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 8, identity: 0.75
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
tgtcgtgcgaagcggaactgctgcgcggtggg Protospacer
* ** *** ********* *********..
75. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
-aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
cacatcaac-acgcgcaactggtgcgcggagaa Protospacer
* .. * * ***** ************* ***
76. spacer 3.33|984307|32|CP034232|CRISPRCasFinder,CRT matches to KX229736 (Campylobacter phage PC5, complete genome) position: , mismatch: 8, identity: 0.75
acaggtagatcatttattaatcagaattaaca CRISPR spacer
ttaggtagaacattttttaatcagaaaagata Protospacer
.******* ***** ********** .*.*
77. spacer 3.33|984307|32|CP034232|CRISPRCasFinder,CRT matches to KX879627 (Campylobacter phage vB_CjeM_Los1, complete genome) position: , mismatch: 8, identity: 0.75
acaggtagatcatttattaatcagaattaaca CRISPR spacer
ttaggtagaacattttttaatcagaaaagata Protospacer
.******* ***** ********** .*.*
78. spacer 3.33|984307|32|CP034232|CRISPRCasFinder,CRT matches to MH107028 (Campylobacter phage CP39, partial genome) position: , mismatch: 8, identity: 0.75
acaggtagatcatttattaatcagaattaaca CRISPR spacer
ttaggtagaacattttttaatcagaaaagata Protospacer
.******* ***** ********** .*.*
79. spacer 3.33|984307|32|CP034232|CRISPRCasFinder,CRT matches to NC_015464 (Campylobacter phage NCTC12673, complete genome) position: , mismatch: 8, identity: 0.75
acaggtagatcatttattaatcagaattaaca CRISPR spacer
ttaggtagaacattttttaatcagaaaagata Protospacer
.******* ***** ********** .*.*
80. spacer 3.33|984307|32|CP034232|CRISPRCasFinder,CRT matches to KX236333 (Campylobacter phage PC14, complete genome) position: , mismatch: 8, identity: 0.75
acaggtagatcatttattaatcagaattaaca CRISPR spacer
ttaggtagaacattttttaatcagaaaagata Protospacer
.******* ***** ********** .*.*
81. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP012500 (Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence) position: , mismatch: 8, identity: 0.75
tttgcgacatttatattaatgattataaatat CRISPR spacer
tagatgggatttattataatgattataaatat Protospacer
* ..*. ****** ****************
82. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP042296 (Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence) position: , mismatch: 8, identity: 0.75
tttgcgacatttatattaatgattataaatat CRISPR spacer
tagatgggatttattataatgattataaatat Protospacer
* ..*. ****** ****************
83. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP012499 (Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence) position: , mismatch: 8, identity: 0.75
tttgcgacatttatattaatgattataaatat CRISPR spacer
tagatgggatttattataatgattataaatat Protospacer
* ..*. ****** ****************
84. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to KJ018210 (Flavobacterium sp. phage 1/32, complete genome) position: , mismatch: 8, identity: 0.75
tttgcgacatttatattaatgattataaatat CRISPR spacer
ctaacgatatttatatgaatgattataatttg Protospacer
.* .***.******** *********** *
85. spacer 3.38|984612|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013047 (Serratia marcescens strain B3R3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgcgccattgctgagggtaaaccggcgatta CRISPR spacer
gcgcgccgttgctgagcgtaaaccaacgcggc Protospacer
*******.******** *******..**
86. spacer 3.38|984612|32|CP034232|CRISPRCasFinder,CRT matches to NC_015972 (Serratia marcescens strain B-6493 plasmid pSM22, complete sequence) position: , mismatch: 8, identity: 0.75
gcgcgccattgctgagggtaaaccggcgatta CRISPR spacer
gcgcgccgttgctgagcgtaaaccaacgcggc Protospacer
*******.******** *******..**
87. spacer 3.38|984612|32|CP034232|CRISPRCasFinder,CRT matches to CP041234 (Serratia marcescens subsp. marcescens ATCC 13880 plasmid pATCC, complete sequence) position: , mismatch: 8, identity: 0.75
gcgcgccattgctgagggtaaaccggcgatta CRISPR spacer
gcgcgccgttgctgagcgtaaaccaacgcggc Protospacer
*******.******** *******..**
88. spacer 3.47|985161|32|CP034232|CRISPRCasFinder,CRT matches to MK085976 (Bacillus phage AP631, complete genome) position: , mismatch: 8, identity: 0.75
attcaaaaattcaatatgaggttggaaatttt CRISPR spacer
ctaaaaaaattcaatataatgttggaaactgc Protospacer
* *************.* ********.* .
89. spacer 3.47|985161|32|CP034232|CRISPRCasFinder,CRT matches to NC_015417 (Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence) position: , mismatch: 8, identity: 0.75
attcaaaaattcaatatgaggttggaaatttt CRISPR spacer
attctaaaattcaatatgacgttttatataaa Protospacer
**** ************** *** * **
90. spacer 3.48|985222|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
gttgtgtgggtacagccggccagcgtcagcag CRISPR spacer
gcgacatgggtgcggccggccagcgtcagcac Protospacer
*. ...*****.*.*****************
91. spacer 3.48|985222|32|CP034232|CRISPRCasFinder,CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 8, identity: 0.75
gttgtgtgggtacagccggccagcgtcagcag CRISPR spacer
cgcgcgctggtccagcccgccagcgtcagcag Protospacer
.*.*. *** ***** **************
92. spacer 3.48|985222|32|CP034232|CRISPRCasFinder,CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 8, identity: 0.75
gttgtgtgggtacagccggccagcgtcagcag CRISPR spacer
gacatgaccgtacagacggtcagcgtcagcag Protospacer
* ..** ****** ***.************
93. spacer 3.50|985344|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP030069 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.4, complete sequence) position: , mismatch: 8, identity: 0.75
caaatgaaaaatggtttaaaggaggtctgtaa----- CRISPR spacer
aaaatgaaaaatggtataaagaa-----gtaagcgaa Protospacer
************** *****.* ****
94. spacer 3.50|985344|32|CP034232|CRISPRCasFinder,CRT matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 8, identity: 0.75
caaatgaaaaatggtttaaaggaggtctgtaa CRISPR spacer
gatataaaaaatggtttaatggaggtttctgt Protospacer
* **.************* ******.* *.
95. spacer 3.52|985466|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75
atcgaatgcttttgtgtgttctgctgccactt CRISPR spacer
atcgaaggcttttgtgagttctggatgtgctt Protospacer
****** ********* ****** ..***
96. spacer 3.52|985466|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75
atcgaatgcttttgtgtgttctgctgccactt CRISPR spacer
atcgaaggcttttgtgagttctggatgtgctt Protospacer
****** ********* ****** ..***
97. spacer 3.56|985710|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
catccccgcgcagcgctaacgtc-caggcatat CRISPR spacer
catccccgcgcagcgccagcgtctcgcgcgcg- Protospacer
****************.*.**** *. **...
98. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to NZ_AP014802 (Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351) position: , mismatch: 8, identity: 0.75
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ggccggttgccgctatctgcagctcgacgaca Protospacer
. *******.** ***************
99. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 8, identity: 0.75
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
tgtcggttgccgctatctgcagctcgacgaca Protospacer
. . *******.** ***************
100. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
acagccccggcaacggcaccgcagccgatgcc Protospacer
. * ** *****************.*** *
101. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_019731 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence) position: , mismatch: 9, identity: 0.719
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
tcatacgtcaccgtccccatatccggcgtact Protospacer
.* ****.***** ************. *
102. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctctatgtcgccgtcggcatctccggcgccat Protospacer
*.. .********** *** ********..*
103. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_019731 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence) position: , mismatch: 9, identity: 0.719
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
tcatacgtcaccgtccccatatccggcgtact Protospacer
.* ****.***** ************. *
104. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctctatgtcgccgtcggcatctccggcgccat Protospacer
*.. .********** *** ********..*
105. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_019731 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.03, complete sequence) position: , mismatch: 9, identity: 0.719
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
tcatacgtcaccgtccccatatccggcgtact Protospacer
.* ****.***** ************. *
106. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctctatgtcgccgtcggcatctccggcgccat Protospacer
*.. .********** *** ********..*
107. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
actcaccaggcccaggctgcccagcaccaggg Protospacer
*. * ************** ***** **. .
108. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021084 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence) position: , mismatch: 9, identity: 0.719
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
ggtggtcaggcccaggcggcgcaggagcatcc Protospacer
. *. *********** ****** **** *
109. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to LN610585 (Pseudomonas phage vB_PaeS_PAO1_Ab20, complete genome) position: , mismatch: 9, identity: 0.719
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
ctcacccaggcccaggctgcccaggagcacaa Protospacer
* . ************** *** **** *
110. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to KU356689 (Pseudomonas phage ZC01, complete genome) position: , mismatch: 9, identity: 0.719
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
cttacccaggcccaggctgcccaggagcacaa Protospacer
* . ************** *** **** *
111. spacer 2.21|965521|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015993 (Pseudomonas sp. TCU-HL1 plasmid pTCUH, complete sequence) position: , mismatch: 9, identity: 0.719
gatgatcgtttttttcgttacgtcgcgcaaat CRISPR spacer
gcttctcggttttttcgttacgttgcgcttta Protospacer
* * *** **************.****
112. spacer 2.21|965521|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015993 (Pseudomonas sp. TCU-HL1 plasmid pTCUH, complete sequence) position: , mismatch: 9, identity: 0.719
gatgatcgtttttttcgttacgtcgcgcaaat CRISPR spacer
gcttctcggttttttcgttacgttgcgcttta Protospacer
* * *** **************.****
113. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP030008 (Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204001, complete sequence) position: , mismatch: 9, identity: 0.719
gaattcgttatttttaaacgaaatcattatca CRISPR spacer
tttttcgttatttttcaacgaaataatcaggt Protospacer
************ ******** **.*
114. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP007513 (Bacillus bombysepticus plasmid pBb, complete genome) position: , mismatch: 9, identity: 0.719
gaattcgttatttttaaacgaaatcattatca CRISPR spacer
ggtggtgcaattttgaaacaaaatcattatca Protospacer
*. .*. ***** ****.************
115. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP015439 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence) position: , mismatch: 9, identity: 0.719
gaattcgttatttttaaacgaaatcattatca CRISPR spacer
ttcttcgttatatttaaacgcaatcaacggca Protospacer
******** ******** ***** .. **
116. spacer 3.7|982721|32|CP034232|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 9, identity: 0.719
tcgtttatagctgagaacaagctggcgctgat CRISPR spacer
caggtctctgctgcggacaagctggcgctgat Protospacer
. * *. . **** *.****************
117. spacer 3.13|983087|32|CP034232|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 9, identity: 0.719
tcgtttatagctgagaacaagctggcgctgat CRISPR spacer
caggtctctgctgcggacaagctggcgctgat Protospacer
. * *. . **** *.****************
118. spacer 3.26|983880|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP010728 (Phaeobacter inhibens strain P88 plasmid pP88_c, complete sequence) position: , mismatch: 9, identity: 0.719
cccccaccaaccccgcaccgcgctggctaaaa CRISPR spacer
cacccaccaacccgccaccgcgctgagcggca Protospacer
* *********** **********. ... *
119. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP024586 (Roseomonas sp. FDAARGOS_362 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
cagcgatcgacgcggagcaggtgcgctggtcc Protospacer
.**************.* ******* *
120. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP021796 (Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence) position: , mismatch: 9, identity: 0.719
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
acctcgccgacgaggaaccggtgcgcggtgat Protospacer
* . ..***** *****.************
121. spacer 3.33|984307|32|CP034232|CRISPRCasFinder,CRT matches to NC_017543 (Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence) position: , mismatch: 9, identity: 0.719
acaggtagatcatttattaatcagaattaaca CRISPR spacer
acaggttgatcatttaataatcacttaggata Protospacer
****** ********* ****** .*.*
122. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.719
tttgcgacatttatattaatgattataaatat CRISPR spacer
cagactacatttatattaaagattttaaacaa Protospacer
. .* ************* **** ****.*
123. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP029389 (Acinetobacter defluvii strain WCHA30 plasmid p1_010030, complete sequence) position: , mismatch: 9, identity: 0.719
tttgcgacatttatattaatgattataaatat CRISPR spacer
tagaaaccattttaattaatgattataaattt Protospacer
* . . ***** **************** *
124. spacer 3.48|985222|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.719
gttgtgtgggtacagccggccagcgtcagcag CRISPR spacer
gcaaccttcgtacagccggccaacgtcaacag Protospacer
*. .. * *************.*****.***
125. spacer 3.48|985222|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.719
gttgtgtgggtacagccggccagcgtcagcag CRISPR spacer
gcaaccttcgtacagccggccaacgtcaacag Protospacer
*. .. * *************.*****.***
126. spacer 3.48|985222|32|CP034232|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gttgtgtgggtacagccggccagcgtcagcag CRISPR spacer
gggtcatcggaacagccggccagcgacagcat Protospacer
* ..* ** ************** *****
127. spacer 3.48|985222|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719
gttgtgtgggtacagccggccagcgtcagcag CRISPR spacer
gggtcatcggaacagccggccagcgacagcat Protospacer
* ..* ** ************** *****
128. spacer 3.52|985466|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
atcgaatgcttttgtgtgttctgctgccactt CRISPR spacer
atcgaaggcttttgtgagttctggatgtgttt Protospacer
****** ********* ****** ...**
129. spacer 3.52|985466|32|CP034232|CRISPRCasFinder,CRT matches to MN855955 (Bacteriophage sp. isolate 57, complete genome) position: , mismatch: 9, identity: 0.719
atcgaatgcttttgtgtgttctgctgccactt CRISPR spacer
gtttaatgcctttgtgcgttctgctgcttcgg Protospacer
.*. *****.******.**********. *
130. spacer 3.52|985466|32|CP034232|CRISPRCasFinder,CRT matches to KJ010489 (Enterococcus phage IME-EFm1, complete genome) position: , mismatch: 9, identity: 0.719
-atcgaatgcttttgtgtgttctgctgccactt CRISPR spacer
tgcttgat-cttttgtgtttgctgctgccacta Protospacer
... .** ********* * ***********
131. spacer 3.53|985527|32|CP034232|CRISPRCasFinder,CRT matches to MN497415 (Vibrio phage vB_VhaM_VH-8, complete genome) position: , mismatch: 9, identity: 0.719
ggggcgt-caccatttttgaatttatcagccgc CRISPR spacer
-atacatacaccactgttgaatttatcagcctt Protospacer
. .*.* *****.* *************** .
132. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MH271319 (Rhodococcus UhSalsa, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
133. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to KT959213 (Rhodococcus phage TWAMP, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
134. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MH271297 (Rhodococcus phage Erik, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
135. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MH271309 (Rhodococcus phage Phrankenstein, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
136. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MF324904 (Rhodococcus phage RexFury, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
137. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MF324901 (Rhodococcus phage Naiad, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
138. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to KT990218 (Rhodococcus phage Lillie, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
139. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to KX550082 (Rhodococcus phage Natosaleda, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
140. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MK524495 (Rhodococcus phage Belenaria, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
141. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MH271299 (Rhodococcus phage Gollum, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
142. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MH271293 (Rhodococcus phage Bradshaw, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
143. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to NC_028677 (Rhodococcus phage CosmicSans, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
144. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MH271306 (Rhodococcus phage Nancinator, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
145. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MH271314 (Rhodococcus phage Swann, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
146. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MF324900 (Rhodococcus phage StCroix, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
147. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to KT375356 (Rhodococcus phage Rhodalysa, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
148. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MK524487 (Rhodococcus phage Espica, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
149. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to NC_016653 (Rhodococcus phage RER2, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
150. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MF324905 (Rhodococcus phage Alatin, complete genome) position: , mismatch: 9, identity: 0.719
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ccgacttagccgccataggcagctcgactcag Protospacer
**. .** ********* ********** .
151. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
gcggcacccgcagcggcaccacagccaaccgg Protospacer
* * *******.*******.*******. .
152. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
153. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
154. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
155. spacer 2.6|964606|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
156. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
157. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
158. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
159. spacer 2.7|964667|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
160. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
161. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
162. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
163. spacer 2.8|964728|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 10, identity: 0.688
cctgccgtcgccgtcgccatatccggcgctgt CRISPR spacer
ctcttggtcgccgtcgccatctcccgcgccag Protospacer
*.. . ************** *** ****..
164. spacer 2.11|964911|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.688
gtttgccgtatcttcgatcataccggaacggt CRISPR spacer
aacaggactatcttcgatcatatcggaaggga Protospacer
. . * **************.***** **
165. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK907268 (Escherichia phage vB_EcoS-26175II, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
166. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK809530 (Salmonella phage vB_SenS_SB6, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
167. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to LR597655 (Escherichia phage T5_ev219 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
168. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431732 (Bacteriophage T5-like pork29, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
169. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431731 (Bacteriophage T5-like pork27, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
170. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074468 (Salmonella phage rutana, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
171. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431738 (Bacteriophage T5-like poul149, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
172. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK907271 (Escherichia phage vB_EcoS-26175V, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
173. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to KY787212 (Salmonella phage BSP22A, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
174. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074461 (Salmonella phage smaug, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
175. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to KX017521 (Salmonella phage 118970_sal2, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
176. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT004791 (Salmonella phage vB_SenS-3, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
177. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_047835 (Escherichia phage OSYSP, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
178. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK907269 (Escherichia phage vB_EcoS-26175III, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
179. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MG065642 (UNVERIFIED: Campylobacter phage A148, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
180. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK972709 (Salmonella phage SE20, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
181. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MH370366 (Salmonella phage S113, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
182. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431736 (Bacteriophage T5-like chee130_1, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
183. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK947459 (Salmonella phage vB_SenS_SB13, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
184. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT833283 (Escherichia coli phage vB_EcoS_Ace, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
185. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074463 (Salmonella phage gmork, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
186. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_047754 (Escherichia phage APCEc03, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
187. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074467 (Salmonella phage falkor, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
188. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048760 (Salmonella phage Sepoy, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
189. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048855 (Phage NBEco002, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
190. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT653145 (Salmonella phage 8sent65, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
191. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK728824 (Salmonella phage Seabear, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
192. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431733 (Bacteriophage T5-like saus47N, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
193. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK770410 (Salmonella phage SE3, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
194. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431735 (Bacteriophage T5-like poul124, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
195. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074466 (Salmonella phage atrejo, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
196. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK907267 (Escherichia phage vB_EcoS-26175I, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
197. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074455 (Salmonella phage beppo, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
198. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431737 (Bacteriophage T5-like saus132, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
199. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_047999 (Salmonella phage SH9, partial genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
200. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to AP019559 (Escherichia phage SP15 DNA, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
201. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048145 (Salmonella phage 3-29, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
202. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK972707 (Salmonella phage SE24, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
203. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074460 (Salmonella phage bux, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
204. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048203 (Escherichia virus vB_Eco_mar003J3 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
205. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK907270 (Escherichia phage vB_EcoS-26175IV, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
206. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN316588 (Escherichia virus VEc33, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
207. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK972717 (Salmonella phage SE18, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
208. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431739 (Bacteriophage T5-like chee158, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
209. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048062 (Salmonella phage Sw2, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
210. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074457 (Salmonella phage rokbiter, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
211. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK867835 (Salmonella phage vB_SenS_SB9, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
212. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048871 (Salmonella phage oselot, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
213. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074464 (Salmonella phage bobsandoy, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
214. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MH370386 (Salmonella phage S147, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
215. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431740 (Bacteriophage T5-like cott162, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
216. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074456 (Salmonella phage polluks, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
217. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048011 (Salmonella phage S133, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
218. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048008 (Salmonella phage S126, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
219. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN994501 (Phage NBSal002, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
220. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431741 (Bacteriophage T5-like saus176N, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
221. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN187969 (Salmonella phage OSY-STA, partial genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
222. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MH370367 (Salmonella phage S114, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
223. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN379739 (Salmonella phage 1-19, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
224. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_027297 (Salmonella phage Stitch, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
225. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK972708 (Salmonella phage SE7, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
226. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MF431734 (Bacteriophage T5-like saus111K, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
227. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK050846 (Salmonella phage Seafire, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
228. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048869 (Salmonella phage fuchur, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
229. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MH370369 (Salmonella phage S116, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
230. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to CP000917 (Enterobacteria phage EPS7, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
231. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074452 (Salmonella phage vaffelhjerte, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
232. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048010 (Salmonella phage S132, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
233. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074453 (Salmonella phage misterkot, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
234. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK005300 (Salmonella phage STG2, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactagaaagta Protospacer
. *********** ***.******* *
235. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK947458 (Salmonella phage vB_SenS_SB10, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
236. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048000 (Salmonella phage LVR16A, partial genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
237. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_024139 (Escherichia phage vB_EcoS_FFH1, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
238. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN197465 (Salmonella phage 2-3, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
239. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN218191 (Salmonella phage 1-29, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
240. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_047885 (Bacteriophage T5-like chee24, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaaata Protospacer
. *********** ***.******* *
241. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MK972704 (Salmonella phage SE19, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacctcatcaactaggaagta Protospacer
. *********** ***.******* *
242. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048867 (Salmonella phage faergetype, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
243. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_031902 (Salmonella phage 100268_sal2, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
244. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MT074447 (Salmonella phage phagemcphageface, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
245. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048866 (Salmonella phage bombadil, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
246. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to MN218190 (Salmonella phage 9-29, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
247. spacer 2.14|965094|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_048149 (Salmonella phage 1-23, complete genome) position: , mismatch: 10, identity: 0.688
tatgagttttcaacatcaccaactagtcatgt CRISPR spacer
ctagagttttcaacttcatcaactaggaagta Protospacer
. *********** ***.******* *
248. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
249. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
250. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
251. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
252. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
253. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
254. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
255. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
256. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
257. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
258. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
259. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
260. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
261. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
262. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
263. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
264. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
265. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
266. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
267. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
268. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
269. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
270. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
271. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
272. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
273. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
274. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
275. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
276. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
277. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
278. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
279. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
280. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
281. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
282. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
283. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
284. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
285. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
286. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
287. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
288. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
289. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
290. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
291. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
292. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
293. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
294. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
295. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
296. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
297. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
298. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
299. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
300. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
301. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
302. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
303. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
304. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
305. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
306. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
307. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
gctcaccaggcccaggctgcccagcaccaggg Protospacer
.. * ************** ***** **. .
308. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to AP018814 (Enterobacteria phage T6 DNA, complete genome) position: , mismatch: 10, identity: 0.688
gaattcgtt-----atttttaaacgaaatcattatca CRISPR spacer
-----caccagtagatttagaaacgaaatcattatca Protospacer
*... **** *****************
309. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to MH550421 (Enterobacteria phage T6, complete genome) position: , mismatch: 10, identity: 0.688
gaattcgtt-----atttttaaacgaaatcattatca CRISPR spacer
-----caccagtagatttagaaacgaaatcattatca Protospacer
*... **** *****************
310. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to MK962750 (Shigella phage CM8, complete genome) position: , mismatch: 10, identity: 0.688
gaattcgtt-----atttttaaacgaaatcattatca CRISPR spacer
-----caccagtagatttagaaacgaaatcattatca Protospacer
*... **** *****************
311. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to FJ839692 (Enterobacteria phage RB14, complete genome) position: , mismatch: 10, identity: 0.688
gaattcgtt-----atttttaaacgaaatcattatca CRISPR spacer
-----caccggtagatttagaaacgaaatcattatca Protospacer
*... **** *****************
312. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to KX130862 (Shigella phage SHFML-26, complete genome) position: , mismatch: 10, identity: 0.688
gaattcgtt-----atttttaaacgaaatcattatca CRISPR spacer
-----caccagtagatttagaaacgaaatcattatca Protospacer
*... **** *****************
313. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to MK327929 (Escherichia phage D5505, complete genome) position: , mismatch: 10, identity: 0.688
gaattcgtt-----atttttaaacgaaatcattatca CRISPR spacer
-----caccagtagatttagaaacgaaatcattatca Protospacer
*... **** *****************
314. spacer 3.1|982355|32|CP034232|CRISPRCasFinder,CRT matches to NC_027404 (Yersinia phage PST, complete genome) position: , mismatch: 10, identity: 0.688
gaattcgtt-----atttttaaacgaaatcattatca CRISPR spacer
-----caccagtagatttagaaacgaaatcattatca Protospacer
*... **** *****************
315. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
tccgcatcgaggtggaactggtgcgcggcgcg Protospacer
***** *.***************.* .
316. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 10, identity: 0.688
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
gcaagatcgtcgcggaactgatgcgcgacgcg Protospacer
. . ***** **********.******..* .
317. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
tccgcatcgaggtggaactggtgcgcggcgcg Protospacer
***** *.***************.* .
318. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
gcaagatcgtcgcggaactgatgcgcgacgcg Protospacer
. . ***** **********.******..* .
319. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
gcaagatcgtcgcggaactgatgcgcgacgcg Protospacer
. . ***** **********.******..* .
320. spacer 3.29|984063|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 10, identity: 0.688
aggcgatcgacgcggaactggtgcgcggtgaa CRISPR spacer
gcaagatcgtcgcggaactgatgcgcgacgcg Protospacer
. . ***** **********.******..* .
321. spacer 3.33|984307|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP039148 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-5, complete sequence) position: , mismatch: 10, identity: 0.688
acaggtagatcatttattaatcagaattaaca CRISPR spacer
gaatatagatcctttattagtcagaattttgc Protospacer
. * .****** *******.********
322. spacer 3.34|984368|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 10, identity: 0.688
atggagcgcggtggttacatcggcgttccgga CRISPR spacer
gttcagcgccgtggttacatcggcattggcct Protospacer
.* ***** **************.**
323. spacer 3.34|984368|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 10, identity: 0.688
atggagcgcggtggttacatcggcgttccgga CRISPR spacer
gttcagcgccgtggttacatcggcattggcct Protospacer
.* ***** **************.**
324. spacer 3.34|984368|32|CP034232|CRISPRCasFinder,CRT matches to NC_002682 (Mesorhizobium japonicum MAFF 303099 plasmid pMLb, complete sequence) position: , mismatch: 10, identity: 0.688
atggagcgcggtggttacatcggcgttccgga CRISPR spacer
gttcagcgccgtggttacatcggcattggtct Protospacer
.* ***** **************.**
325. spacer 3.34|984368|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 10, identity: 0.688
atggagcgcggtggttacatcggcgttccgga CRISPR spacer
gttcagcgccgtggttacatcggcattggcct Protospacer
.* ***** **************.**
326. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NC_004349 (Shewanella oneidensis MR-1 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
tttgcgacatttatattaatgattataaatat CRISPR spacer
atcaaattttttattttaatgattaaaaatat Protospacer
*.. . . ***** ********** ******
327. spacer 3.47|985161|32|CP034232|CRISPRCasFinder,CRT matches to NC_028940 (Pectobacterium bacteriophage PM2, complete genome) position: , mismatch: 10, identity: 0.688
attcaaaaattcaatatgaggttggaaatttt CRISPR spacer
tttcaaaaatacaagatgaggttgtgcttcgg Protospacer
********* *** ********* . *.
328. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
329. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
330. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
ccggtccggttcgtctggttcaacaatttcat Protospacer
.. ..*.***************** ** **.
331. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
332. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
333. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
334. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
335. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
336. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
337. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
338. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
339. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
340. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
341. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
342. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
343. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
344. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
345. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
346. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
347. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
348. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
349. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
350. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
351. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
352. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
cccgtccggttcgtctggttcaacaatttcat Protospacer
.....*.***************** ** **.
353. spacer 3.51|985405|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 10, identity: 0.688
tttacctggttcgtctggttcaactatatcga CRISPR spacer
ccggtccggttcgtctggttcaacaatttcat Protospacer
.. ..*.***************** ** **.
354. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MN945902 (Rhodococcus phage Dinger, complete genome) position: , mismatch: 10, identity: 0.688
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ctgacttagccgccataggcagctcgactcag Protospacer
*.. .** ********* ********** .
355. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to MH316569 (Rhodococcus phage Shuman, complete genome) position: , mismatch: 10, identity: 0.688
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ctgacttagccgccataggcagctcgactcag Protospacer
*.. .** ********* ********** .
356. spacer 3.58|985832|32|CP034232|CRISPRCasFinder,CRT matches to KX712237 (Rhodococcus phage Partridge, complete genome) position: , mismatch: 10, identity: 0.688
ccatttttgccgccatatgcagctcgacgaca CRISPR spacer
ctgacttagccgccataggcagctcgactcag Protospacer
*.. .** ********* ********** .
357. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
358. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
359. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
360. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
361. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
362. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
363. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
364. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
365. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP009874 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH30 plasmid pKPN-b9c, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
366. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
367. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
368. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NC_020122 (Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
369. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
370. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
371. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
372. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
373. spacer 3.59|985893|32|CP034232|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgaacccgcaacggcaccgcagccaatgac CRISPR spacer
ttcaccatcgcaaccgcaccgcagacaatgat Protospacer
*. .****** ********* ******.
374. spacer 3.62|986076|33|CP034232|CRISPRCasFinder,CRT matches to MN693999 (Marine virus AFVG_250M363, complete genome) position: , mismatch: 10, identity: 0.697
ataaatctaatttatttgattagtagtgctaaa CRISPR spacer
ataaatctgatttatttgattggtcagatatat Protospacer
********.************.** . .. *
375. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
cgtgatcaggcccaggcggcgcagcacttcgg Protospacer
** *********** ******** . .
376. spacer 2.16|965216|32|CP034232|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656
atggaacaggcccaggctgcgcagcagcaaca CRISPR spacer
cgtgatcaggcccaggcggcgcagcacttcgg Protospacer
** *********** ******** . .
377. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MH697582 (Mycobacterium phage Ejimix, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
378. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MK967402 (Mycobacterium phage NihilNomen, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
379. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MN586029 (Mycobacterium phage Hannaconda, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
380. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
381. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
382. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MF919504 (Mycobacterium phage DmpstrDiver, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
383. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MH399772 (Mycobacterium phage Constella, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
384. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
385. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to JF937090 (Mycobacterium virus BAKA, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
386. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
387. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MK524521 (Mycobacterium phage Schatzie, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
388. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MF133445 (Mycobacterium phage Lucky2013, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
389. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MF072690 (Mycobacterium phage Porcelain, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
390. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
391. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to NC_041844 (Mycobacterium phage Optimus, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
392. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
393. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MK279849 (Mycobacterium phage Duke13, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
394. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to JF937101 (Mycobacterium virus LittleE, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
395. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MN183286 (Mycobacteriophage Yeet, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
396. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
397. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
398. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to NC_026584 (Mycobacterium phage Minerva, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
399. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MF919534 (Mycobacterium phage Superphikiman, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
400. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to NC_023690 (Mycobacterium phage Courthouse, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
401. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
402. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to NC_022067 (Mycobacterium phage Wanda, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
403. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MK524504 (Mycobacterium phage Hughesyang, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
404. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
405. spacer 3.30|984124|32|CP034232|CRISPRCasFinder,CRT matches to NC_028953 (Mycobacterium phage MiaZeal, complete genome) position: , mismatch: 11, identity: 0.656
tggatgtgtacgccgcctcgccggatgaggcg CRISPR spacer
tggaggtgtacgccgccgcgccgatcaccctc Protospacer
**** ************ *****. .. .
406. spacer 3.31|984185|32|CP034232|CRISPRCasFinder,CRT matches to MK368614 (Vibrio phage 2 TSL-2019, complete genome) position: , mismatch: 11, identity: 0.656
atcggcatttctccaatcatgcagcatgcgca CRISPR spacer
gaaggcgcttctccaatcatgcagcaaagctt Protospacer
. ***..****************** . .
407. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP007647 (Lactobacillus salivarius strain JCM1046 plasmid pMP1046A, complete sequence) position: , mismatch: 13, identity: 0.594
tttgcgacatttatattaatgattataaatat------ CRISPR spacer
------acatttataatgattaaaataaatgatagcgc Protospacer
********* *.** * ******.
408. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP011404 (Lactobacillus salivarius str. Ren plasmid pR1, complete sequence) position: , mismatch: 13, identity: 0.594
tttgcgacatttatattaatgattataaatat------ CRISPR spacer
------acatttataatgattaaaataaatgatagcgt Protospacer
********* *.** * ******.
409. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP020859 (Lactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence) position: , mismatch: 13, identity: 0.594
tttgcgacatttatattaatgattataaatat------ CRISPR spacer
------acatttataatgattaaaataaatgatagcgt Protospacer
********* *.** * ******.
410. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NC_007930 (Lactobacillus salivarius UCC118 plasmid pMP118, complete sequence) position: , mismatch: 13, identity: 0.594
tttgcgacatttatattaatgattataaatat------ CRISPR spacer
------acatttataatgattaaaataaatgatagcgt Protospacer
********* *.** * ******.
411. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_CP017108 (Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence) position: , mismatch: 13, identity: 0.594
tttgcgacatttatattaatgattataaatat------ CRISPR spacer
------acatttataatgattaaaataaatgatagcgt Protospacer
********* *.** * ******.
412. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to NZ_LT604075 (Lactobacillus salivarius isolate LPM01 plasmid II) position: , mismatch: 13, identity: 0.594
tttgcgacatttatattaatgattataaatat------ CRISPR spacer
------acatttataatgattaaaataaatgatagcgt Protospacer
********* *.** * ******.
413. spacer 3.36|984490|32|CP034232|CRISPRCasFinder,CRT matches to CP002037 (Lactobacillus salivarius CECT 5713 plasmid pHN3, complete sequence) position: , mismatch: 13, identity: 0.594
tttgcgacatttatattaatgattataaatat------ CRISPR spacer
------acatttataatgattaaaataaatgatagcgt Protospacer
********* *.** * ******.