Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034249 Klebsiella pneumoniae strain KP18-29 chromosome, complete genome 1 crisprs csa3,RT,cas3,DEDDh,DinG,WYL 0 1 9 0

Results visualization

1. CP034249
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034249_2 4497781-4497875 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034249_1 1.1|4013835|36|CP034249|CRISPRCasFinder 4013835-4013870 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
CP034249_1 1.1|4013835|36|CP034249|CRISPRCasFinder 4013835-4013870 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
CP034249_1 1.1|4013835|36|CP034249|CRISPRCasFinder 4013835-4013870 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 1.1|4013835|36|CP034249|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 1.1|4013835|36|CP034249|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 1.1|4013835|36|CP034249|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 445790 : 515168 74 uncultured_Caudovirales_phage(61.11%) integrase,tail,portal,protease,capsid,terminase,head,tRNA attL 463398:463415|attR 479393:479410
DBSCAN-SWA_2 1255886 : 1335013 85 Salmonella_phage(72.92%) lysis,transposase,integrase,tail,portal,capsid,plate,coat,head,tRNA attL 1254180:1254226|attR 1293963:1294009
DBSCAN-SWA_3 1743855 : 1750758 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_4 2732933 : 2743820 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_5 3002343 : 3069081 84 Enterobacteria_phage(20.0%) transposase,integrase,tail,holin,terminase attL 3002125:3002140|attR 3066387:3066402
DBSCAN-SWA_6 3445575 : 3531323 86 Salmonella_phage(50.0%) lysis,integrase,tail,portal,protease,capsid,plate,head,tRNA attL 3501099:3501117|attR 3531398:3531416
DBSCAN-SWA_7 3979650 : 4024925 64 Escherichia_phage(26.42%) lysis,integrase,coat,terminase,head,tRNA attL 3970953:3970999|attR 4021997:4022043
DBSCAN-SWA_8 4234484 : 4246138 13 Enterobacteria_phage(70.0%) NA NA
DBSCAN-SWA_9 4719041 : 4729720 14 Stx2-converting_phage(55.56%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage