Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024921 Bacillus sp. wens01 chromosome, complete genome 3 crisprs NA 1 1 0 0

Results visualization

1. CP024921
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024921_1 285-387 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024921_2 118204-118309 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024921_3 564689-564767 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP024921_1 1.1|322|29|CP024921|CRISPRCasFinder 322-350 29 CP024921.1 4062348-4062376 0 1.0

1. spacer 1.1|322|29|CP024921|CRISPRCasFinder matches to position: 4062348-4062376, mismatch: 0, identity: 1.0 

tgactgtacttgtgtataggatatgacct	CRISPR spacer
tgactgtacttgtgtataggatatgacct	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024921_3 3.1|564716|25|CP024921|CRISPRCasFinder 564716-564740 25 NZ_CP023526 Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence 143945-143969 5 0.8

1. spacer 3.1|564716|25|CP024921|CRISPRCasFinder matches to NZ_CP023526 (Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

accgaaagaaacgctgcacctgcat	CRISPR spacer
cagtaaataaacgctgcacctgcat	Protospacer
    *** *****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage