Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034338 Pseudomonas entomophila strain 1257 chromosome, complete genome 1 crisprs PD-DExK,WYL,cas3,DEDDh,DinG,csa3 0 1 6 0

Results visualization

1. CP034338
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034338_2 4529152-4529317 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034338_1 1.3|2326453|36|CP034338|CRT 2326453-2326488 36 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 110597-110632 8 0.778

1. spacer 1.3|2326453|36|CP034338|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.778

cggcgggctgggcgccgacaccatgaacggcggtgc	CRISPR spacer
aggcgacggcggcgccgacaccatcaacggcggggc	Protospacer
 ****.    ************** ******** **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1953910 : 2012806 64 uncultured_Caudovirales_phage(48.57%) head,tail,terminase,portal,protease,integrase,plate,capsid,holin,lysis,tRNA attL 1947805:1947835|attR 2017646:2017676
DBSCAN-SWA_2 2960954 : 3058389 110 Pseudomonas_phage(43.4%) head,tail,terminase,portal,integrase,plate,capsid,holin,tRNA attL 2980793:2980811|attR 3063131:3063149
DBSCAN-SWA_3 3493672 : 3532404 53 Pseudomonas_phage(62.16%) head,tail,terminase,portal,protease,integrase,capsid,holin attL 3516080:3516096|attR 3530378:3530394
DBSCAN-SWA_4 3804331 : 3813988 12 uncultured_Caudovirales_phage(80.0%) tRNA NA
DBSCAN-SWA_5 4599451 : 4708654 110 uncultured_Caudovirales_phage(25.58%) tail,protease,integrase,plate,holin,lysis,tRNA attL 4593896:4593912|attR 4636053:4636069
DBSCAN-SWA_6 4861642 : 4869415 10 Planktothrix_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage