Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034349 Staphylococcus aureus subsp. aureus strain 80wphwpl chromosome, complete genome 12 crisprs cas3,DEDDh,DinG,csa3,WYL 4 1 8 0

Results visualization

1. CP034349
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_1 600154-600246 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_2 664884-664983 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_3 752618-752702 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_4 810829-810908 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_5 876164-876249 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_6 1177667-1177759 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_7 1875867-1876009 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_8 1909961-1910044 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_9 1920624-1920815 Orphan NA
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_10 2103290-2103379 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_11 2180835-2180960 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034349_12 2707497-2707580 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034349_3 3.1|752644|33|CP034349|CRISPRCasFinder 752644-752676 33 CP034349.1 1002300-1002332 1 0.97
CP034349_3 3.1|752644|33|CP034349|CRISPRCasFinder 752644-752676 33 CP034349.1 2253553-2253585 1 0.97
CP034349_12 12.1|2707523|32|CP034349|CRISPRCasFinder 2707523-2707554 32 CP034349.1 2253522-2253553 1 0.969
CP034349_5 5.1|876194|26|CP034349|CRISPRCasFinder 876194-876219 26 CP034349.1 1994870-1994895 2 0.923
CP034349_5 5.1|876194|26|CP034349|CRISPRCasFinder 876194-876219 26 CP034349.1 2058556-2058581 2 0.923
CP034349_9 9.2|1920703|34|CP034349|CRT 1920703-1920736 34 CP034349.1 255710-255743 2 0.941
CP034349_9 9.2|1920703|34|CP034349|CRT 1920703-1920736 34 CP034349.1 335005-335038 2 0.941
CP034349_9 9.2|1920703|34|CP034349|CRT 1920703-1920736 34 CP034349.1 719479-719512 2 0.941
CP034349_9 9.2|1920703|34|CP034349|CRT 1920703-1920736 34 CP034349.1 752683-752716 2 0.941
CP034349_9 9.2|1920703|34|CP034349|CRT 1920703-1920736 34 CP034349.1 1028457-1028490 2 0.941
CP034349_9 9.2|1920703|34|CP034349|CRT 1920703-1920736 34 CP034349.1 1703275-1703308 2 0.941
CP034349_9 9.2|1920703|34|CP034349|CRT 1920703-1920736 34 CP034349.1 2219143-2219176 2 0.941
CP034349_9 9.2|1920703|34|CP034349|CRT 1920703-1920736 34 CP034349.1 2359387-2359420 2 0.941
CP034349_12 12.1|2707523|32|CP034349|CRISPRCasFinder 2707523-2707554 32 CP034349.1 752676-752707 2 0.938
CP034349_12 12.1|2707523|32|CP034349|CRISPRCasFinder 2707523-2707554 32 CP034349.1 1002390-1002421 2 0.938

1. spacer 3.1|752644|33|CP034349|CRISPRCasFinder matches to position: 1002300-1002332, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctgtgttggggccca	Protospacer
******************** ************

2. spacer 3.1|752644|33|CP034349|CRISPRCasFinder matches to position: 2253553-2253585, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttgggaccca	Protospacer
****************************.****

3. spacer 12.1|2707523|32|CP034349|CRISPRCasFinder matches to position: 2253522-2253553, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

4. spacer 5.1|876194|26|CP034349|CRISPRCasFinder matches to position: 1994870-1994895, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cgcggccccaacacagaagctggcgg	Protospacer
** ********************.**

5. spacer 5.1|876194|26|CP034349|CRISPRCasFinder matches to position: 2058556-2058581, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cggggccccaacacaaaagctggcgg	Protospacer
***************.*******.**

6. spacer 9.2|1920703|34|CP034349|CRT matches to position: 255710-255743, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

7. spacer 9.2|1920703|34|CP034349|CRT matches to position: 335005-335038, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

8. spacer 9.2|1920703|34|CP034349|CRT matches to position: 719479-719512, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

9. spacer 9.2|1920703|34|CP034349|CRT matches to position: 752683-752716, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

10. spacer 9.2|1920703|34|CP034349|CRT matches to position: 1028457-1028490, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

11. spacer 9.2|1920703|34|CP034349|CRT matches to position: 1703275-1703308, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

12. spacer 9.2|1920703|34|CP034349|CRT matches to position: 2219143-2219176, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

13. spacer 9.2|1920703|34|CP034349|CRT matches to position: 2359387-2359420, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

14. spacer 12.1|2707523|32|CP034349|CRISPRCasFinder matches to position: 752676-752707, mismatch: 2, identity: 0.938

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaacttgcattgcctgtagaatttct	Protospacer
******.****.********************

15. spacer 12.1|2707523|32|CP034349|CRISPRCasFinder matches to position: 1002390-1002421, mismatch: 2, identity: 0.938

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaacttgcattgcctgtagaatttct	Protospacer
******.****.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034349_1 1.1|600186|29|CP034349|CRISPRCasFinder 600186-600214 29 NZ_CP026273 Klebsiella oxytoca strain KONIH4 plasmid pKOX-ea2b, complete sequence 142439-142467 8 0.724

1. spacer 1.1|600186|29|CP034349|CRISPRCasFinder matches to NZ_CP026273 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-ea2b, complete sequence) position: , mismatch: 8, identity: 0.724

ccgcacaactgcataaatccctctaatcg	CRISPR spacer
attcacaactatataaatccctctaaatt	Protospacer
 . *******..************** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 697859 : 705680 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 717652 : 731790 15 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 814784 : 830428 25 Staphylococcus_phage(89.47%) integrase,terminase,coat attL 814625:814644|attR 830883:830902
DBSCAN-SWA_4 917765 : 966902 44 Bacillus_virus(22.22%) tRNA,protease,holin,transposase NA
DBSCAN-SWA_5 1003770 : 1012243 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1553068 : 1561380 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_7 1630817 : 1641779 8 uncultured_Mediterranean_phage(42.86%) tRNA,transposase NA
DBSCAN-SWA_8 1764907 : 1834405 67 Staphylococcus_phage(93.18%) tRNA,protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage