Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027712 Pseudomonas chlororaphis subsp. chlororaphis strain DSM 50083 chromosome, complete genome 2 crisprs DinG,csa3,cas3,PD-DExK,DEDDh,WYL 0 1 4 0

Results visualization

1. CP027712
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027712_1 416058-416169 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027712_2 2451811-2451926 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027712_2 2.1|2451852|34|CP027712|CRISPRCasFinder 2451852-2451885 34 NZ_CP014857 Lysinibacillus sphaericus III(3)7 plasmid, complete sequence 19494-19527 10 0.706
CP027712_2 2.1|2451852|34|CP027712|CRISPRCasFinder 2451852-2451885 34 NC_010381 Lysinibacillus sphaericus C3-41 plasmid pBsph, complete sequence 175028-175061 10 0.706
CP027712_2 2.1|2451852|34|CP027712|CRISPRCasFinder 2451852-2451885 34 MT075580 Lysinibacillus sphaericus strain SSII-1 plasmid pSSII-1, complete sequence 46825-46858 10 0.706
CP027712_2 2.1|2451852|34|CP027712|CRISPRCasFinder 2451852-2451885 34 NZ_CP014644 Lysinibacillus sphaericus strain OT4b.25 plasmid unnamed, complete sequence 79747-79780 10 0.706

1. spacer 2.1|2451852|34|CP027712|CRISPRCasFinder matches to NZ_CP014857 (Lysinibacillus sphaericus III(3)7 plasmid, complete sequence) position: , mismatch: 10, identity: 0.706

aacaatcgcaagatcgccacatcaatcggcttta	CRISPR spacer
gctcctaacaatatcgccacatcattcggcttaa	Protospacer
. .  * .*** ************ ******* *

2. spacer 2.1|2451852|34|CP027712|CRISPRCasFinder matches to NC_010381 (Lysinibacillus sphaericus C3-41 plasmid pBsph, complete sequence) position: , mismatch: 10, identity: 0.706

aacaatcgcaagatcgccacatcaatcggcttta	CRISPR spacer
gctcctaacaatatcgccacatcattcggcttaa	Protospacer
. .  * .*** ************ ******* *

3. spacer 2.1|2451852|34|CP027712|CRISPRCasFinder matches to MT075580 (Lysinibacillus sphaericus strain SSII-1 plasmid pSSII-1, complete sequence) position: , mismatch: 10, identity: 0.706

aacaatcgcaagatcgccacatcaatcggcttta	CRISPR spacer
gctcctaacaatatcgccacatcattcggcttaa	Protospacer
. .  * .*** ************ ******* *

4. spacer 2.1|2451852|34|CP027712|CRISPRCasFinder matches to NZ_CP014644 (Lysinibacillus sphaericus strain OT4b.25 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

aacaatcgcaagatcgccacatcaatcggcttta	CRISPR spacer
gctcctaacaatatcgccacatcattcggcttaa	Protospacer
. .  * .*** ************ ******* *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1316369 : 1404235 93 Pseudomonas_phage(41.18%) plate,tail,tRNA,protease NA
DBSCAN-SWA_2 1549870 : 1617979 80 uncultured_Caudovirales_phage(42.86%) tail,integrase,plate,terminase,protease attL 1545470:1545492|attR 1550270:1550292
DBSCAN-SWA_3 2309840 : 2361838 69 Pseudomonas_phage(52.94%) tail,terminase NA
DBSCAN-SWA_4 4379448 : 4385707 8 uncultured_Caudovirales_phage(83.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage